View
2
Download
0
Category
Preview:
Citation preview
UNIVERSIDADE POSITIVO
JÉSSICA APARECIDA VIESSER
SELEÇÃO E IDENTIFICAÇÃO DE BACTÉRIAS DEGRADADORAS DE
PETRÓLEO DA RIZOSFERA DE Panicum aquaticum Poir., POACEAE
CURITIBA
2015
i
JÉSSICA APARECIDA VIESSER
SELEÇÃO E IDENTIFICAÇÃO DE BACTÉRIAS DEGRADADORAS DE
PETRÓLEO DA RIZOSFERA DE Panicum aquaticum Poir., POACEAE
Dissertação apresentada como requisito para
obtenção do título de Mestre em Biotecnologia
Industrial, do Programa de Mestrado Profissional
em Biotecnologia Industrial, Universidade
Positivo.
Orientadora: Profª. Drª. Leila Teresinha Maranho
CURITIBA
2015
ii
Dados Internacionais de Catalogação na Publicação (CIP) Biblioteca da Universidade Positivo - Curitiba - PR
V665 Viesser, Jéssica Aparecida. Seleção e identificação de bactérias degradadoras de petróleo da rizosfera de Panicum aquaticum Poir., Poaceae / Jéssica Aparecida Viesser. ― Curitiba : Universidade Positivo, 2015. 82 f. : il.
Dissertação (mestrado) – Universidade Positivo, 2015. Orientação : Prof. Dr. Leila Teresinha Maranho.
1. Biorremediação. 2. Petróleo. 3. Micro-organismos. I. Maranho, Leila Teresinha. II. Título.
CDU 663.1
iii
AGRADECIMENTOS
Agradeço à Universidade Positivo pela oportunidade concedida com bolsa integral
para a realização do Mestrado Profissional em Biotecnologia Industrial.
Aos meus pais, Ana Maria e João, que sempre me apoiaram. Obrigada pelo amor e
carinho incondicional de vocês.
Aos meus irmãos, Marcel e Renan, pela paciência, amizade, conversas e pelos
ensinamentos em todos os momentos.
À minha querida família que sempre me apoiou e entendeu que minha ausência era
necessária. Amo vocês!
À Profaª. Drª. Leila Teresinha Maranho, meu exemplo na pesquisa. Agradeço pela
orientação, ensinamentos, amizade e incentivo desde a graduação. Obrigada por confiar em
meu trabalho e a me incentivar a nunca desistir, principalmente nos momentos mais difíceis.
Em especial aos meus amigos Tissiane, Wilson, Vanessa, Rafael e Agnes pela
amizade e conversas. Obrigada por serem tão gentis e generosos comigo.
Aos colegas Taís, Jefferson, Francini, Giuliana, Daniele e Jorgete pela amizade e
auxílio durante a realização das análises.
À Karla Preussler e à Alessandra Souza por sempre me incentivarem e entenderem a
minha ausência durante o período de trabalho.
Ao Laboratório de Biologia Molecular do Boticário (LABIM), especialmente à Ana e
à Marcela, pelo auxílio nas análises de quantificação de DNA e densidade ótica.
À Profª. Drª. Eliane Carvalho de Vasconcelos por me ensinar a utilizar o equipamento
de cromatografia a gás (GC).
À Profª. Drª. Márcia Regina Pincerati pela amizade e disponibilidade em me auxiliar
nas análises de biologia molecular.
À Msc. Ledyane Rocha Uriartt pela sua gentileza e disposição em realizar os testes
estatísticos.
Ao Profº. Msc. Eduardo Scopel Ferreira da Costa e à Profª. Drª. Susan Grace Karp
pelas considerações, críticas e sugestões na banca de qualificação deste trabalho, contribuindo
para a melhoria do mesmo.
E a todos que de alguma forma contribuíram para a realização deste trabalho.
iv
RESUMO
O petróleo é um composto orgânico originado a partir de deposições fósseis. Como um
dos principais componentes da matriz energética mundial, sua intensa exploração ocasiona
acidentes ambientais como os derramamentos no solo que comprometem a biodiversidade e a
saúde humana. Entre as estratégias desenvolvidas para a descontaminação de ambientes
poluídos, a biorremediação destaca-se como uma alternativa viável e, dentro desta, a
rizodegradação destaca-se por apresentar uma elevada concentração de micro-organismos
associados à rizosfera de plantas fitorremediadoras. As Poaceae possuem grande potencial
para a fitorremediação de solos contaminados com petróleo por intermédio de micro-
organismos rizosféricos que realizam a biodegradação do petróleo. Assim, o objetivo da
presente pesquisa foi de selecionar bactérias com potencial de degradação de petróleo, a partir
da rizosfera de Panicum aquaticum Poir., a qual demostrou tolerância ao crescer em solos
contaminados com petróleo. Foram isoladas nove bactérias, sendo caracterizadas
morfologicamente por meio da Coloração de Gram e identificadas molecularmente a nível
genérico. As bactérias 3, 6 e 7 foram selecionadas por apresentarem diferentes tempos de
crescimento e analisadas quanto ao potencial de degradação de petróleo por meio de testes de
degradação, sendo mensurados parâmetros como: pH, temperatura, oxigênio dissolvido,
condutividade elétrica, biomassa por gravimetria e densidade ótica, e cromatografia a gás
(GC). Das nove bactérias isoladas, sete são Gram-positivas e duas são Gram-negativas
apresentando diferentes morfologias. Cinco bactérias foram identificadas molecularmente,
pertencendo aos gêneros Sporosarcina sp. (bactéria 2), Bacillus sp. (bactérias 3 e 6),
Microbacterium sp. (bactéria 4) e Rhodococcus sp. (bactéria 7). Resultados obtidos nos testes
de degradação e GC revelaram que as três bactérias são promissoras quanto à degradação de
petróleo ao reduzirem a concentração dos compostos de petróleo, podendo ser utilizadas em
processos de biorremediação. A presente dissertação está dividida em três capítulos. O
primeiro capítulo consiste em uma revisão de literatura sobre os efeitos da contaminação de
petróleo sobre o crescimento e desenvolvimento das plantas, o segundo capítulo é uma
revisão de literatura sobre o potencial de uso da rizosfera na biorremediação de solos
contaminados com petróleo e o terceiro refere-se ao artigo científico resultante da presente
pesquisa.
Palavras-chave: Biorremediação. Rizodegradação. Petróleo. Micro-organismos.
v
ABSTRACT
Petroleum is an organic compound originated from fossil deposits. As a major
component of global energy, its intense exploitation causes environmental accidents such as
spills on the ground that compromise biodiversity and human health. Among the strategies
developed for the decontamination of polluted environments, bioremediation stands out as a
viable alternative and, within this, the rizodegradation stands out by having a high
concentration of micro-organisms in the rhizosphere of plants phytoremediator. The Poaceae
have great potential for phytoremediation of soils contaminated with petroleum through
rhizosphere microorganisms that carry out petroleum biodegradation. The objective of this
research was to select bacteria with petroleum degradation potential, from the rhizosphere of
Panicum aquaticum Poir., which demonstrated tolerance to grow with petroleum
contaminated soil. Nine bacteria were isolated, characterized morphologically by Gram
staining and molecularly identified to generic level. Bacteria 3, 6 and 7 were selected because
they presented different periods of growth and were analyzed for petroleum degradation
potential through degradation tests, measuring parameters such as pH, temperature, dissolved
oxygen, conductivity, biomass gravimetrically and by optical density, and gas
chromatography (GC). Of the nine bacterial isolates, five are Gram-positive and four are
Gram-negative, presenting different morphologies. Five bacteria were identified molecularly
belonging to the genera Sporosarcina sp. (bacteria 2), Bacillus sp. (bacterias 3 and 6),
Microbacterium sp. (bacteria 4) and Rhodococcus sp. (bacteria 7). Results of degradation and
GC tests revealed that the three bacteria are promising for petroleum degradation by reducing
concentracion of the petroleum compounds and may be used in bioremediation processes.
This dissertation is divided in three chapters. The first chapter consists of a literature review
on the effects of petroleum pollution on the growth and development of plants, the second
chapter is a literature review on the potential use of rhizosphere in bioremediation with
petroleum contaminated soil and the third relates to the resulting scientific article of this
research.
Keywords: Bioremediation. Rizodegradation. Petroleum. Microorganisms.
vi
LISTA DE ILUSTRAÇÕES
CAPÍTULO III
FIGURA 1 - Eletroforese em gel de agarose a 1,5% dos produtos de PCR das bactérias 2,
3, 4, 6 e 7 isoladas da rizosfera de Panicum aquaticum Poir. 2 (Bactéria 2);
3 (Bactéria 3); 4 (Bactéria 4); 6 (Bactéria 6); 7 (Bactéria 7); C- (Controle
Negativo de PCR); MM (Marcador de Massa Molecular – 100 pb)............37
FIGURA 2 - Eletroforese em gel de agarose a 1,5% dos produtos de PCR das bactérias 3
e 4 isoladas da rizosfera de Panicum aquaticum Poir. 3 (Bactéria 3); 4
(Bactéria 4); C- (Controle Negativo de PCR); MM (Marcador de Massa
Molecular – 100 pb)......................................................................................38
FIGURA 3 - Cromatogramas referentes às taxas de degradação de petróleo pelas bactérias
3 (Bacillus sp.), 6 (Bacillus sp.) e 7 (Rhodococcus sp.) isoladas da rizosfera
de Panicum aquaticum Poir. (a) T24 – bactéria 3. (b) T48 – bactéria 3. (c)
T24 – bactéria 6. (d) T48 – bactéria 6. (e) T24 – bactéria 7. (f) T48 –
bactéria 7.......................................................................................................44
vii
LISTA DE TABELAS
CAPÍTULO I
TABELA 1 - Relação dos efeitos da contaminação do petróleo sobre Magnoliophyta
(Angiospermas) e Pinophyta (Gimnospermas) .............................................. 7
CAPÍTULO III
TABELA 1 - Coloração de Gram, morfologia, tempo de crescimento e densidade ótica
(DO610) média dos inóculos de bactérias isoladas da rizosfera de
Panicum aquaticum Poir. ............................................................................. 36
TABELA 2 - Quantificação de DNA genômico extraído pelo método Fenol/Clorofórmio
de bactérias isoladas da rizosfera de Panicum aquaticum Poir.....................37
TABELA 3 - Identificação molecular das bactérias isoladas da rizosfera de
Panicum aquaticum Poir..............................................................................38
TABELA 4 - pH, temperatura (T), oxigênio dissolvido (OD), condutividade elétrica (CE),
biomassa por gravimetria (BG) e densidade ótica (DO610) durante os testes
de degradação de petróleo com as bactérias 3 (Bacillus sp.), 6 (Bacillus sp.)
e 7 (Rhodococcus sp.) nos diferentes intervalos de tempo (T0, T24, T48,
T72 e T96 h) ................................................................................................ 40
TABELA 5 - Tempos de retenção, áreas e taxas de degradação dos compostos presentes
no petróleo pelas bactérias 3, 6 e 7 isoladas da rizosfera de
Panicum aquaticum Poir. ............................................................................ 43
viii
LISTA DE ABREVIATURAS, SIGLAS E SÍMBOLOS
AN Ágar Nutriente
BG Biomassa por Gravimetria
CaCl2 Cloreto de cálcio
CE Condutividade Elétrica
células mL-1
Células por mililitro
C21H20BrN3 Brometo de etídeo
CH2Cl2 Diclorometano
C2H7NO2 Acetato de amônio
CO2 Dióxido de carbono
cm Centímetro
C- Controle negativo da PCR
DNA Ácido desoxirribonucléico
dNTP Desoxirribonucletotídeos fosfatados
DO Densidade Ótica
FeCl3 Cloreto de ferro (III)
g Grama
GC Cromatografia a Gás
g L-1
Gramas por litro
h Hora
KCl Cloreto de potássio
kg Quilograma
K2HPO4 Fosfato de potássio dibásico
L Litro
m Metro
M Molar
MgCl2 Cloreto de magnésio
mg L-1
Miligramas por litro
MgSO4.7H2O Sulfato de magnésio heptahidratado
Min Minuto
mL Mililitro
ix
mM Milimolar
MM Marcador de massa molecular
MnCl2 Cloreto de manganês (II)
mS cm-1
Milisiemens por centímetro
NaSO4 Sulfato de sódio anidro
(NH4)2SO4 Sulfato de amônio
ng µL-1
nanôgrama por microlitro
nm Nanômetro
OD Oxigênio Dissolvido
pb Pares de base
PCR Reação em Cadeia da Polimerase (Polimerase Chain Reaction)
pH Potencial Hidrogeniônico
rpm Rotações por minuto
T Temperatura
Tris-HCl (Hidroximetil)aminometano hidrocloreto
U Unidades
UV Ultravioleta
V Volts
v/v Volume por volume
ZnSO4 Sulfato de zinco
% Porcentagem
ºC Grau Celsius
µL Microlitro
µm Micrômetro
16S rRNA Gene que codifica a subunidade ribossômica menor
16S rDNA Subunidade do DNA ribossomal
SUMÁRIO
1 INTRODUÇÃO ................................................................................................................................... 1
CAPÍTULO I .......................................................................................................................................... 3
EFEITOS DA CONTAMINAÇÃO POR PETRÓLEO SOBRE O CRESCIMENTO E
DESENVOLVIMENTO DAS PLANTAS ............................................................................................. 3
1. Introdução .......................................................................................................................................... 3
2. Fitotoxicidade do petróleo ................................................................................................................. 5
3.Estratégias desenvolvidas pelas plantas que permitem sua sobrevivência em solos
contaminados com petróleo ................................................................................................................. 10
4. Conclusão ......................................................................................................................................... 11
5. Referências ........................................................................................................................................ 12
CAPÍTULO II ....................................................................................................................................... 17
A EFICIÊNCIA DA RIZOSFERA NA BIORREMEDIAÇÃO DE SOLOS CONTAMINADOS COM
PETRÓLEO ........................................................................................................................................... 17
1. Introdução ........................................................................................................................................ 17
2. Biorremediação ................................................................................................................................ 20
3. Fitorremediação e rizodegradação ................................................................................................. 21
4. Controle rizosférico da biodegradação de compostos de petróleo ............................................... 22
5. Conclusões ......................................................................................................................................... 23
6. Referências ........................................................................................................................................ 23
CAPÍTULO III ..................................................................................................................................... 30
SELEÇÃO E IDENTIFICAÇÃO DE BACTÉRIAS DEGRADADORAS DE PETRÓLEO DA
RIZOSFERA DE Panicum aquaticum Poir., POACEAE ...................................................................... 30
1. Introdução ........................................................................................................................................ 30
2. Materiais e métodos ......................................................................................................................... 32
3. Resultados e discussão ..................................................................................................................... 35
4. Conclusão .......................................................................................................................................... 45
5. Referências ........................................................................................................................................ 46
CONCLUSÕES .................................................................................................................................... 50
REFERÊNCIAS ................................................................................................................................... 51
ANEXO I ............................................................................................................................................... 61
ANEXO II ............................................................................................................................................. 75
ANEXO III ............................................................................................................................................ 79
1
1 INTRODUÇÃO
O petróleo é um dos principais componentes da matriz energética mundial. A indústria
de refino do petróleo é uma das maiores no mundo (GAYLARDE et al., 1999), fornecendo
subprodutos amplamente utilizados como combustíveis, lubrificantes, solventes, plásticos e
borrachas (BAKER, 1970; GAYLARDE et al., 1999). A região do Oriente Médio possui as
maiores reservas de petróleo, sendo a Arábia Saudita o maior produtor mundial de barris de
petróleo em 2013 (BRITISH PETROLEUM, 2014).
Originado a partir de grandes deposições fósseis, o petróleo é constituído
predominantemente por hidrocarbonetos alifáticos ou aromáticos, além de pequenas
quantidades de asfaltenos, resinas e baixas concentrações de níquel, ferro e vanádio (BAKER,
1970; GAYLARDE et al., 1999; VAN HAMME et al., 2003).
Nos últimos anos, acidentes envolvendo a contaminação dos ecossistemas por
hidrocarbonetos de petróleo estão se tornando frequentes (HUTCHINSON et al., 2001;
PANDEY et al., 2009; MOREIRA et al., 2013; BRAMLEY-ALVES et al., 2014) devido à
intensa exploração de petróleo (HUANG et al., 2005; DAS; MUKHERJEE, 2007;
GERHARDT et al., 2009). As principais causas desta contaminação são os derramamentos
acidentais, vazamentos de tanques e tubulações e a eliminação inadequada dos resíduos
gerados (CHAINEAU et al., 2003; WHITE et al., 2006). Quando presente no ambiente, o
petróleo gera consequências à biodiversidade e à saúde humana (XU et al., 2006; ZAFRA et
al., 2014), bem como compromete os recursos hídricos e o solo (WANG et al., 2008) por
causa da lenta biodegradação dos hidrocarbonetos (MICHEL et al., 2002).
Diante desta problemática, ressalta-se a necessidade de utilizar técnicas que visem à
descontaminação de ambientes atingidos pelo petróleo por meio da redução ou degradação do
contaminante. A rizodegradação é proposta como a técnica com maior potencial para
remediação de petróleo no solo (MA et al., 2009), pois as plantas e os micro-organismos
rizosféricos contribuem de forma mais efetiva para a ecorrestauração dos locais contaminados
com petróleo (DAVID; SHARON, 2009; LEE et al., 2012). No processo de rizodegradação,
as plantas são responsáveis por disponibilizar oxigênio e sintetizar, acumular e secretar
nutrientes e os micro-organismos, por sua vez, realizam a degradação do petróleo por
utilizarem-no como fonte de carbono, o que facilita o crescimento das plantas em ambientes
2
contaminados (CUNNINGHAM et al., 1996; GLICK, 2003; WALKER et al., 2003; KUIPER
et al., 2004; KHAN, 2005; GERHARDT et al., 2009; MENDES et al., 2013).
Entre as várias espécies de plantas empregadas na rizodegradação, as Poaceae
apresentam grande potencial para a descontaminação de solos contaminados por petróleo
(CUNNINGHAM et al., 1996; GLICK, 2003; MERKL et al., 2005), por apresentarem
crescimento rápido e raízes ramificadas que propiciam uma maior área para a colonização de
micro-organismos rizosféricos (CUNNINGHAM et al., 1996; GLICK, 2003; MERKL et al.,
2005). Assim, a hipótese da presente pesquisa é de que as bactérias extraídas da rizosfera de
Panicum aquaticum Poir., cujo crescimento ocorreu em solo contaminado com petróleo,
possuem potencial para degradar petróleo.
A presente dissertação está dividida em três capítulos. O primeiro capítulo consiste em
uma revisão de literatura sobre os efeitos da contaminação de petróleo sobre o crescimento e
desenvolvimento das plantas, seguindo as normas propostas pela revista Environmental
Pollution (Anexo I). O segundo capítulo é uma revisão de literatura sobre o potencial de uso
da rizosfera na biorremediação de solos contaminados com petróleo, estando de acordo com
as normas da revista FEMS Microbiology Reviews (Anexo II). O terceiro capítulo refere-se
ao artigo científico resultante da presente pesquisa proposto segundo as normas estabelecidas
pela revista FEMS Microbiology Letters (Anexo III).
3
CAPÍTULO I
Efeitos da contaminação por petróleo sobre o crescimento e desenvolvimento das
plantas
Jéssica Aparecida Viessera,b,c
e Leila Teresinha Maranhoa,d
a Departamento de Biotecnologia Industrial, Universidade Positivo, Rua Professor Pedro
Viriato Parigot de Souza, 5300, CEP 81.280-330 Curitiba, PR, Brasil. b
Autor para correspondência c e-mail: jessi.viesser@gmail.com
d e-mail: maranho@up.edu.br
RESUMO
O petróleo é o principal componente da matriz energética mundial. Nos últimos anos,
devido a sua intensa exploração, tornaram-se frequentes acidentes envolvendo a contaminação
do ambiente por hidrocarbonetos de petróleo. Efeitos tóxicos desta contaminação podem ser
observados nas plantas, as quais são capazes de desenvolver estratégias para tolerar e
sobreviver à presença do contaminante. O objetivo desta revisão é verificar a relação entre os
efeitos do petróleo sobre a fisiologia e estrutura das plantas, sendo relatados principalmente
efeitos negativos sobre a biomassa e alterações estruturais nas folhas e raízes. A presença do
petróleo no ambiente também pode favorecer a germinação de sementes e a produção da
biomassa de raízes e folhas. O conhecimento acerca destes efeitos proporciona melhor
entendimento sobre a contaminação, além de fornecer ferramentas que auxiliem no
desenvolvimento de estratégias para a remoção do poluente.
Palavras-chave: Poluição, Solo, Fitotoxicidade.
1. Introdução
O petróleo, originado a partir da transformação de grandes deposições fósseis, é
constituído predominantemente por hidrocarbonetos (alifáticos ou aromáticos), e em menores
quantidades por asfaltenos, resinas e baixas concentrações de níquel, ferro e vanádio (Baker,
1970; Gaylarde et al., 1999; Van Hamme et al., 2003). Sua maior produção localiza-se no
Oriente Médio, região à qual pertence a Arábia Saudita, considerada como o maior produtor
mundial de barris de petróleo (British Petroleum, 2014).
Nos últimos anos, acidentes envolvendo a contaminação dos ecossistemas por
hidrocarbonetos de petróleo estão se tornando frequentes (Hutchinson et al., 2001; Pandey et
4
al., 2009; Moreira et al., 2013; Bramley-Alves et al., 2014) como consequência da intensa
exploração e consumo de petróleo (Huang et al., 2005; Das e Mukherjee, 2007; Gerhardt et
al., 2009). Em 2013, o consumo mundial de petróleo foi de aproximadamente 91,3 milhões de
barris por dia, com crescimento de 1,4% em relação ao ano anterior (British Petroleum, 2014).
O petróleo é um poluente que pode persistir no ambiente por um longo período por
causa da lenta biodegradação dos hidrocarbonetos (Michel et al., 2002), sendo os efeitos
crônicos da poluição com petróleo pouco conhecidos (Strickland, 1990). As moléculas de alta
massa molecular, geralmente aromáticas, são as mais persistentes e responsáveis pelos efeitos
tóxicos mais duradouros (Escalante-Espinosa et al., 2005; Balachandran et al., 2012), tanto à
saúde humana quanto à biodiversidade, pois apresentam a capacidade de bioacumulação em
micro-organismos, animais e plantas, sendo relatados efeitos citotóxicos, genotóxicos,
carcinogênicos e mutagênicos (Xu et al., 2006; Zafra et al., 2014; Zhang et al., 2014).
A presença de petróleo no ambiente compromete os recursos hídricos e o solo (Wang
et al., 2008). A contaminação do solo por hidrocarbonetos de petróleo afeta de maneiras
distintas as plantas. Alterações fisiológicas (Baker, 1970; Pezeshki e DeLaune, 1993;
Pezeshki et al., 2000), estruturais (Merkl et al., 2004a; Merkl et al., 2005; Maranho et al.,
2006; Agbogidi et al., 2007; Farias et al., 2009; Maranho et al., 2009; Bona et al., 2011;
Bramley-Alves et al., 2014) e no crescimento e desenvolvimento das plantas (Lin e
Mendelssohn, 1998; Petukhov et al., 2000; Hernández-Valencia e Mager, 2003; Achuba,
2006; Peña-Castro et al., 2006; Shirdam et al., 2008; Peng et al., 2009; Gogosz et al., 2010
Inckot et al., 2011) são os efeitos mais relatados para diferentes espécies.
O que se constata é uma escassez de informações acerca da toxicidade do petróleo
sobre as plantas no solo, embora diversos artigos tenham investigado a biodegradação de
hidrocarbonetos de petróleo. Esse mesmo aspecto também foi apontado por Maranho et al.
(2006, 2009). Baker (1970) revisou os efeitos fitotóxicos de hidrocarbonetos de petróleo sobre
os processos fisiológicos em diversas espécies e Pezeshki et al. (2000) sintetizaram os efeitos
desta mesma contaminação sobre espécies de macrófitas.
O objetivo desta revisão foi sintetizar as informações existentes na literatura a fim de
relacionar os principais efeitos da contaminação por petróleo sobre as plantas – Pinophyta
(Gimnospermas) e Magnoliophyta (Angiospermas). Para tanto, realizou-se a busca de
informações em livros e artigos científicos de revistas especializadas que tratam do assunto.
5
2. Fitotoxicidade do petróleo
A toxicidade dos hidrocarbonetos está associada com a estrutura química e
hidrofobicidade das moléculas (Clark et al., 1997), sendo os compostos saturados e de baixo
peso molecular os mais tóxicos (Lin e Mendelssohn, 1998; Pezeshki et al., 2000). Após o
contato do petróleo com o ambiente, os efeitos tóxicos imediatos tendem a ser causados por
moléculas de baixa massa molecular por serem mais solúveis em água (Freedman, 1993). Em
longo prazo, os efeitos proporcionados pelo petróleo ocorrem devido à maior persistência de
moléculas de alta massa molecular, geralmente aromáticas (Escalante-Espinosa et al., 2005;
Balachandran et al., 2012). Zhang et al. (2014), ao estudarem a contaminação de petróleo em
solos, águas subterrâneas e vegetais, verificaram que hidrocarbonetos com baixo número de
carbonos (n-alcanos), provenientes do derramamento de petróleo no solo, foram as principais
moléculas responsáveis pela contaminação de Brassica chinensis L. e Apium graveolens L.
No ambiente, os efeitos da contaminação por petróleo variam de acordo com o tipo de
contaminante e a sua concentração, com a extensão da contaminação, o tipo de solo, a idade e
a espécie vegetal (Baker, 1970; Pezeshki et al., 2000; Kisic et al., 2009). A fitotoxicidade do
petróleo pode ocorrer devido ao contato direto deste sobre as plantas ou, de forma indireta,
quando está presente no solo (Pezeshki e DeLaune, 1993; Roy et al., 2003; Peña-Castro et al.,
2006). Os mecanismos destes impactos ocorrem: (1) pela ruptura das relações planta-solo, (2)
pelos impactos diretos no metabolismo das plantas, (3) pela toxicidade para as células vivas, e
(4) pela reduzida troca de oxigênio entre o ambiente e o solo (Lin e Mendelssohn, 1998).
Ao entrar em contato direto com as plantas, o petróleo promove alterações na
solubilidade e na permeabilidade das membranas celulares, reduz as trocas gasosas, ocasiona
clorose nas folhas e inibe a germinação de sementes (Pezeshki e DeLaune, 1993; Pezeshki et
al., 2000; Sangabriel et al., 2006). As taxas de transpiração e de fotossíntese são reduzidas
quando o petróleo recobre as folhas, bloqueando os estômatos e impedindo a difusão de
oxigênio para as raízes (Baker, 1970; Pezeshki e DeLaune, 1993; Pezeshki et al., 2000).
As propriedades do solo também são alteradas pela presença do petróleo, e resultam na
indisponibilidade de nutrientes e/ou no comprometimento da absorção daqueles que são
necessários para o crescimento e desenvolvimento das plantas (Anoliefo et al., 2003; Roy et
al., 2003). O solo contaminado apresenta menor capacidade de retenção de água (Roy et al.,
2003) e baixa disponibilidade de nutrientes e oxigênio (Pezeshki et al., 2000), proporcionando
um menor crescimento e menor produção de biomassa nas plantas (Hutchinson et al., 2001).
6
A germinação pode ser inibida por condições desfavoráveis do solo geradas pela
presença do petróleo. Os hidrocarbonetos de petróleo podem adentrar nas sementes e alterar
suas reações metabólicas (Chaîneau et al., 1997) como a inibição da atividade das enzimas
amilase e amido fosforilase (Achuba, 2006) ou recobrindo as sementes, o que impede a
captação de água e oxigênio, ocasionando a morte do embrião (Baker, 1970). Baixos índices
de germinação das sementes em solos contaminados com petróleo podem ser atribuídos ao
fato de muitas espécies, por exemplo, as gramíneas, apresentarem sementes com baixo tempo
de viabilidade quando comparadas com sementes de leguminosas (Merkl et al., 2004b; Gaskin
et al., 2008).
Embora a maioria dos estudos descrevam sobre os efeitos fitotóxicos dos
hidrocarbonetos de petróleo, a presença do contaminante no ambiente pode favorecer a
germinação de sementes (Salanitro et al., 1997; Rivera-Cruz e Trujillo-Nárcia, 2004; Liste e
Prutz, 2006; Gaskin et al., 2008; Farias et al., 2009) e a produção de biomassa das raízes
(Gaskin et al., 2008; Bramley-Alves et al., 2014) e folhas (Bramley-Alves et al., 2014). As
frações do petróleo podem atuar como auxinas, e assim, auxiliar no processo de germinação
das sementes (Baker, 1970; Salanitro et al., 1997; Rivera-Cruz e Trujillo-Nárcia, 2004).
Os efeitos fitotóxicos do petróleo foram avaliados por diferentes autores em diferentes
espécies, incluindo Magnoliophyta (Angiospermas) e Pinophyta (Gimnospermas). Na Tabela
1, a partir de uma varredura em literatura especializada, foram compilados os principais
efeitos relatados dos hidrocarbonetos de petróleo sobre o crescimento e desenvolvimento de
plantas expostas em solos contaminados. Os trabalhos são apresentados em ordem
cronológica.
7
Tabela 1
Relação dos efeitos fitotóxicos da contaminação de petróleo sobre Magnoliophyta (Angiospermas) e Pinophyta (Gimnospermas).
Divisão Família Espécie Hábito Efeitos observados Referência
M
agnoli
ophyta
(Angio
sper
ma)
Poaceae
Spartina alterniflora Loisel. e
Spartina patens (Aiton) Muhl.
Herbáceo
Morte das plantas
Lin e Mendelssohn,
1998
Poaceae Avena sativa L., Hordeum
vulgare L. e Secale cereale L.
Herbáceo Redução da germinação, biomassa
total e no comprimento das raízes
Petukhov et al., 2000
Poaceae Panicum maximum Jacq. Herbáceo Redução da biomassa e morte das
plantas
Hernández-Valencia e
Mager, 2003
Poaceae Calopogonium mucunoides
Desv. e Desmodium glabrum
(Mill.) DC.
Herbáceo Redução na germinação, altura das
plantas e biomassa seca
Merkl et al., 2004a
Poaceae e Cyperaceae Brachiaria brizantha (Hochst.
ex A. Rich.) Stapf e Cyperus
aggregatus (Willd.) Endl.
Herbáceo Encurtamento e espessamento das
raízes
Merkl et al., 2005
Fabaceae Vigna unguiculata (L.) Walp. Herbáceo Redução na germinação Achuba, 2006
8
Tabela 1 (continuação)
Divisão Família Espécie Hábito Efeitos observados Referência
Poaceae Cynodon dactylon (L.) Pers. Herbáceo Clorose nas folhas, redução no
crescimento das raízes e menor
número de folhas
Peña-Castro et al.,
2006
Poaceae Zea mays L. Herbáceo Redução na altura das plantas, no
diâmetro do caule e na área foliar
Agbogidi et al., 2007
Linaceae e Poaceae Linum usitatissimum L. e
Sorghum bicolor (L.) Moench
Herbáceo Redução na altura das plantas Shirdam et al., 2008
Fabaceae Erythrina crista-galli L. Arbóreo Redução na altura das plantas, na
quantidade de nódulos e alterações
estruturais nas raízes
Farias et al., 2009
Nyctaginaceae Mirabilis jalapa L. Arbusto Redução da biomassa Peng et al., 2009
Euphorbiaceae Jatropha curcas L. Arbusto Clorose nas folhas, redução no
crescimento e morte das plantas
Agamuthu et al., 2010
Myrtaceae Campomanesia xanthocarpa
Mart. ex O. Berg
Arbóreo Redução da biomassa, observação de
injúrias e morte das plantas
Gogosz et al., 2010
Mag
noli
ophyta
(Angio
sper
ma)
9
Tabela 1 (continuação)
Divisão Família Espécie Hábito Efeitos observados
Poaceae Echinochloa polystachya
(Kunth) Hitchc.
Herbáceo Redução no número, no comprimento
das folhas e na biomassa aérea e total
Lopes e Piedade,
2010
Euphorbiaceae e
Anarcadiaceae
Sebastiana commersoniana
(Baill.) L.B. Sm & Downs e
Schinus terebinthifolius Raddi
Arbóreo Alterações morfoanatônicas na raiz e
nas folhas
Bona et al., 2011
Fabaceae Mimosa pilulifera Benth. Arbusto Redução da biomassa aérea Inckot et al., 2011
Poaceae Poa foliosa (Hook. f.) Hook. f. Herbácea Redução na área foliar Bramley-Alves et al.,
2014
Podocarpaceae Podocarpus lambertii Klotzsch
ex Endl.
Arbóreo Redução da área foliar e
aumento da densidade estomática
Maranho et al., 2006
Podocarpaceae Podocarpus lambertii Klotzsch
ex Endl.
Arbóreo Traqueídes com menores dimensões Maranho et al., 2009
Referência
Pin
ophyta
(Gim
nosp
erm
a)
Mag
noli
ophyta
(Angio
sper
ma)
10
Foram encontrados 19 artigos (Tabela 1) que relatam a respeito dos efeitos dos
hidrocarbonetos de petróleo sobre as Magnoliophyta (Angiospermas) e Pinophyta
(Gimnospermas). Os principais efeitos ocorrem sobre a germinação de sementes, biomassa,
no comprimento das raízes e folhas e na arquitetura vegetal, podendo provocar ou não a morte
das plantas.
O grupo Magnoliophyta (Angiospermas) apresentou uma maior frequência nos
estudos relacionados, representando 89,47% do total. Estes estudos foram realizados em
condições experimentais em laboratório, o que justifica o uso de espécies herbáceas por estas
crescerem rapidamente. Em contrapartida, são escassos os estudos realizados em campo, no
local onde houve derramamento de petróleo, como os desenvolvidos por Maranho et al.
(2006, 2009) com Podocarpus lambertii Klotzsch ex Endl. (Pinophyta).
Dentre os 19 artigos encontrados, dez artigos (52,63%) investigam a tolerância e o
comportamento de espécies de Poaceae em solos contaminados com petróleo. O mesmo foi
constatado em estudos realizados por Chaîneau et al. (1997) e Merkl et al. (2005), que
também verificaram que os efeitos da contaminação por petróleo são mais estudados sobre as
espécies de Poaceae, sendo a redução da biomassa a principal toxicidade relatada.
Uma das justificativas para o estudo de espécies de Poaceae está relacionada ao fato
destas plantas apresentarem crescimento rápido e raízes ramificadas, o que propicia maior
área para a colonização de micro-organismos rizosféricos responsáveis pela biodegradação do
petróleo (Cunningham et al., 1996; Glick, 2003; Merkl et al., 2005). As raízes desempenham
um papel fundamental para tolerância e sobrevivência de plantas em solos contaminados com
petróleo, pois alterações morfológicas e no crescimento das raízes podem afetar diretamente a
degradação do petróleo pelos micro-organismos (Kuiper et al., 2004; Farias et al., 2009), bem
como comprometer a capacidade de crescimento e retenção de água e nutrientes, o que reduz
a produção de biomassa nas plantas (Hutchinson et al., 2001; Merkl et al., 2005).
3. Estratégias desenvolvidas pelas plantas que permitem sua sobrevivência em solos
contaminados com petróleo
As plantas adaptam-se rapidamente às mudanças ambientais que lhe são impostas
(Larcher, 2004), por isso o conhecimento acerca dos efeitos do petróleo sobre as plantas
permite uma avaliação mais concreta dos impactos do poluente no ambiente, bem como na
seleção de espécies tolerantes.
11
Quando presentes em ambientes contaminados com petróleo, as plantas podem
desenvolver respostas à escassez de água, oxigênio e nitrogênio a que estão sendo submetidas
como alterações estruturais nas raízes (Merkl et al., 2005; Farias et al., 2009; Bona et al.,
2011), folhas (Maranho et al., 2006; Agbogidi et al., 2007) e lenho (Maranho et al., 2009). As
alterações estruturais observadas por Merkl et al. (2005), Maranho et al. (2006, 2009),
Agbogidi et al. (2007), Farias et al. (2009) e Bona et al. (2011), foram consideradas segundo
estes autores, como estratégias desenvolvidas pelas plantas para tolerar os efeitos tóxicos do
petróleo e seus derivados.
A estrutura da raiz pode ser influenciada pelo contato direto com o petróleo presente
no solo. Merkl et al. (2005) verificaram que o solo contaminado com petróleo apresenta uma
maior resistência mecânica, o que impediu o crescimento das raízes de Brachiaria brizantha
(Hochst. ex A. Rich.) Stapf e Cyperus aggregatus (Willd.) Endl., porém propiciou o aumento
do diâmetro das raízes como uma estratégia contra o estresse hídrico. Resultados semelhantes
também foram observados por Farias et al. (2009) em Erythrina crista-galli L. como
alterações na organização das células da epiderme e a compactação de células que constituem
o córtex nas raízes dos indivíduos que cresceram em solos contaminados.
Exemplares de P. lambertii coletados em solo contaminado com petróleo
apresentaram uma tendência na redução das dimensões foliares e aumento na espessura das
folhas e densidade estomática. Os autores relacionam essa resposta como um mecanismo de
resistência contra a perda de água por transpiração (Maranho et al., 2006). Uma menor
disponibilidade de água também provocou reduções foliares em Zea mays L. (Agbogidi et al.,
2007).
O lenho de indivíduos de P. lambertii que foram expostos à poluição por petróleo
apresentaram seus elementos de condução do xilema (traqueídes) com menores dimensões de
comprimento, diâmetro e espessura quando comparados aos indivíduos controle, sugerindo
que a presença de traqueídes mais curtas pode ser uma alternativa para manter o transporte
hídrico, o qual foi prejudicado pela presença de petróleo nas raízes (Maranho et al., 2009).
4. Conclusão
A crescente exploração de petróleo tem provocado o derramamento deste nos recursos
hídricos e no solo, tornando-o um poluente persistente no ambiente. A realização de estudos
sobre os efeitos do petróleo na biota, principalmente em plantas, torna-se importante pelo fato
12
do papel ecológico das plantas como produtores primários, bem como na seleção de espécies
tolerantes. Uma vez tolerantes ao petróleo, estas plantas poderão ser utilizadas para o
desenvolvimento de técnicas de biorremediação de solos contaminados com petróleo, como a
fitorremediação e rizodegradação.
Referências
Achuba, F.I. 2006. The effect of sublethal concentrations of crude oil on the growth and
metabolism of Cowpea (Vigna unguiculata) seedlings. The Environmentalist 26, 17-20.
Agamuthu, P., Abioye, O.P, Aziz, A.A., 2010. Phytoremediation of soil contaminated with
used lubricating oil using Jatropha curcas. J. Hazard. Mater. 179, 891-894.
Anoliefo, G.O., Vwioko, D.E., Mpamah, P., 2003. Regeneration of Chromolaena odorata (L.)
K. & R. in crude oil polluted soil: A possible phytoremediating agent. Benin Science Digest
1, 9-16.
Agbogidi, O.M., Eruotor, P.G., Akparobi, S.O., 2007. Effects of crude oil levels in the growth
of maize (Zea mays L.). Am. J. Food Techn. 2, 529-535. f
Balachandran, C., Duraipandiyan, V., Balakrishna, K., Ignacimuthu, S., 2012. Petroleum and
polycyclic aromatic hydrocarbons (PAHs) degradation and naphthalene metabolism in
Streptomyces sp. (ERI-CPDA-1) isolated from oil contaminated soil. Bioresource Technol.
112, 83-90.
Baker, J.M. The effects of oils on plants. Environmental Pollution. England: Elsevier
Publishing Company Ltd. 1, 27-44, 1970.
Bona, C., Silva, M.B., Rezende, I.M., Santos, G.O., Souza, L.A., Inckot, R.C., 2011. Efeito do
solo contaminado com óleo diesel na estrutura da raiz e da folha de plântulas de Sebastiania
commersoniana (Euphorbiaceae) e Schinus terebinthifolius (Anacardiaceae). Acta bot. bras.
25, 277-285.
Bramley-Alves, J., Wasley, J., King, C.K., Powell, S., Robinson, S.A., 2014.
Phytoremediation of hydrocarbon contaminants in subantarctic soils: An effective
management option. J. Environ. Manage 142, 60-69.
British Petroleum (BP), 2014. BP Statistical Review of World Energy June 2014, London,
England.
Chaîneau, C.H., Morel, J.L., Oudot, J., 1997. Phytotoxicity and plant uptake of fuel oil
hydrocarbons. J. Environ. Qual. 26, 1478-1483.
Clark, R.B., 1997. Marine pollution. Oxford, Oxford University Press.
13
Cunningham, S.D., Anderson, T.A., Schwab, A.P., Hsu, F.C., 1996. Phytoremediation of soils
contaminated with organic pollutants. Adv. Agron. 56: 55-114.
Das, K., Mukherjee, A.K., 2007. Crude petroleum-oil biodegradation efficiency of Bacillus
subtilis and Pseudomonas aeruginosa strains isolated from a petroleum-oil contaminated soil
from North-East India. Bioresource Technol. 98, 1339–1345.
Escalante-Espinosa, E., Gallegos-Martínez, M.E., Favela-Torres, E., Gutiérrez-Rojas, M.,
2005. Improvement of the hydrocarbon phytoremediation rate by Cyperus laxus Lam.
inoculated with a microbial consortium in a model system. Chemosphere 59, 405-413.
Farias, V., Maranho, L.T., Vasconcelos, E.C., Carvalho Filho, M.A.S., Lacerda, L.G.,
Azevedo, J.A.M., Pandey, A., Soccol, C.R., 2009. Phytodegradation potential of Erythrina
crista-galli L., Fabaceae, in petroleum-contaminated soil. Appl. Biochem. Biotech. 157, 10-
22.
Freedman, B., 1993. Environmental ecology: the ecological effects of pollution, disturbance,
and other stresses. San Diego, Academic Press.
Gaskin, S., Soole, K., Bentham, R., 2008. Screening of Australian Native Grasses for
rhizoremediation of aliphatic hydrocarbon-contaminated soil. Int. J. Phytoremediation 10,
378-389.
Gaylarde, C.C., Bento, F.M., Kelley, J.,1999. Microbial contamination of stored hydrocarbon
fuels and its control. Rev. Microbiol. 30, 1-10.
Gerhardt, K.E., Huang, X., Glick, B.R., Greenberg, B.M., 2009. Phytoremediation and
rhizoremediation of organic soil contaminants: potential and challenges. Plant Sci. 176, 20–
30.
Glick, B.R., 2003. Phytoremediation: synergistic use of plants and bacteria to clean up the
environment. Biotechnol. Adv. 21, 383-393.
Gogosz, A.M., Bona, C., Santos, G.O., Botosso, P.C., 2010. Germination and initial growth of
Campomanesia xanthocarpa O. Berg. (Myrtaceae), in petroleum-contaminated soil and
bioremediated soil. Braz. J. Biol. 70, 977-986.
Hernández-Valencia, I., Mager, D., 2003. Uso de Panicum maximum y Brachiaria brizantha
para fitorremediar suelos contaminados con un crudo de petróleo liviano. Bioagro 15, 149-
155.
Huang, X., El-Alawi, Y., Gurska, J., Click, B.R., Greenberg, B.M., 2005. A multi-process
phytoremediation system for decontamination of persistent total petroleum hydrocarbons
(TPHs) from soils. Microchem. J. 81, 139-147.
Hutchinson, S.L., Banks, M.K., Schwab, A.P., 2001. Phytoremediation of aged petroleum
sludge: Effects of inorganic fertilizer. J. Environ. Qual. 30, 395-403.
14
Inckot, R.C, Santos, G.O., Souza, L.A, Bona, C. 2011. Germination and development of
Mimosa pilulifera in petroleum-contaminated soil and bioremediated soil. Flora, 261-266.
Kisic, I., Mesic, S., Basic, F., Brkic, V., Mesic, M., Durn, G., Zgorelec, Z., Bertovic, L., 2009.
The effect of drilling fluids and crude oil on some chemical characteristics of soil and crops.
Geoderma 149, 209-216.
Kuiper, I., Lagendijk, E.L., Bloemberg, G.V., Lugtenberg, B.J.J., 2004. Rhizoremediation: A
beneficial plant-microbe interaction. Mol. Plant. Microbe. In. 17, 6-15.
Larcher, W., 2004. Ecofisiologia Vegetal. São Carlos: Rima.
Lin, Q., Mendenssohn, I.A., 1998. The combined effects of phytoremediation and
biostimulation in enhancing habitat restoration and oil degradation of petroleum contaminated
wetlands. Ecol. Engi. 10, 263-274.
Liste, H., Prutz, I., 2006. Plant performance, dioxygenase-expressing rhizosphere bacteria,
and biodegradation of weathered hydrocarbons in contaminated soil. Chemosphere 62, 1411-
1420.
Lopes, A., Piedade, M.T.F., 2009. Estabelecimento de Echinochloa polystachya (H.B.K.)
Hitchcock (Poaceae) em solo de várzea contaminado com petróleo de Urucu. Acta Amazon.
39, 583-590.
Maranho, L.T., Galvão, F., Preussler, K.H., Muñiz, G.I.B., Kuniyoshi, Y.S., 2006. Efeitos da
poluição por petróleo na estrutura da folha de Podocarpus lambertii Klotzsch ex Endl.,
Podocarpaceae. Acta bot. bras. 20, 615-624.
Maranho, L.T., Dziedzic, M.A., Muñiz, G.I.B., Kuniyoshi, Y.S., Galvão, F., 2009. Effects of
the pollution by petroleum on the tracheids along the stem of Podocarpus lambertii Klotzsch
ex Endl., Podocarpaceae. Braz. J. Biol. 69, 263-269.
Merkl, N., Schultze-Kraft, R., Infante, C., 2004a. Phytoremediation in the tropics - The effect
of crude oil on the growth of tropical plants. Biorem. J. 8, 177-184.
Merkl, N., Schultze-Kraft, R., Infante, C. 2004b. Phytoremediation of petroleum-
contaminated soils in the tropics - Pre-selection of plant species from eastern Venezuela. J.
Appl. Bot. Food Qual. 78, 185-192.
Merkl, N., Schultze-Kraft, R., Infante, C., 2005. Phytoremediation in the tropics e influence
of heavy crude oil on root morphological characteristics of graminoids. Environ. Pollut. 138,
86-91.
Michel, J., Henry Jr., C.B., Thumm, S., 2002. Shoreline assessment and environmental
impacts from the M/T Westchester oil spill in the Mississippi River. Spill Sci. Technol Bull.
7: 155-161.
15
Moreira, I.T.A., Oliveira, O.M.C., Triguis, J.A., Queiroz, A.F.S., Barbosa, R.M., Anjos,
J.A.S.A., Reyes, C.Y., Silva, C.S., Trindade, M.C.L.F., Rios, M.C., 2013. Evaluation of the
effects of metals on biodegradation of total petroleum hydrocarbons. Microchem. J. 110, 215-
220.
Pandey, J., Chauhan, A., Jain, R.K., 2009. Integrative approaches for assessing the ecological
sustainability of in situ bioremediation. FEMS Microbiol. Rev. 33, 324-375.
Peña-Castro, J.M., Barrera-Figueroa, B.E., Fernández-Linares, L., Ruiz-Medrano, R.,
Xoconostle-Cázares, B., 2006. Isolation and identification of up-regulated genes in
bermudagrass roots (Cynodon dactylon L.) grown under petroleum hydrocarbon stress. Plant
Science 170, 724-731.
Peng, S., Zhou, Q., Cai, Z., Zhang, Z., 2009. Phytoremediation of petroleum contaminated
soils by Mirabilis Jalapa L. in a greenhouse plot experiment. J. Hazard. Mater. 168, 1490–
1496.
Petukhov,V.N., Fomchenkov, V.M., Chugunov, V.M., Kholodenko, V.P., 2000. Plant biotests
for soil and water contaminated with oil and oil products. Appl. Bioch. Microbiol. 36, 652-
655.
Pezeshki, S.R., DeLaune, R.D., 1993. Effect of crude oil on gas exchange functions of Juncus
roemerianus and Spartina alterniflora. Water Air Soil Pollut. 68, 461-468.
Pezeshki, S.R., Hester, M.W., Lin, Q., Nyman, J.A., 2000. The effects of oil spill and clean-
up on dominant US Gulf coast marsh macrophytes: a review. Environ. Pollut. 108, 129-139.
Rivera-Cruz, M.C, Trujillo-Narcía, A., 2004. Estudio de toxicidad vegetal em suelos com
petróleos nuevo e intemperizado. Interciencia 29: 369-376.
Roy, J.L., McGill, W.B., Lowen, H.A., Johnson, R.L., 2003. Relationship between water
repellency and native and petroleum-derived organic carbon in soils. J. Environ. Qual. 32,
583-590.
Salanitro, J., Dorn, P., Hueseman, M., Moore, K., Rhodes, I., Rice, L., Jackson, T., Viponnd,
M., Western, M., Wisniewsky, H., 1997. Crude oil hydrocarbon bioremediation and soil
ecotoxicity assessment. Environ. Sci. Technol. 31: 1769-1776.
Sangabriel, W., Ferrera-Cerrato, R., Trejo-Aguilar, D., Mendonza-López, M.R., Cruz-
Sánchez, J.S., López-Ortiz, C., Delgadillo-Martínez, J., Alarcón, A., 2006. Tolerancia y
capacidad de fitorremediación de combustóleo en el suelo por seis especies vegetales. Rev.
Int. Contam. Ambient. 22, 63-73.
Shirdam, R., Zand, A.D., Bidhendi, G.N., Mehrdadi, N., 2008. Phytoremediation of
hydrocarbon-contaminated soils with emphasis on the effect of petroleum hydrocarbons on
the growth of plant species. Phytoprotection 89, 21-29.
Strickland, R.M., 1990. The Pacific Northwest coast: fossil fuel frontier. Environ. J. 6, 25-77.
16
Van Hamme, J.D., Singh, A., Ward, O.P., 2003. Recent advances in petroleum microbiology.
Microbiol. Mol. Biol. Rev. 67, 503-549.
Xu, S.Y., Chen, Y.X., Wu, W.X., Wang, K.X., Lin, Q., Lian, X.Q., 2006. Enhanced
dissipation of phenanthrene and pyrene in spiked soils by combined plants cultivation. Sci.
Total Environ. 363, 206-215.
Wang, J., Zhang, Z., Su, Y., He, W., He, F., Song, H., 2008. Phytoremediation of petroleum
polluted soil. Pet. Sci. 5, 167-171.
Zafra, G., Absalón, A.E., Cuevas, M.D., Cortés-Espinosa, D.V., 2014. Isolation and selection
of a highly tolerant microbial consortium with potential for PAH biodegradation from heavy
crude oil-contaminated soils. Water Air Soil Pollut. 225: 1-18.
Zhang, J., Fan, S., Yang, J., Du, X., Li, F., Hou, H. 2014. Petroleum contamination of soil and
water, and their effects on vegetables by statistically analyzing entire data set. Sci. Total
Environ. 476-477, 258-265.
17
CAPÍTULO II
A eficiência da rizosfera na biorremediação de solos contaminados com petróleo
Rizosfera e biorremediação de solos contaminados com petróleo.
Jéssica Aparecida Viesser1,2
& Leila Teresinha Maranho1
Resumo
Nos últimos anos, impactos ambientais relacionados à contaminação dos ecossistemas
por petróleo têm se tornado frequentes. Quando em contato com o ambiente, o petróleo pode
proporcionar efeitos tóxicos à biodiversidade e à saúde humana, além de comprometer tanto
os recursos hídricos como terrestres. Entre as estratégias desenvolvidas para tratamento, a
biorremediação se destaca como alternativa viável e promissora e, dentro desta, a
rizodegradação é uma das técnicas que se destacam na descontaminação de ambientes
poluídos com petróleo devido à elevada concentração de micro-organismos associados à
rizosfera das plantas fitorremediadoras. Novos estudos devem direcionar-se para a seleção e
identificação de micro-organismos rizosféricos, além de entender os processos metabólicos
envolvidos na degradação, para posteriormente desenvolver consórcios microbianos e
produtos biotecnológicos que auxiliem na descontaminação ambiental.
Palavras-chave: hidrocarbonetos de petróleo; rizodegradação; bactéria; fungo.
Introdução
O petróleo é um composto orgânico originado a partir da transformação de grandes
deposições fósseis e constituído principalmente por hidrocarbonetos alifáticos ou aromáticos,
além de pequenas quantidades de asfaltenos, resinas e baixas concentrações de níquel, ferro e
vanádio (Baker, 1970; Gaylarde et al., 1999; Van Hamme et al., 2003). Sua composição pode
ser alterada devido à localização geográfica e às condições físicas, químicas e biológicas do
ambiente no qual foi originado (Van Hamme et al., 2003).
1 Mestrado Profissional de Biotecnologia Industrial, Universidade Positivo, Rua Professor Pedro Viriato Parigot de Souza,
5300, CEP 81.280-330 Curitiba, PR, Brasil. 2 Autor para correspondência - e-mail: jessi.viesser@gmail.com
18
A matriz energética mundial possui o petróleo como um dos seus principais
componentes. A indústria de refino do petróleo é uma das maiores no mundo (Gaylarde et al.,
1999), fornecendo subprodutos amplamente utilizados como combustíveis, lubrificantes,
solventes, plásticos e borrachas (Baker, 1970; Gaylarde et al., 1999). As maiores reservas
mundiais de petróleo localizam-se no Oriente Médio, região à qual pertence o maior produtor
mundial de barris de petróleo em 2013, a Arábia Saudita, seguida pela Rússia, Estados Unidos
e China (British Petroleum, 2014).
Devido à elevada demanda energética mundial e por produtos derivados do refino de
petróleo, a necessidade de utilizá-lo como matéria-prima aliada com a ineficiência dos
processos de exploração, transporte, refino, armazenamento e consumo deste têm provocado
vários danos ambientais, tanto em ecossistemas terrestres quanto em ecossistemas aquáticos
(Baker, 1970; Huang et al., 2005; Das & Mukherjee, 2007; Gerhardt et al., 2009). As
principais causas da contaminação por petróleo são os derramamentos acidentais, vazamentos
de tanques e tubulações e a eliminação inadequada dos resíduos gerados (Chaineau et al.,
2003; White et al., 2006).
Ao entrar em contato com o ambiente, o petróleo sofre alterações em suas
características originais, devido a fatores físicos e biológicos. Entretanto, essas
transformações são influenciadas pela interação do contaminante com as características do
ambiente que foi atingido (Sloan, 1999; Balachandran et al., 2012). O petróleo pode persistir
no ambiente por um longo período por causa da lenta biodegradação dos hidrocarbonetos
(Michel et al., 2002). Em longo prazo, os efeitos proporcionados pela contaminação por
petróleo ocorrem devido à maior persistência de moléculas de alta massa molecular,
geralmente aromáticas (Escalante-Espinosa et al., 2005; Balachandran et al., 2012).
A presença do petróleo no ambiente acarreta em consequências à saúde humana e à
biodiversidade, sendo relatados efeitos citotóxicos, genotóxicos, carcinogênicos e
mutagênicos (Xu et al., 2006; Zafra et al., 2014), bem como o comprometimento dos recursos
hídricos e do solo (Wang et al., 2008). A contaminação de águas subterrâneas é um dos
problemas gerados pela alta persistência de petróleo no solo (Rahman et al., 2002).
Pelo exposto, surge a necessidade de utilizar técnicas que visem à descontaminação de
ambientes atingidos pelo petróleo por meio da redução ou degradação do contaminante.
Técnicas físicas, químicas ou biológicas estão sendo utilizadas para minimizar os impactos
destas contaminações (Udell et al., 1995; Scullion, 2006; Pandey et al., 2009). Após
19
contaminar o solo, o petróleo pode ser removido através de processos químicos - oxidação
química, físicos - extração de vapores, e biológicos - atenuação natural e biorremediação
(Andrade et al., 2010; Balachandran et al., 2012).
As chances de degradação/remoção de um contaminante no ambiente são elevadas ao
combinar-se duas ou mais técnicas de tratamento (Kuiper et al., 2004; Huang et al., 2005). A
escolha de uma técnica que seja eficiente para o tratamento de um ambiente contaminado com
petróleo deve levar em consideração: (1) as características físicas, químicas e biológicas do
local; (2) a concentração do contaminante derramado; (3) o tempo necessário para que ocorra
a degradação ou remoção do contaminante e (4) o custo total (Andrade et al., 2010).
Os métodos químicos e físicos possuem os maiores custos e podem alterar as
características físico-químicas e biológicas do solo tratado, sendo assim recomendados para o
tratamento de pequenas áreas contaminadas (Khan, 2005; Gerhardt et al., 2009). Os processos
biológicos, por sua vez, apresentam baixo custo e não produzem subprodutos tóxicos, porém
são mais lentos quando comparados aos processos físicos e químicos (Atagana, 2011).
A rizodegradação é proposta como a técnica com maior potencial para remediação de
petróleo no solo (Ma et al., 2009). As plantas e bactérias rizosféricas contribuem de forma
mais efetiva para a ecorrestauração de sítios contaminados com petróleo (David & Sharon,
2009; Lee et al., 2012). Quando um micro-organismo rizosférico é isolado e reintroduzido no
ambiente com uma planta adequada, é possível otimizar o processo de biorremediação (Bisht
et al., 2010). As plantas realizam funções especializadas como, por exemplo, sintetizam,
acumulam e secretam um conjunto diversificado de nutrientes sem nenhuma exigência de
fonte de carbono exógena, assim as raízes podem regular a comunidade microbiana do solo na
sua vizinhança imediata (Walker et al., 2003). Já as bactérias podem facilitar o crescimento
das plantas diretamente ou indiretamente ao utilizarem o petróleo como um recurso energético
(Glick, 2003; Khan, 2005).
Embora o processo de rizodegradação ocorra naturalmente, este pode ser manejado
quando ocorre a exploração dos micro-organismos rizosféricos associados às plantas. Dessa
forma, o objetivo desta revisão é retratar a importância da biorremediação para a
descontaminação de ambientes, principalmente as potencialidades do uso da rizosfera
(rizodegradação) neste processo.
20
Biorremediação
A biorremediação baseia-se na exploração do potencial metabólico de organismos,
comumente plantas, bactérias e fungos para a atenuação dos efeitos tóxicos de poluentes
presentes no ar, solo e água por meio da transformação em produtos menos tóxicos, remoção
completa e imobilização do poluente (Vidali, 2001; Diaz, 2004; Parales & Haddock, 2004;
Pandey et al., 2009). Os micro-organismos, principalmente as bactérias, são os agentes mais
estudados na degradação de poluentes por apresentarem uma elevada diversidade metabólica
e rápida evolução genética (Diaz, 2004; Phale et al., 2007; Pandey et al., 2009).
As técnicas de biorremediação estão sendo amplamente empregadas, uma vez que os
custos são relativamente menores e a eficiência é maior quando comparadas às técnicas
químicas e físicas (Vidali, 2001; Watanabe, 2001; Paul et al., 2005; Pandey et al., 2009;
Omotayo et al., 2012). Estas podem ser realizadas tanto no local do acidente (in situ) ou fora
deste (ex situ), sendo as técnicas in situ as mais desejáveis por apresentarem baixo custo e
menor risco à saúde humana (Vidali, 2001; Pandey et al., 2009).
Fatores ambientais como as características físico-químicas do ambiente contaminado,
o tipo e a concentração do contaminante, a extensão da contaminação, a disponibilidade de
nutrientes no solo e a estrutura de comunidade microbiana são determinantes para o
desenvolvimento dos processos de biorremediação de solos (Leahy & Colwell, 1990; Morelli
et al., 2001; Coulon et al., 2005).
Durante a biorremedição, para acelerar o processo de degradação do poluente, podem
ser realizados os processos de bioaumentação e bioestimulação (Thomassin-Lacroix et al.,
2002; Pandey et al., 2009). No processo de bioaumentação há a adição de micro-organismos
derivados do próprio solo contaminado ou a partir de uma cultura estoque, capazes de
degradar o contaminante (Vidali, 2001; Pandey et al., 2009). Já a bioestimulação constitui-se
na introdução de nutrientes orgânicos e inorgânicos no solo contaminado (Thomassin-Lacroix
et al., 2002; Sarkar et al., 2005; Garcia-Blanco et al., 2007), para geração de um ambiente
propício para a degradação, por meio de alterações no pH, temperatura e aeração (Saito &
Magara, 2003; Luo et al., 2005) com o objetivo de promover um aumento da biomassa
microbiana presente no solo (Thomassin-Lacroix et al., 2002; Sarkar et al., 2005).
21
Fitorremediação e rizodegradação
As plantas também podem contribuir para o processo de descontaminação dos solos
denominando-se este de fitorremediação (Cunningham et al., 1996). A fitorremediação é uma
tecnologia na qual são utilizados plantas e micro-organismos associados às suas raízes
(rizosfera) para degradar, remover ou estabilizar contaminantes presentes no solo e na água
(Cunningham et al., 1996; Cunningham & Ow, 1996; Gerhardt et al., 2009). Em comparação
aos processos químicos e físicos, a fitorremediação demonstra ser mais vantajosa
especialmente por conta da sua elevada eficiência de descontaminação e baixo custo
(Cunningham et al., 1996; Glick, 2003).
A partir da fitorremediação é possível remediar solos contaminados com poluentes
orgânicos e inorgânicos tais como hidrocarbonetos de petróleo, metais pesados, resíduos
agroindustriais e solventes clorados. O tipo de contaminante, sua biodisponibilidade e as
propriedades do solo são fatores determinantes durante o processo de fitorremediação
(Cunningham & Ow, 1996). A seleção e a identificação de espécies fito-indicadoras são
realizadas a partir de estudos sobre a tolerância e comportamento das plantas em solos
contaminados (Maranho et al., 2006). Plantas que apresentam rápido crescimento, alta
produção de biomassa, altas taxas de translocação e grande acúmulo de substâncias de reserva
favorecem o processo de fitorremediação (Cunningham et al., 1996).
A tolerância das plantas ao crescerem em solos contaminados com poluentes
orgânicos, como o petróleo, ocorre principalmente devido à associação de micro-organismos
com suas raízes no solo, região denominada de rizosfera. Ao serem estimulados
(fitoestimulação), esses micro-organismos tornam-se responsáveis pela biodegradação dos
hidrocarbonetos, denominando-se este processo de rizodegradação (Leahy & Colwell, 1990;
Glick, 2003; Kuiper et al., 2004).
Plantas com raízes mais densas e ramificadas são indicadas para a fitorremediação de
poluentes orgânicos por proporcionarem uma maior área rizosférica, e assim, uma maior
colonização de micro-organismos (Glick, 2003; Wenzel, 2009). Contudo, para se obter
sucesso durante um processo de fitorremediação é necessário que tanto a planta quanto a
microbiota nativa sejam tolerantes ao contaminante (Wenzel, 2009).
Essa interação planta-micro-organismos traz benefícios para ambos. As plantas
disponibilizam oxigênio e liberam no solo, por meio de suas raízes, substâncias contendo
açúcares, aminoácidos e ácidos orgânicos que são metabolizadas pelos micro-organismos, e
22
estes por sua vez, promovem a degradação do poluente (Cunningham et al., 1996; Glick,
2003; Kuiper et al., 2004; Khan, 2005; Gerhardt et al., 2009; Mendes et al., 2013), além de
utilizarem os compostos orgânicos existentes no poluente como fonte de carbono (Kuiper et
al., 2004). Com isso, os micro-organismos acabam estimulando o crescimento e o
desenvolvimento das plantas por facilitar a absorção de água e nutrientes presentes no solo
(Glick, 2003; Khan, 2005), influenciando assim na composição e na produtividade das
comunidades vegetais (Van der Heidjen et al., 2008; Mendes et al., 2013).
Na rizodegradação, os micro-organismos utilizam os hidrocarbonetos de petróleo
como fonte de carbono, convertendo-os em dióxido de carbono (CO2), água e biomassa
(McCutcheon & Schonoor, 2003). As bactérias são os agentes mais ativos na biodegradação
de petróleo, sendo consideradas como degradadoras primárias (Rahman et al., 2002). Estima-
se que em apenas 1 g de solo existem aproximadamente um milhão de genomas bacterianos
distintos (Gans et al., 2005).
A formação de um biofilme e a capacidade de produção de biossurfactantes são
características destas bactérias rizosféricas (Bannat et al., 2000; Johnsen & Karlson, 2004; Lai
et al., 2009). Os biofilmes microbianos são um conjunto de micro-organismos envoltos por
uma matriz extracelular polissacarídica que permanecem aderidos em alguma superfície, por
exemplo, na superfície do contaminante (Pandey et al., 2009). Além da formação de biofilmes
microbianos, a produção de moléculas com propriedades tensoativas, emulsificantes e
solubilizantes, denominadas de biosurfactantes, promove uma maior interação entre o
contaminante com os micro-organismos (Pandey et al., 2009), facilitando assim a
biodisponibilidade e a degradação dos hidrocarbonetos (Lu et al., 2003; Lai et al., 2009).
Controle rizosférico da biodegradação de compostos de petróleo
As bactérias e os fungos filamentosos apresentam-se em maior quantidade nos solos
contaminados com petróleo quando comparados com outros micro-organismos e, por isso, são
os mais investigados em estudos de biorremediação de solos (Rahman et al., 2002; Kuiper et
al., 2004; Pandey et al., 2009; Mendes et al., 2013).
As bactérias pertencentes aos gêneros Achromobacter, Acinetobacter, Alcaligenes,
Bacillus, Corynebacterium, Enterobacter, Flavobacterium, Microbacterium, Micrococcus,
Mycobacterium, Pseudomonas, Rhodococcus, Sphingomonas e Streptomyces são relatadas
como degradadoras de petróleo por Gaylarde et al. (1999), Daane et al. (2001), Kuiper et al.
23
(2001), Rahman et al. (2002), Mishra et al. (2004), Escalante-Espinosa et al. (2005),
Schippers et al. (2005), Liste e Felgentreu (2006), Toledo et al. (2006), Das e Mukherjee
(2007), Wang et al. (2007), Yateem et al. (2008), Vasconcellos et al. (2009), Balachandran et
al. (2012), Omotayo et al. (2012), Xu et al. (2013), Al-Wasif e Hamed (2014), Deng et al.
(2014) e Zafra et al. (2014). Os fungos dos gêneros Aspergillus, Fusarium, Penicillium,
Pestalotiopsis, Talaromyces e Scedosporium também são descritos como degradadores de
petróleo de acordo com Escalante-Espinosa et al. (2005), Yateem et al. (2008), Yanto e
Tachibana (2013) e Zafra et al. (2014).
O processo de biodegradação dos hidrocarbonetos de petróleo no solo é influenciado
por parâmetros físico-químicos (pH, temperatura e concentração de oxigênio), bem como pela
microbiota nativa existente, pela composição química, concentração e biodisponibilidade do
contaminante, e pelas características do solo (Margesin & Schinner, 1997; Dandie et al.,
2010). Micro-organismos com capacidade de degradar as duas classes de hidrocarbonetos
constituintes do petróleo (alifáticos e aromáticos) simultaneamente são raros, devido às
diferenças nas vias de degradação de ambos, entretanto uma exposição prolongada dos micro-
organismos a diferentes hidrocarbonetos pode resultar em alterações genéticas que permitem
uma degradação mais efetiva do petróleo (Obayori et al., 2009).
Conclusões
A rizodegradação é uma técnica de biorremediação que apresenta um alto potencial
para a remediação de petróleo no solo, pois a rizosfera desempenha um grande papel a partir
de uma intrínseca relação entre planta e micro-organismos, resultando na biodegradação do
petróleo. Novos estudos devem ser direcionados para a investigação e identificação de micro-
organismos rizosféricos capazes de degradar petróleo, bem como entender os mecanismos que
envolvem a degradação, para posteriormente, ser possível o desenvolvimento de produtos
biotecnológicos que auxiliem na descontaminação ambiental.
Referências
Al-Wasify R & Hamed SR (2014) Bacterial biodegradation of crude oil using local isolates.
International Journal of Bacteriology 2014: 1-8
Andrade JA, Augusto F & Jardim, ICSF (2010) Biorremediação de solos contaminados por
petróleo e seus derivados. Eclet quim 35: 17-43.
24
Atagana HI (2011) Bioremediation of co-contamination of crude oil and heavy metals in soil
by phytoremediation using Chromolaena odorata (L) King & H.E. Robinson. Water Air Soil
Pollut 215: 261-271.
Baker JM (1970) The effects of oils on plants. Environ Pollut. England: Elsevier Publishing
Company Ltd.: 27-44.
Balachandran C, Duraipandiyan V, Balakrishna K & Ignacimuthu S (2012) Petroleum and
polycyclic aromatic hydrocarbons (PAHs) degradation and naphthalene metabolism in
Streptomyces sp. (ERI-CPDA-1) isolated from oil contaminated soil. Bioresour Technol 112:
83-90.
Banat IM, Makkar MS & Cameotra SS (2000) Potential commercial applications of microbial
surfactants. Appl Microbiol Biotech 53: 495-508.
Bisht S, Pandey P, Sood A, Sharma, S & Bisht NS (2010) Biodegradation of naphthalene and
anthracene by chemotactically active rhizobacteria of Populus deltoides. Brazilian Journal of
Microbiology 4: 922-930.
British Petroleum (BP), 2014. BP Statistical Review of World Energy June 2014, London,
England.
Chaineau CH, Yepremian C, Vidalie JF, Ducreux J & Ballerini D (2003) Bioremediation of a
crude oil-polluted soil: biodegradation, leaching and toxicity assessments. Water Air Soil
Pollut 144: 419–440.
Coulon F, Pelletier E, Gourhant L & Delille D (2005) Effects of nutrient and temperature on
degradation of petroleum hydrocarbons in contaminated sub-Antarctic soil. Chemosphere 58:
1439–1448.
Cunningham SD, Anderson TA, Schwab AP & Hsu FC (1996) Phytoremediation of soils
contaminated with organic pollutants. Adv Agron 56: 55-114.
Cunningham SD & Ow DW (1996) Promises and prospects of phytoremediation. Plant
Physiol 110: 715-719.
Daane LL, Harjono I, Zylstra GJ & Häggblom MM (2001) Isolation and characterization of
polycyclic aromatic hydrocarbon-degrading bacteria associated with the rhizosphere of Salt
Marsh Plants. Appl Environ Microbiol 67: 2683-2691.
Dandie CE, Weber J, Aleer S, Adetutu EM, Ball AS & Juhasz AL (2010) Assessment of five
bioaccessibility assays for predicting the efficacy of petroleum hydrocarbon biodegradation in
aged contaminated soils. Chemosphere 81: 1061-1068.
Das K & Mukherjee AK (2007) Crude petroleum-oil biodegradation efficiency of Bacillus
subtilis and Pseudomonas aeruginosa strains isolated from a petroleum-oil contaminated soil
from North-East India. Bioresour Technol 98: 1339-1345.
25
David ND & Sharon LD (2009) Improving phytiremediation through biotechnology. Curr
Opin Biotechnol 20: 1-3.
Deng M, Li J, Liang F, Meisheng Y, Xu X, Yuang J, Peng J, Wu C & Wang J (2014)
Isolation and characterization of a novel hydrocarbon-degrading bacterium Achromobacter
sp. HZ01 from the crude oil-contaminated seawater at the Daya Bay, southern China. Mar
Pollut Bull 83: 79-86.
Diaz E (2004) Bacterial degradation of aromatic pollutants: a paradigm of metabolic
versatility. Int Microbiol 7: 173–180.
Escalante-Espinosa E, Gallegos-Martínez ME, Favela-Torres E & Gutiérrez-Rojas M (2005)
Improvement of the hydrocarbon phytoremediation rate by Cyperus laxus Lam. inoculated
with a microbial consortium in a model system. Chemosphere 59: 405-413.
Gans J, Wolinsky M & Dunbar J (2005) Computational improvements reveal great bacterial
diversity and high metal toxicity in soil. Science 309: 1387–1390.
Garcia-Blanco S, Venosa AD, Suidan MT, Lee K, Cobanli S & Haines JR (2007)
Biostimulation for the treatment of an oil-contaminated coastal salt marsh. Biodegradation
18: 1–15.
Gaylarde CC, Bento FM & Kelley J (1999) Microbial contamination of stored hydrocarbon
fuels and its control. Rev Microbiol 30: 1-10.
Gerhardt KE, Huang X, Glick BR & Greenberg BM (2009) Phytoremediation and
rhizoremediation of organic soil contaminants: Potential and challenges. Plant Sci 176: 20–
30.
Glick BR (2003) Phytoremediation: synergistic use of plants and bacteria to clean up the
environment. Biotech Adv 21: 383-393.
Huang X, El-Alawi Y, Gurska J, Glick BR & Greenberg BM (2005) A multi-process
phytoremediation system for decontamination of persistent total petroleum hydrocarbons
(TPHs) from soils. Microchem J 81: 139-147.
Johnsen AR & Karlson U (2004) Evaluation of bacterial strategies to promote the
bioavailability of polycyclic aromatic hydrocarbons. Appl Microbiol Biotech 63: 452–459.
Khan AG (2005) Role of soil microbes in the rhizospheres of plants growing on trace metal
contaminated soils in phytoremediation. J Trace Elem Med Biol 18: 355-364.
Kuiper I, Bloemberg GV & Lugtenberg BJJ (2001) Selection of a plant-bacterium pair as a
novel tool for rhizostimulation of polycyclic aromatic hydrocarbon-degrading bacteria. MPMI
14: 1197-1205.
Kuiper I, Lagendijk EL, Bloemberg GV & Lugtenberg BJJ (2004) Rhizoremediation: A
beneficial plant-microbe interaction. MPMI 17: 6-15.
26
Lai C, Huang YC, Wei Y & Chang J (2009) Biosurfactant-enhanced removal of total
petroleum hydrocarbons from contaminated soil. J Hazard Mater 167: 609-614.
Leahy JG & Colwell RR (1990) Microbial degradation of hydrocarbons in the environment.
Microbiol Rev 54: 305-315.
Lee S, Ka JO & Gyu SH (2012). Growth promotion of Xanthium italicum by application of
rhizobacterial isolates of Bacillus aryabhattai in microcosm soil. The Journal of Microbiology
50: 45-49.
Liste H & Felgentreu D (2006) Crop growth, culturable bacteria, and degradation of petrol
hydrocarbons (PHCs) in a long-term contaminated field soil. Appl Soil Ecol 31: 43-52.
Lu XX, Zhang X, Li GH & Zhang WH (2003) Production of biosurfactant and its role in the
biodegradation of oil hydrocarbons. J Environ Sci Health A 38: 483–492.
Luo Q, Zhang X, Wang H & Qian Y (2005) The use of non-uniform electrokinetics to
enhance in situ bioremediation of phenol-contaminated soil. J Hazard Mater 121: 187–194.
Ma B, He Y, Chen HH & Xu JM (2009) Dissipation of polycyclic aromatic hydrocarbons
(PAHs) in the rhizosphere: Synthesis through metaanalysis. Environ Pollut 159: 855-861.
Margesin R & Schinner F (1997) Bioremediation of diesel-oil contaminated alpine soils at
low temperatures. Appl Microbiol Biotechnol 47: 462-468.
Maranho LT, Galvão F, Preussler KH, Muñiz GIB & Kuniyoshi YS (2006) Efeitos da
poluição por petróleo na estrutura da folha de Podocarpus lambertii Klotzsch ex Endl.,
Podocarpaceae. Acta bot bras 20: 615-624.
McCutcheon SC & Schonoor JL (2003) Phytoremediation: transformation and control of
contaminants. John Wiley & Sons (Eds.). New Jersey.
Mendes R, Garbeva P & Raaijmakers JM (2013) The rhizosphere microbiome: significance of
plant beneficial, plant pathogenic, and human pathogenic microorganisms. FEMS Microbiol
Rev 37: 634-663.
Michel J, Henry Jr CB & Thumm S (2002) Shoreline assessment and environmental impacts
from the M/T Westchester oil spill in the Mississippi River. Spill Sci Technol Bull 7: 155-161.
Mishra S, Sarma MP & Lal B (2004) Crude oil degradation efficiency of a recombinant
Acinetobacter baumannii strain and its survival in crude oil-contaminated soil microcosm.
FEMS Microbiol Lett 235: 323-331.
Morelli IS, Vecchioli GI, Del Panno MT & Painceira MT (2001) Effect of petrochemical
sludge concentrations of changes in mutagenic activity during soil bioremediation process.
Environ Toxicol Chem 20: 2179–2183.
27
Obayori OS, Ilori MO, Adebusoye SA, Oyetibo GO, Omotayo AE & Amund OO (2009)
Degradation of hydrocarbons and biosurfactant production by Pseudomonas sp. strain LP1.
World J Microbiol Biotechnol 25:1615-1623.
Omotayo AE, Ojo OY & Amund OO (2012) Crude oil degradation by microorganisms in
soils composts. Res J Microbiol 7: 209-218.
Pandey J, Chauhan A & Jain RK (2009). Integrative approaches for assessing the ecological
sustainability of in situ bioremediation. FEMS Microbiol Rev 33: 324-375.
Parales RE & Haddock JD (2004) Biocatalytic degradation of pollutants. Curr Opin
Biotechnol 15: 374–379.
Paul D, Pandey G, Pandey J & Jain RK (2005) Accessing microbial diversity for
bioremediation and environmental restoration. Trends Biotechnol 23: 135–142.
Phale PS, Basu A, Majhi PD, Deveryshetty J, Vamsee-Krishna C & Shrivastava R (2007)
Metabolic diversity in bacterial degradation of aromatic compounds. OMICS 11: 252–279.
Rahman PKSM, Rahman T, Lakshmanaperumalsamy P & Banat IM (2002) Occurrence of
crude oil degrading bacteria in gasoline and diesel station soils. J Basic Microbiol 42: 284-
291.
Saito M & Magara Y (2003) Removal of organic pollutants and metabolic adaptation of
microorganisms by micro-aeration. J Environ Sci Heal A 38: 991–1005.
Sarkar D, Ferguson M, Dalla R & Birnbaum S (2005) Bioremediation of petroleum
hydrocarbons in contaminated soils: Comparison of biosolids addition, carbon
supplementation, and monitored natural attenuation. Environ Pollut 136: 187-195.
Scullion J (2006) Remediating polluted soils. Naturwissenschaften 93: 51-65.
Schippers A, Bosecker K, Spröer C & Schumann P (2005) Microbacterium oleivorans sp.
nov. and Microbacterium hydrocarbonoxydans sp. nov., novel crude-oil-degrading Gram-
positive bacteria. Int J Syst Evol Micr 55: 655-660.
Sloan NA (1999) Oil impacts on cold-water marine resources: A review relevant to Parks
Canada’s evolving Marine Mandate. Occasional Paper 11: 1-61.
Thomassin-Lacroix EJ, Eriksson M, Reimer KJ & Mohn WW (2002) Biostimulation and
bioaugmentation for on-site treatment of weathered diesel fuel in Arctic soil. Appl Microbiol
Biotechnol 59: 551–556.
Toledo FL, Calvo C, Rodelas B & González-López J (2006) Selection and identification of
bacteria isolated from waste crude oil with polycyclic aromatic hydrocarbons removal
capacities. Syst Appl Microbiol 29: 244-252.
28
Udell KS, Grubb DG & Sitar N (1995) Technologies for in situ cleanup of contaminated sites.
Cent Eur J Public Health 3: 67–76.
Van der Heijden MGA, Bardgett RD & Van Straalen NM (2008) The unseen majority: soil
microbes as drivers of plant diversity and productivity in terrestrial ecosystems. Ecol Lett 11:
296–310.
Van Hamme JD, Singh A & Ward OP (2003) Recent advances in petroleum microbiology.
Microbiol Mol Biol Rev 67: 503-549.
Vasconcellos SP, Crespim E, Cruz GF, Cruz GF, Senatore DB, Simioni KCM, Santos Neto
EV, Marsaioli AJ & Oliveira VM (2009) Isolation, biodegradation ability and molecular
detection of hydrocarbon degrading bacteria in petroleum samples from a Brazilian offshore
basin. Org Geochem 40: 574-588.
Vidali M (2001) Bioremediation. An overview. Pure Appl Chem 73: 1163-1672.
Walker TS, Bais HP, Grotewold E & Vivanco JM (2003) Root exudation and rhizosphere
biology. Plant Physiol 132: 44-51.
Wang J, Hongke X & Shaohui G (2007) Isolation and characteristics of a microbial
consortium for effectively degrading phenanthrene. Pet Sci 4: 68-75.
Wang J, Zhang Z, Su Y, He W, He F & Song H (2008) Phytoremediation of petroleum
polluted soil. Pet Sci 5: 167-171.
Watanabe K (2001) Microorganisms relevant to bioremediation. Curr Opin Biotechnol 12:
237-241.
Wenzel WW (2009) Rhizosphere processes and management in plant-assisted bioremediation
(phytoremediation) of soils. Plant Soil 321: 385-408.
White PM, Wolf DC, Thoma GJ & Reynolds C (2006) Phytoremediation of alkylated
polycyclic aromatic hydrocarbons in a crude oil-contaminated soil. Water Air Soil Pollut 169:
207-220.
Yateem A, Al-Sharrah T & Bin-Haji A (2008) Investigation of microbes in the rhizosphere of
selected trees for the rhizoremediation of hydrocarbon-contaminated soils. Int J Phytorem 10:
311-324.
Yanto DHY & Tachibana S (2013) Biodegradation of petroleum hydrocarbons by a newly
isolated Pestalotiopsis sp. NG007. Int Biodeterior Biodegrad 85: 438-450.
Xu SY, Chen YX, WO, WX, Wang KX, Lin Q & Lian XQ (2006) Enhanced dissipation of
phenanthrene and pyrene in spiked soils by combined plants cultivation. Sci Total Environ
363: 206-215.
29
Xu N, Bao M, Sun P & Li Y (2013) Study on bioadsorption and biodegradation of petroleum
hydrocarbons by a microbial consortium. Bioresour Technol 149: 22-30.
Zafra G, Absalón AE, Cuevas MD, Cortés-Espinosa DV (2014) Isolation and selection of a
highly tolerant microbial consortium with potential for PAH biodegradation from heavy crude
oil-contaminated soils. Water Air Soil Pollut 225: 1826-1844.
30
CAPÍTULO III
Seleção de bactérias degradadoras de petróleo da rizosfera de Panicum aquaticum Poir.,
Poaceae
Jéssica Aparecida Viesser
& Leila Teresinha Maranho
Resumo
O petróleo é um importante componente da matriz energética mundial e devido à sua
intensa exploração são frequentes os acidentes envolvendo derramamentos no solo, o que gera
consequências à biodiversidade e à saúde humana. Diante desta problemática, sugere-se na
presente pesquisa o uso da rizodegradação, uma técnica eficiente de tratamento que promove
a descontaminação de ambientes poluídos a partir da seleção e utilização de micro-
organismos presentes na rizosfera de plantas fitorremediadoras. O objetivo foi selecionar
bactérias com potencial de degradação de petróleo, a partir da rizosfera de
Panicum aquaticum Poir., a qual demostrou ter tolerância em solos contaminados com
petróleo. Foram isoladas nove bactérias, sendo caracterizadas morfologicamente por meio da
Coloração de Gram. As bactérias 3, 6 e 7 foram analisadas quanto ao potencial de degradação
de petróleo por meio de testes de degradação e cromatografia a gás (GC). Das nove bactérias
isoladas, cinco são Gram-positivas e quatro são Gram-negativas apresentando diferentes
morfologias. Resultados obtidos nos testes de degradação e GC revelaram que as bactérias são
promissoras quanto à degradação de petróleo, podendo ser utilizadas em processos de
biorremediação.
Palavras-chave: biotecnologia; biorremediação; micro-organismos rizosféricos.
Introdução
O petróleo apresenta uma composição complexa formada predominantemente por
hidrocarbonetos alifáticos ou aromáticos, e em baixas concentrações por asfaltenos, resinas e
metais como níquel, ferro e vanádio (Baker, 1970; Gaylarde et al., 1999; Van Hamme et al.,
2003). A localização geográfica e as condições físicas, químicas e biológicas do ambiente que
dá origem ao petróleo são fatores que explicam as variações na sua composição (Van Hamme
et al., 2003).
31
A necessidade de utilizar o petróleo como matéria-prima para suprir a demanda
energética mundial, bem como a ineficiência dos processos de exploração, transporte, refino,
armazenamento e consumo deste ocasionam derramamentos de petróleo que provocam danos
ambientais (Huang et al., 2005; Das & Mukherjee, 2007; Gerhardt et al., 2009). Ao entrar em
contato com o ambiente, o petróleo sofre alterações em suas características originais devido a
fatores físicos e biológicos, sendo essas transformações influenciadas pela interação do
contaminante com o ambiente que foi atingido (Sloan, 1999; Balachandran et al., 2012).
A persistência de petróleo no ambiente é longa em consequência da lenta
biodegradação dos hidrocarbonetos (Michel et al., 2002), o que ocasiona danos à saúde
humana e à biodiversidade (Xu et al., 2006; Zafra et al., 2014) e pode comprometer os
recursos hídricos e o solo (Wang et al., 2008a).
Diante da necessidade de conciliar a demanda crescente por petróleo com a proteção
ambiental, faz-se importante o desenvolvimento de técnicas de remediação que visem à
redução ou degradação de petróleo presente no ambiente. Segundo Watanabe (2001), Paul et
al. (2005) e Pandey et al. (2009), as técnicas de biorremediação são amplamente empregadas
na descontaminação ambiental devido aos custos relativamente menores e maior eficiência
quando comparadas às técnicas de remediação químicas e físicas.
A biorremediação baseia-se na exploração do potencial metabólico de plantas,
bactérias e fungos para a atenuação dos efeitos tóxicos de poluentes presentes no ambiente
por meio da transformação em produtos menos tóxicos, da remoção completa ou pela
imobilização dos mesmos (Vidali, 2001; Díaz, 2004; Parales & Haddock, 2004; Pandey et al.,
2009). Na fitorremediação são utilizados plantas e micro-organismos associados às suas raízes
(rizosfera) para degradar, remover ou estabilizar contaminantes presentes no solo e na água
(Cunningham et al., 1996; Cunningham & Ow, 1996; Glick, 2003; Gerhardt et al., 2009).
A tolerância das plantas em solos contaminados com poluentes orgânicos, como
petróleo, ocorre principalmente pela associação de micro-organismos às suas raízes, que ao
serem estimulados (fitoestimulação) tornam-se responsáveis pela biodegradação dos
hidrocarbonetos, denominando-se este processo de rizodegradação (Leahy & Colwell, 1990;
Glick, 2003; Kuiper et al., 2004). Os hidrocarbonetos de petróleo servem como fonte de
carbono para os organismos rizosféricos que os convertem em dióxido de carbono (CO2),
água e biomassa (McCutcheon & Schnoor, 2003).
32
Entre as várias plantas empregadas na fitorremediação, as espécies da família Poaceae
demonstram potencial para o uso na descontaminação de solos contaminados por petróleo,
pois reduzem a erosão e adicionam matéria orgânica ao solo (Carneiro et al., 2001), além de
apresentarem rápido crescimento e raízes ramificadas que propiciam uma maior área
superficial para a colonização de micro-organismos rizosféricos (Cunningham et al., 1996;
Glick, 2003; Merkl et al., 2005). Entre as Poaceae destaca-se Panicum maximum Jacq., uma
vez que a sua presença em solos contaminados reduziu significativamente a quantidade de
hidrocarbonetos de petróleo presentes, segundo estudo desenvolvido por Hernández-Valencia
e Mager (2003).
Assim como P. maximum, outras espécies do gênero Panicum podem apresentar
potencial para a fitorremediação de petróleo. Por exemplo, Panicum aquaticum Poir.,
conhecida popularmente como capim de tartaruga, é uma espécie nativa do Brasil encontrada
principalmente em locais bastante úmidos (Guglieri et al., 2007). A tolerância de
P. aquaticum em solos contaminados com diferentes concentrações de petróleo, assim como a
comprovação de seu potencial fitorremediador, foi estudada. Com base nessa informação e
sabendo-se que este processo é intermediado pela presença de micro-organismos na rizosfera,
o objetivo da presente pesquisa foi selecionar bactérias presentes na rizosfera de P. aquaticum
com potencial para degradação de petróleo.
Materiais e métodos
Constituiu como objeto da presente pesquisa o isolamento de bactérias presentes na
rizosfera de P. aquaticum cultivado em solo contaminado com petróleo na concentração de
100 g kg-1
. Para o isolamento foram colocados 2,5 g de solo em 250 mL de água destilada
estéril contendo 0,1% de peptona com posterior agitação em shaker TE-420 (TECNAL,
Piracicaba, Brasil) à temperatura de 30 ºC e 145 rpm por 24 h. Em seguida, foram realizadas
diluições seriadas, sendo as diluições 10-6
, 10-7
e 10-8
utilizadas para a inoculação de micro-
organismos em meio Ágar Nutriente (AN). Foram isoladas nove colônias de bactérias em
placas de Petri contendo o meio AN.
As placas contendo as bactérias isoladas foram numeradas (1 a 9) e mantidas em
estufa microbiológica a 36 ºC para a verificação do tempo de crescimento e caracterização das
colônias. Após, foram preparadas lâminas semipermanentes por meio da técnica de Coloração
33
de Gram (Borzani et al., 2001), a fim de caracterizar a morfologia com base em literatura
especializada (Colle et al., 1996).
A identificação das bactérias foi realizada mediante extração de DNA genômico pelo
método Fenol/Clorofórmio adaptado de Thomaz-Soccol et al. (2009), sendo a pureza e a
concentração do DNA obtido determinadas pela análise da absorbância em espectrofotômetro
Nanodrop 2000c (Thermo Scientific, Wilmington, Estados Unidos) com comprimento de
onda de 260 nm para a quantificação (ng µL-1
) e pela razão das leituras de 260 nm e 280 nm.
O gene 16S rRNA foi amplificado pela reação de PCR utilizando o conjunto de
oligonucleotídeos iniciadores 27F (5’ AGTTTGATCCTGGCTCAG 3’) e 1492R
(5’ ACGGCTACCTTGTTACGACTT 3’) utilizados para o domínio Bacteria. Cada reação de
PCR, em um volume final de 20 µL, foi constituída por 50 mM KCl, 20 mM Tris-HCl
(pH 8,4), 1,5 mM de MgCl2, 0,4 mM de dNTP mix, 0,3 mM de cada oligonucleotídeo
iniciador (primer), 1,5 U de Platinum Taq DNA Polimerase (Invitrogen) e 50 ng de DNA
genômico. A reação de PCR foi conduzida em termociclador (Applied Biosystems, Carlsbad,
Estados Unidos), sob as seguintes condições: desnaturação inicial a 95 °C por 5 min, seguido
de 30 ciclos de 94 °C por 1 min, anelamento dos primers a 58 °C durante 1 min e extensão a
72 °C por 1 min. Em seguida, a reação foi mantida a 72 ºC por 5 min e após resfriada a
4 °C. A amplificação dos produtos de PCR foi verificada por meio de eletroforese em gel de
1,5% de agarose a 90 V e, após coloração por brometo de etídeo (C21H20BrN3), visualizou-se
por luz ultravioleta (UV), sendo as imagens capturadas utilizando fotodocumentador (Kodak
Gel Logic, Rocheser, Estados Unidos).
Para a remoção do excesso de oligonucleotídeos, dNTP’s e sais oriundos da etapa de
PCR, os produtos (cerca de 10 µL) foram purificados com 6,67 µL de acetato de amônio
7,5 M (C2H7NO2) e 20 µL de etanol absoluto, seguido por centrifugação a 20000 rpm por
20 min. O sobrenadante foi descartado por inversão, e o precipitado lavado com 80 µL de
etanol 70° com posterior centrifugação a 20000 rpm por 15 min. O material genético aderido
à parede do microtubo foi preservado após o descarte do sobrenadante. Após a completa
evaporação do etanol à temperatura ambiente (overnight), o precipitado foi ressuspendido em
20 µL de água ultrapura estéril.
Posteriormente, os produtos de PCR purificados foram sequenciados por sequenciador
automático (Genetic Analyzer 3500, Applied Biosystems, Estados Unidos), sendo utilizados
os mesmos primers. As sequências 16S rDNA obtidas foram comparadas por similaridade
34
com sequências referentes às bactérias disponíveis em bancos de dados genômicos usando o
NCBI BLAST (https://blast.ncbi.nlm.nih.gov).
Três bactérias foram selecionadas com base no tempo de crescimento para a realização
dos testes de degradação de petróleo. Para a análise da densidade ótica (DO) foram preparadas
diluições 108
células mL-1
de todas as bactérias isoladas a partir da contagem do número de
células em Câmara de Neubauer. Amostras contendo 300 µL foram colocadas em microplaca
para cultivo celular e realizada a leitura em espectrofotômetro SpectraMAX M3 (Molecular
Devices, Sunnyvalle, Estados Unidos) no comprimento de onda de 610 nm (DO610) com a
finalidade de obter a relação entre a DO e a concentração em células mL-1
para cada inóculo
utilizado nos testes de degradação de petróleo.
Para verificar o potencial de degradação de petróleo foram preparados reatores em
frascos de Erlenmeyer de 125 mL em cinco intervalos de tempo (T0, T24, T48, T72 e T96 h)
para cada bactéria, sendo dois tratamentos e em triplicata. Como tratamento controle (TC)
foram preparados reatores contendo 25 mL de meio mineral (g L-1
) (K2HPO4 - 0,5;
(NH4)2SO4 - 0,5; MgSO4.7H2O - 0,5; FeCl3 - 0,01; MnCl2 - 0,001; ZnSO4 - 0,0001; CaCl2 -
0,01) adaptado de Déziel et al. (1996) e 1% (v/v) de petróleo conforme proposto por Rahman
et al. (2002) e Omotayo et al. (2012). O segundo tratamento (TB) foi composto por 25 mL
meio mineral, 1% (v/v) de petróleo como a única fonte de carbono e o inóculo de bactérias em
concentração final de 108 células mL
-1. Estes procedimentos seguiram metodologia proposta
por Mishra et al. (2004). Posteriormente, estes permaneceram em shaker à temperatura de
36 ºC e 145 rpm.
Para cada intervalo de tempo (T0, T24, T48, T72 e T96 h) foram analisados, tanto para
TC quanto para TB, os seguintes parâmetros: temperatura (T) e pH em pHmetro TCP01
(Onda Científica, Campinas, Brasil), concentração de oxigênio dissolvido (OD) em oxímetro
Handylab OX12-Set (SI Analytics, Mainz, Alemanha), condutividade elétrica (CE) em
condutivímetro Handylab LF11 (SI Analytics, Mainz, Alemanha) e densidade ótica (DO610)
em espectrofotômetro. Também para quantificar a biomassa (BG) foi utilizado o método de
gravimetria adaptado de Makkar e Cameotra (1998), sendo centrifugados 5 mL de cada
amostra e em duplicata a 12000 rpm por 20 min, secados à temperatura de 105 °C em estufa.
A eficiência da degradação de petróleo para cada bactéria foi avaliada mediante a
extração e quantificação de hidrocarbonetos totais de petróleo, conforme método proposto por
Schwab et al. (1999). Para cada amostra foi adicionado 1 g de sulfato de sódio anidro
35
(Na2SO4) para a absorção de água e 5 mL de diclorometano (CH2Cl2) padrão cromatografia
como solvente para extração dos compostos do petróleo. As amostras foram armazenadas
dentro de vidros âmbar em geladeira até a avaliação por cromatografia a gás (GC).
As amostras foram analisadas mediante cromatografia a gás (GC) utilizando o
cromatógrafo líquido/gasoso GC-2010 (Shimadzu, Kyoto, Japão) com coluna capilar DB-5
(0,25 µm de diâmetro, 30 m de comprimento e 0,25 µm de largura). As temperaturas do
injetor e detector foram 250 ºC e 280 ºC, respectivamente. O hidrogênio atuou como
carreador (1,0 mL min-1
). Inicialmente, a temperatura da coluna foi ajustada para 70 ºC por
4 min, e elevada até 190 ºC (20 ºC min-1
) para 250 ºC (10 min-1
) e finalmente para 280 ºC
(30 ºC min-1
), mantendo-se por 10 min. O volume injetado de cada amostra foi de 0,5 µL e em
triplicata. Cada composto foi identificado com base em seus tempos de retenção e
porcentagem de redução de área.
Os dados obtidos foram analisados quanto à normalidade pelo teste de Shapiro-Wilk.
Como apresentaram distribuição normal, foram comparados pelo teste paramétrico t de
Student (t). Essas análises foram conduzidas no software Statistica, versão 10.0, a 5% de
probabilidade (P). Os que não atenderam ao pressuposto de normalidade foram comparados
pelo teste não paramétrico de Kruskal-Wallis (H), seguido pelo teste de Dunn, a 5% de
probabilidade (P). Os parâmetros (pH, T, CE, OD, BG e DO) foram comparados entre os
diferentes tratamentos (T0, T24, T48, T72 e T96 h) para cada bactéria. Foi aplicado o teste de
correlação de postos de Spearman (r) para verificar as relações entre os parâmetros. Os
valores de referência que qualificaram as correlações foram adotados de acordo com
Callegari-Jacques (2003): 0 < r > 0,3 (fraca), 0,3 ≤ r < 0,6 (moderada) e r ≥ 0,6 (forte). Essas
análises foram conduzidas no software Statistica, versão 10.0.
Resultados e discussão
Das nove bactérias isoladas da rizosfera de P. aquaticum, constatou-se que sete são
Gram-positivas e duas são Gram-negativas. Com relação à morfologia, foram identificados
quatro bacilos, três estreptococos, um estreptobacilo e um coco. O tempo de crescimento para
a observação de colônias visiveis variou entre 16 e 72 h, sendo que apenas uma bactéria
apresentou tempo de crescimento em 16 h (bactéria 3), três em 24 h (bactérias 1, 2 e 6), uma
entre 24 e 48 h (bactéria 7), duas em 48 h (bactérias 8 e 9) e duas em 72 h (bactérias 4 e 5).
Na análise da densidade ótica (DO610), a suspensão contendo a bactéria 7 apresentou o menor
36
valor de absorbância (0,011) enquanto que a suspensão com a bactéria 6 exibiu a maior
absorbância (0,043) (Tabela 1).
Tabela 1. Coloração de Gram, morfologia, tempo de crescimento e densidade ótica média
(DO610) dos inóculos de bactérias isoladas da rizosfera de Panicum aquaticum Poir.
A diversidade de bactérias encontradas na rizosfera de P. aquaticum, quando cultivada
em substrato contaminado com petróleo, corrobora com Daane et al. (2001). Estes autores
afirmam que tanto bactérias Gram-positivas quanto Gram-negativas presentes em solos
contaminados e/ou na rizosfera de plantas possuem a capacidade de degradar petróleo.
O método Fenol/Clorofórmio para a extração de DNA genômico de bactérias
cultivadas em meio AN demonstrou ser efetivo, uma vez que a concentração e a pureza do
DNA obtido mostraram-se apropriadas para a amplificação e sequenciamento (Tabela 2).
Bactérias Cor das Colônias Gram Morfologia Tempo
(h)
DO610 células mL-1
1 Bege Negativa Bacilo 24 0,018 1,94x108
2 Branca Leitosa Positiva Bacilo 24 0,013 3,11x108
3 Branca Positiva Estreptobacilo 16 0,025 8,9x108
4 Amarela Brilhante Positiva Estreptococo 72 0,026 1,81x108
5 Amarela Positiva Estreptococo 72 0,020 1,67x108
6 Creme Positiva Bacilo 24 0,043 3,01x108
7 Rosa Claro Positiva Coco 24/48 0,011 3,67x108
8 Amarelo Leitoso Negativa Bacilo 48 0,015 1,92x108
9 Branca Positivo Estreptococo 48 0,030 1,96x108
37
Tabela 2. Quantificação de DNA genômico extraído pelo método Fenol/Clorofórmio de
bactérias isoladas da rizosfera de Panicum aquaticum Poir.
Bactérias Concentração de DNA
(ng µL-1
) A260 A280 A260/280
Controle 2,2 0,045 0,045 0,98
2 150,3 3,006 1,889 1,59
3 142,4 2,848 1,739 1,64
4 198,6 3,973 2,412 1,65
6 99,5 1,99 1,392 1,43
7 107,9 2,159 1,386 1,56
Na Fig. 1 é possível evidenciar a amplificação de um fragmento de 1200 pb para as
bactérias 2, 3, 4, 6 e 7. Na reação com o DNA da bactéria 3 (Fig. 1) observa-se a formação de
um “rastro”, ao mesmo tempo que na reação com o DNA da bactéria 4 ocorreu a amplificação
não específica de outro fragmento de maior peso molecular, além do fragmento esperado.
2 3 4 6 7 C- MM
Fig. 1. Eletroforese em gel de agarose a 1,5% dos produtos de PCR das bactérias 2, 3, 4, 6 e
7 isoladas da rizosfera de Panicum aquaticum Poir. 2 (Bactéria 2); 3 (Bactéria 3); 4 (Bactéria
4); 6 (Bactéria 6); 7 (Bactéria 7); C- (Controle Negativo de PCR); MM (Marcador de Massa
Molecular – 100 pb).
Uma nova amplificação foi realizada para as amostras contendo o DNA das bactérias
3 e 4, elevando-se a temperatura de anelamento de 58 °C para 60 °C. Essa mudança na
← 100 pb
← 1200 pb
38
temperatura de anelamento proporcionou uma maior especificidade na amplificação do DNA
das amostras, observando-se apenas a amplificação do fragmento alvo (Fig. 2).
3 4 C- MM
Fig. 2. Eletroforese em gel de agarose a 1,5% dos produtos de PCR das bactérias 3 e 4
isoladas da rizosfera de Panicum aquaticum Poir. 3 (Bactéria 3); 4 (Bactéria 4); C- (Controle
Negativo de PCR); MM (Marcador de Massa Molecular – 100 pb).
As sequências de nucleotídeos do gene 16S rRNA foram determinadas em ambas as
cadeias. As sequências obtiveram correspondência com sequências de genes 16S rRNA
depositadas em bancos de dados genômicos cujas similariedades encontradas variaram entre
96% e 98%, sendo possível a identificação à nível de gênero (Tabela 3).
Tabela 3. Identificação molecular de bactérias isoladas da rizosfera de Panicum aquaticum
Poir.
Bactérias Espécie Similariedade (%)
2 Sporosarcina sp. 97
3 Bacillus sp. 97
4 Microbacterium sp. 98
6 Bacillus sp. 96
7 Rhodococcus sp. 98
As bactérias 3 (Bacillus sp.), 6 (Bacillus sp.) e 7 (Rhodococcus sp.) foram
selecionadas para a realização dos testes de degradação de petróleo, uma vez que
apresentaram variações no tempo de crescimento e na morfologia, fatores que podem
influenciar no processo de degradação do petróleo.
← 100 pb
← 1200 pb
39
Segundo Wang et al. (2008b), grande parte dos estudos relacionados à biorremediação
de solos contaminados com hidrocarbonetos tem por objetivo analisar a taxa de degradação
destes sem atentar aos efeitos das variações ambientais sobre a degradação e, de acordo com
Röling et al. (2004), a análise dessas variações em laboratório permite o maior entendimento
das condições necessárias para que ocorram altas taxas de degradação do contaminante.
Diante do exposto, os resultados do tratamento com a bactéria 3 (Bacillus sp.)
demonstraram que houve diferença significativa para o pH, temperatura (T), condutividade
elétrica (CE), oxigênio dissolvido (OD) e densidade ótica (DO610) entre os intervalos de
tempo (T0, T24, T48, T72 e T96 h) quando comparados ao TC. A DO610 e o OD diferiram
significativamente em todos os intervalos de tempo, enquanto que para a biomassa (BG) não
ocorreu diferença significativa (Tabela 4).
Para o tratamento com a bactéria 6 (Bacillus sp.), quando comparado ao seu respectivo
TC, o pH foi significativamente maior em T72, enquanto que a T foi estatisticamente mais
elevada em T48. Por outro lado, o OD foi o único parâmetro que diferiu significativamente
para todos os intervalos de tempo (T0, T24, T48, T72 e T96 h) (Tabela 4). Ao comparar-se a
bactéria 7 (Rhodococcus sp.) com seu respectivo TC, verificou-se que a T foi
significativamente maior em T0 e T96. Em T24, a BG apresentou-se significativamente
maior, enquanto que a DO610 diferiu significativamente em T24, T48, T72 e T96 (Tabela 2).
Quando os parâmetros foram comparados entre os diferentes intervalos de tempo para
cada bactéria (3, 6 e 7), os resultados para os tratamentos com as bactérias 3 (Bacillus sp.) e 6
(Bacillus sp.) revelaram que o pH, CE, OD, BG e DO610 não diferiram significativamente
entre os intervalos de tempo (T0, T24, T48, T72 e T96 h), por outro lado a T foi
significativamente maior em T48 e T72 quando comparada a T0 nos tratamentos com a
bactéria 3. Para a bactéria 6 (Bacillus sp.), a T foi estatisticamente mais elevada nos
tratamentos T24 e T72 quando comparados ao tratamento T96. Ao considerar apenas os
tratamentos com a bactéria 7 (Rhodococcus sp.), houve equivalência estatística entre o pH,
OD, BG e DO e observou-se uma redução significativa da temperatura no T72 em relação ao
T48; a CE foi estatisticamente inferior no T48 quando comparada aos tratamentos T72 e T96,
e foi mais elevada no T72 em relação ao T24 (Tabela 4).
40
Tabela 4. pH, temperatura (T), oxigênio dissolvido (OD), condutividade elétrica (CE), biomassa por gravimetria (BG) e densidade ótica (DO610) durante os testes de
degradação de petróleo com as bactérias 3 (Bacillus sp.), 6 (Bacillus sp.) e 7 (Rhodococcus sp.) nos diferentes intervalos de tempo (T0, T24, T48, T72 e T96 h). TEMPO
(h) PARÂMETROS
pH T
(°C)
OD
(mg L-1)
CE
(mS cm-1)
BG
(g L-1)
DO610 nm
TC TB TC TB TC TB TC TB TC TB TC TB
Ba
ctér
ia 3
(Ba
cill
us
sp.)
T0 6,58 ± 0,20 6,74 ± 0,14 23,63 ± 0,06 23,83 ± 0,12ab 1,49 ± 0,11 1,24 ± 0,13 1678,67 ± 57,83 5,65 ± 0,08 0,00 ± 0,00 1,43 ± 0,03 0,00 ± 0,00 0,02 ± 0,00
T24 6,71 ± 0,13 7,06 ± 0,01 24,27 ± 0,32 24,43 ± 0,50ab 1,26 ± 0,03 0,72 ± 0,06a 1737,00 ± 89,94 5,76 ± 0,17a 0,00 ± 0,00 6,20 ± 0,42 0,00 ± 0,00 0,12 ± 0,02
T48 6,85 ± 0,19 7,04 ± 0,05 24,27 ± 0,67 25,47 ± 0,15a 1,80 ± 0,04 0,79 ± 0,06 1843,33 ± 37,90 6,02 ± 0,05 0,00 ± 0,00 7,58 ± 0,54 0,00 ± 0,00 0,08 ± 0,01
T72 6,90 ± 0,09 6,87 ± 0,06 24,77 ± 0,06 24,67 ± 0,21a 1,74 ± 0,09 0,61 ± 0,16 1864,67 ± 52,79 6,12 ± 0,13 0,00 ± 0,00 4,61 ± 1,19 0,00 ± 0,00 0,05 ± 0,01
T96 6,79 ± 0,10 6,89 ± 0,12 23,77 ± 0,40 24,51 ± 0,09ab 1,42 ± 0,04 0,67 ± 0,06 1940,67 ± 43,82 6,82 ± 0,38 0,00 ± 0,00 4,03 ± 0,57 0,01 ± 0,00 0,04 ± 0,00
Ba
ctér
ia 6
(Ba
cill
us
sp.)
T0 6,68 ± 0,21 6,73 ± 0,09 24,40 ± 0,10 24,30 ± 0,26ab 1,37 ± 0,03 0,6 ± 0,26 1618,00 ± 209,36 5,48 ± 0,15 0,01 ± 0,01 1,03 ± 0,74 0,01 ± 0,01 0,01 ± 0,00
T24 6,52 ± 0,20 6,59 ± 0,15 24,37 ± 0,31 24,73 ± 0,23a 0,98 ± 0,05 0,49 ± 0,29 1651,00 ± 104,92 5,48 ± 0,17 0,00 ± 0,00 2,82 ± 1,62 0,01 ± 0,01 0,03 ± 0,02
T48 6,56 ± 0,16 6,82 ± 0,25 23,40 ± 0,17 24,50 ± 0,30ab 0,84 ± 0,14 0,44 ± 0,10 1788,33 ± 150,32 6,19 ± 0,10 0,00 ± 0,00 3,29 ± 0,62 0,01 ± 0,01 0,06 ± 0,01
T72 7,43 ± 0,23 6,65 ± 0,25 24,23 ± 0,21 24,87 ± 0,12a 0,95 ± 0,07 0,82 ± 0,15 1567,67 ± 91,98 6,21 ± 0,50 0,00 ± 0,00 2,98 ± 0,24 0,01 ± 0,00 0,06 ± 0,01
T96 6,47 ± 0,22 6,60 ± 0,13 22,73 ± 0,40 23,17 ± 0,35b 0,96 ± 0,08 0,44 ± 0,05 1598,67 ± 243,67 6,82 ± 0,09 0,00 ± 0,00 3,83 ± 0,18 0,00 ± 0,00 0,05 ± 0,01
Ba
ctér
ia 7
(Rh
od
oco
ccu
s sp
.)
T0 6,92 ± 0,26 6,46 ± 0,38 25,83 ± 0,38 24,53 ± 0,59ab 2,52 ± 0,23 2,19 ± 0,15 1796,67 ± 63,96 5,90 ± 0,54abc 0,02 ± 0,01 1,70 ± 0,64 0,01 ± 0,00 ,02 ± 0,01
T24 6,59 ± 0,15 6,62 ± 0,38 25,60 ± 0,53 25,07 ± 0,45ab 2,01 ± 0,20 2,02 ± 0,53 1797,67 ± 60,75 5,77 ± 0,57bc 0,05 ± 0,15 2,50 ± 0,33 0,01 ± 0,00 0,09 ± 0,03
T48 6,59 ± 0,57 6,74 ± 0,31 25,70 ± 0,36 26,30 ± 0,20a 2,10 ± 0,15 1,94 ± 0,20 1759,33 ± 10,97 6,11 ± 0,08b 0,00 ± 0,00 3,10 ± 0,88 0,01 ± 0,01 0,06 ± 0,04
T72 6,60 ± 0,14 6,25 ± 0,19 24,37 ± 0,29 25,17 ± 0,70b 2,48 ± 0,20 3,96 ± 0,21 1860,33 ± 42,00 7,37 ± 2,07a 0,00 ± 0,00 2,93 ± 0,88 0,00 ± 0,00 0,03 ± 0,02
T96 6,41 ± 0,02 5,86 ± 0,15 25,33 ± 0,50 26,4 ± 0,20ab 2,40 ± 0,28 3,17 ± 0,41 1755,67 ± 50,46 6,13 ± 0,12ac 0,08 ± 0,02 2,53 ± 0,54 0,01± 0,00 0,02 ± 0,01
* Letras diferentes indicam diferença significativa pelo teste Kruskal-Wallis (H), seguido pelo teste de Dunn, a 5% de probabilidade.
41
Considerando todos os tratamentos para as diferentes bactérias, houve correlação
direta e moderada entre a T e CE (r=0,50; P<0,05) e forte entre DO e BG (r=0,84; P<0,05).
Observou-se correlação inversa e fraca entre BG e CE (r=-0,28; P<0,05), DO610 e CE (r=-
0,26; P<0,05), moderada entre CE e pH (r=-0,47; P<0,05) e forte entre OD e BG (r=-0,79;
P<0,05) e OD e DO610 (r=-0,72; P<0,05).
O pH (Tabela 4) apresentou pouca variação entre o tratamento controle (TC) e com a
presença dos inóculos de bactérias (TB). Em TB, o pH permaneceu entre 5,86 e 7,06, sendo
que o maior valor de biomassa microbiana obtido ocorreu em torno de um pH 6,87. Chen et
al. (2006) relatam que o crescimento de micro-organismos é favorecido em uma faixa de pH
entre 6,0 e 8,0. Balachandran et al. (2012) verificaram que as maiores taxas de degradação de
naftaleno (99,14%), óleo diesel (98,25%) e fenantreno (17,5%) por Streptomyces sp.
ocorreram em um pH 7,0.
A temperatura (T) também demonstrou menor variação durante a realização dos testes,
nos quais a temperatura mínima obtida em TB foi de 23,17 ºC e a temperatura máxima de
26,40 °C (Tabela 4). Resultados semelhantes foram obtidos por Rahman et al. (2002),
Balachandran et al. (2012) e Deng et al. (2014) que descreveram a ocorrência de
biodegradação de hidrocarbonetos em temperaturas acima de 20 ºC por consórcio microbiano
composto por Micrococcus sp., Corynebacterium sp., Flavobacterium sp., Bacillus sp. e
Pseudomonas sp.; por Streptomyces sp.; e por Achromobacter sp., respectivamente.
Margesin e Schinner (2001) afirmam que a temperatura desempenha um importante
papel na biodegradação de hidrocarbonetos por afetar o crescimento das bactérias, bem como
as propriedades físicas e a composição química dos hidrocarbonetos. No estudo de Wang et
al. (2008b) a temperatura foi o parâmetro com maior influência na taxa de degradação de
petróleo por consórcios de bactérias quando comparado ao pH.
Em relação à concentração de oxigênio dissolvido (OD) (Tabela 4) houve uma
tendência de redução desta em TB, indicando este ser um processo aeróbico. No tratamento
com a bactéria 7 (Rhodococcus sp.), observou-se que a menor concentração de oxigênio
dissolvido (1,94 mg L-1
) ocorreu quando constatou-se uma maior concentração de biomassa
bacteriana (3,10 g L-1
), evidenciando o consumo de oxigênio dissolvido no meio e
corroborando com a correlação inversa e forte obtida entre OD e BG.
A presença de oxigênio é um fator limitante para o crescimento de bactérias aeróbicas
e para que estas realizem a biodegradação dos hidrocarbonetos por meio da quebra dos anéis
42
aromáticos pela ação de enzimas oxigenases (Holliger et al., 1997; Díaz, 2004), cujos
produtos formados são utilizados nas vias de geração de energia (Kanaly & Harayama, 2000;
Díaz, 2004). Deng et al. (2014), quando da investigação do potencial de degradação de
hidrocarbonetos de petróleo por Achromobacter sp., citam que a maior taxa de degradação
(95,6%) ocorreu quando os reatores contendo a bactéria foram submetidos a velocidades de
rotação de 150 rpm, o que permitiu uma areação suficiente para manter a concentração de
oxigênio dissolvido necessária para o processo de biodegradação.
A condutividade elétrica (CE) foi o parâmetro utilizado para monitorar o consumo dos
nutrientes presentes no meio (Tabela 4). TC apresentou uma elevada condutividade elétrica
quando comparados à TB, demonstrando que houve o consumo dos nutrientes presentes no
meio pelos micro-organismos. Nos testes realizados com as bactérias 3 (Bacillus sp.) e 6
(Bacillus sp.) verifica-se um aumento na quantidade de íons presentes durante os intervalos de
tempo, enquanto que no teste com a bactéria 7 (Rhodococcus sp.) ocorreram oscilações.
Atekwana et al. (2004) relatam que a elevação da condutividade elétrica está relacionada ao
processo de degradação do petróleo, pois as bactérias ao crescerem consomem os nutrientes
presentes formando íons dissociados e aumentando, assim, a condutividade elétrica do meio.
Estudos relacionados à avaliação da eficiência de degradação de petróleo por espécies
isoladas de bactérias têm verificado a influência de alterações no pH, temperatura e salinidade
sobre a biodegradação (Wang et al., 2008b; Balachandran et al., 2012; Deng et al., 2014). Um
elevado potencial osmótico pode alterar a solubilidade e inibir o crescimento dos micro-
organismos, reduzindo assim a degradação (Qin et al., 2012).
A quantificação da biomassa presente em cada intervalo de tempo, tanto pelo método
de gravimetria (BG) quanto pela densidade ótica (DO610) (Tabela 4), permitiu o estudo da
cinética do crescimento de cada bactéria nas condições propostas. Durante os testes, o
aumento da biomassa revelou que o petróleo foi utilizado como fonte de carbono pelas
bactérias testadas, bem como os outros minerais presentes no meio.
Na Tabela 5 e na Fig. 3, as análises cromatográficas revelaram a eficiência de
degradação de petróleo pelas três 3, 6 e 7. Karima (1995) e Zhang et al. (2014) reportam que a
biodegradação dos compostos de petróleo pode ser constatada pela redução das áreas dos
picos dos compostos quando comparadas com um controle, pois processos não biológicos irão
ocorrer na mesma proporção tanto para os tratamentos inoculados como para os controles
quando estiverem nas mesmas condições impostas.
43
Tabela 5. Áreas e taxas de degradação dos compostos presentes no petróleo pelas bactérias 3, 6 e 7 isoladas da rizosfera de Panicum aquaticum Poir.
TEMPO
(h)
TEMPO DE RETENÇÃO
(min)
Ba
ctér
ia 3
(Ba
cill
us
sp.)
6.122 7.279 8.218 9.026 9.488 9.752 10.192 10.439 11.984 12.684 13.495 17.291
T24 (C) ÁREA 15782,77 38906,33 60380,02 83207,12 36547,58 58675,58 26444,62 48879,57 34548,21 22417,89 20989,01 24883,68
T24 (B) ÁREA 8424,58 24444,54 44438,62 57604,08 27004,13 41973,87 14474,14 35019,46 25410,60 17263,02 16343,81 19827,73
DEGRADAÇÃO
(%) 46,62 37,17 26,40 30,77 26,11 28,46 45,27 28,36 26,45 22,99 22,13 20,32
T48 (C) ÁREA 4905,07 25917,59 63515,81 95475,17 43131,57 71962,57 39507,89 60958,71 51005,34 32492,99 34423,26 43916,42
T48 (B)
ÁREA 452,67 5972,43 19472,48 38091,19 19766,17 31593,69 13208,23 27516,14 19681,03 13188,38 11988,24 12304,80
DEGRADAÇÃO
(%) 90,77 76,96 69,34 60,10 54,17 56,10 66,57 54,86 61,41 59,41 65,17 71,98
Ba
ctér
ia 6
(Ba
cill
us
sp.)
T24 (C) ÁREA 10663,17 23245,13 65767,27 101276,20 48018,77 75813,47 41486,70 66712,53 49020,43 32751,57 31933,67 47212,90
T24 (B) ÁREA 2857,60 16857,42 52795,18 63709,86 28286,08 43704,79 33271,81 43154,32 26825,43 24572,39 17106,96 27245,59
DEGRADAÇÃO
(%) 73,20 27,48 19,72 37,09 41,09 42,35 19,80 34,79 45,28 24,97 46,43 42,29
T48 (C) ÁREA 18209,40 60414,67 115078,77 150947,84 66199,36 105736,79 32022,02 89253,21 62113,70 42306,98 41941,01 54706,94
T48 (B)
ÁREA 4450,33 21106,70 46895,30 65256,58 27790,12 46427,70 24640,80 34917,81 23650,00 16489,26 14795,12 18342,97
DEGRADAÇÃO
(%) 75,56 65,06 59,25 56,77 58,02 56,09 23,05 60,88 61,92 61,02 64,72 66,47
Ba
ctér
ia 7
(Rh
odo
cocc
us
sp.)
T24 (C) ÁREA 33812,67 143947,44 317789,33 449380,41 209827,22 334562,72 195664,16 282753,68 242656,64 188496,18 224233,72 362542,30
T24 (B)
ÁREA 27899,77 14717,26 37863,94 59186,74 29767,46 46250,74 25289,14 35413,91 28986,10 21615,08 22678,41 52234,62
DEGRADAÇÃO (%)
91,72 89,78 88,09 86,83 85,81 86,18 87,08 87,48 88,05 88,53 89,89 85,59
T48 (C) ÁREA 18892,59 96278,82 249267,26 405706,81 197516,02 321073,89 193629,83 276925,86 250323,31 199285,22 235855,00 375534,21
T48 (B)
ÁREA 727,92 7192,09 23691,18 429664,57 26048,33 35239,68 23218,17 27082,53 27423,67 17639,81 18562,31 53197,27
DEGRADAÇÃO
(%) 96,15 92,53 90,50 89,41 86,81 89,02 88,01 90,22 89,04 91,15 92,13 85,83
44
(a) (b)
(c) (d)
(e) (f)
Fig. 3. Cromatogramas referentes às taxas de degradação de petróleo pelas bactérias 3
(Bacillus sp.), 6 (Bacillus sp.) e 7 (Rhodococcus sp.) isoladas da rizosfera de
Panicum aquaticum Poir. (a) T24 – bactéria 3. (b) T48 – bactéria 3. (c) T24 – bactéria 6. (d)
T48 – bactéria 6. (e) T24 – bactéria 7. (f) T48 – bactéria 7.
Para todos os tempos de retenção analisados, ocorreram reduções nas áreas dos picos
relativos aos compostos de petróleo após 24 e 48 h (T24B e T48B) em relação aos respectivos
controles (T24C e T48C), sendo que em 48 h obtiveram-se as maiores taxas de redução nas
áreas em todos os testes com as bactérias (Tabela 5). Estes resultados estão de acordo com os
valores de biomassa apresentados anteriormente, isto é, a maior concentração de biomassa das
2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 min
0.0
1.0
2.0
3.0
4.0
5.0uV(x10,000)
Chromatogram
2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 min
0.0
1.0
2.0
3.0
4.0
5.0uV(x10,000)
Chromatogram
2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 min
0.0
1.0
2.0
3.0
4.0
5.0uV(x10,000)
Chromatogram
2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 min
0.0
1.0
2.0
3.0
4.0
5.0uV(x10,000)
Chromatogram
2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 min
0.0
1.0
2.0
3.0
4.0
5.0uV(x10,000)
Chromatogram
2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 min
0.0
2.5
5.0
7.5
10.0uV(x10,000)
Chromatogram
45
bactérias 3 (Bacillus sp.), 6 (Bacillus sp.) e 7 (Rhodococcus sp.) ocorreu em 48 h quando
houve uma maior degradação dos compostos de petróleo.
A bactéria 7 (Rhodococcus sp.) demostrou maior eficiência para a degradação dos
compostos de petróleo quando comparada com as bactérias 3 (Bacillus sp.) e 6 (Bacillus sp.)
para todos os compostos, tanto em 24 h quanto em 48 h (Tabela 5).
A fração polar do petróleo é altamente resistente à degradação microbiana (Das &
Mukherjee, 2007), porém hidrocarbonetos de cadeia leve (alifáticos) como os n-alcanos são
mais biodegradáveis do que os compostos aromáticos (Liu et al., 2013). Altas taxas de
degradação de compostos aromáticos podem ocorrer devido a baixos percentuais destes na
composição do petróleo (Al-Wasify & Hamed, 2014). Deng et al. (2014) relatam a
capacidade de Achromobacter sp. em degradar 96,6% de n-alcanos entre C12 e C27 após 10
dias em um tempo de retenção de até 42,5 min, enquanto que as taxas de degradação de
compostos aromáticos como antraceno (29,8%) e fenantreno (50,6%) foram menores.
Al-Wasify e Hamed (2014) constataram que as taxas de degradação da maioria dos
compostos de petróleo aumentam com o tempo de incubação de Pseudomonas aeruginosa,
Bacillus subtilis e Acinetobacter lwoffi, atingindo o máximo em 28 dias de incubação.
P. aeruginosa degradou 53,68% de petróleo em cinco dias, enquanto que B. subtilis reduziu
47,35% e A. lwoffi degradou 38,07% de petróleo durante o mesmo período. Após 28 dias, os
percentuais de degradação foram 77,8%, 76,7% e 74,3%, respectivamente.
Conclusão
Os resultados obtidos na presente pesquisa evidenciaram que as três bactérias isoladas
(3 - Bacillus sp.; 6 - Bacillus sp. e 7 - Rhodococcus sp.) da rizosfera de Panicum aquaticum
Poir. demonstraram eficiência quanto à degradação de petróleo. Por meio de análises em
cromatografia a gás (GC), observou-se que Rhodococcus sp. apresentou maior potencial para
a degradação de petróleo, reduzindo em até 96,15% os compostos de petróleo. Assim, os
resultados obtidos podem auxiliar no desenvolvimento de técnicas de biorremediação, uma
vez que bactérias com elevada eficiência metabólica poderão ser utilizadas em processos de
descontaminação de áreas contaminadas com petróleo.
46
Referências
Al-Wasify R & Hamed SR (2014) Bacterial biodegradation of crude oil using local isolates.
International Journal of Bacteriology 2014: 1-8
Atekwana EA, Werkema DD, Duris JW, Rossbach S, Atekwana EA, Sauck WA, Cassidy DP,
Means J & Legall FD (2004) In-situ apparent conductivity measurements and microbial
population distribution at a hydrocarbon-contaminated site. Geophysics 69: 56-63.
Baker JM (1970) The effects of oils on plants. Environ Pollut. England: Elsevier Publishing
Company Ltd.: 27-44.
Balachandran C, Duraipandiyan V, Balakrishna K & Ignacimuthu S (2012) Petroleum and
polycyclic aromatic hydrocarbons (PAHs) degradation and naphthalene metabolism in
Streptomyces sp. (ERI-CPDA-1) isolated from oil contaminated soil. Bioresour Technol 112:
83-90.
Borzani W, Schmidell W, Lima UA, Aquarone E (2001) Biotecnologia Industrial:
fundamentos. São Paulo: Edgard Blucher, 274p.
Carneiro MAC, Siqueira JO & Moreira FMS (2001) Estabelecimento de plantas herbáceas em
solo com contaminação de metais pesados e inoculação de fungos micorrízicos arbusculares.
Pesqui Agropecu Bras 6: 1443-1452.
Callegari-Jacques SM (2003) Bioestatística: Princípios e Aplicações. Porto Alegre: Artmed,
255p.
Chen HJ, Guo GL, Tseng DH, Cheng CL & Huang SL (2006) Growth factors, kinetics and
biodegradation mechanism associated with Pseudomonas nitroreducens TX1 grown on
octylphenol polyethoxylates. J Environ Manage 80: 279–286.
Colle JG, Fraser AG, Marmion BP, Simmons A (1996) Practical Medical Microbiology. New
York: Churchill Livingstone, 425p.
Cunningham SD, Anderson TA, Schwab AP & Hsu FC (1996) Phytoremediation of soils
contaminated with organic pollutants. Adv Agron 56: 55-114.
Cunningham SD & Ow DW (1996) Promises and prospects of phytoremediation. Plant
Physiol 110: 715-719.
Daane LL, Harjono I, Zylstra GJ & Häggblom MM (2001) Isolation and characterization of
polycyclic aromatic hydrocarbon-degrading bacteria associated with the rhizosphere of Salt
Marsh Plants. Appl Environ Microbiol 67: 2683-2691.
Das K & Mukherjee AK (2007) Crude petroleum-oil biodegradation efficiency of Bacillus
subtilis and Pseudomonas aeruginosa strains isolated from a petroleum-oil contaminated soil
from North-East India. Bioresour Technol 98: 1339–1345.
47
Deng M, Li J, Liang F, Meisheng Y, Xu X, Yuang J, Peng J, Wu C & Wang J (2014).
Isolation and characterization of a novel hydrocarbon-degrading bacterium Achromobacter
sp. HZ01 from the crude oil-contaminated seawater at the Daya Bay, southern China. Mar
Pollut Bull 83: 79-86.
Déziel E, Paquette G, Villemur G, Lépine F & Bisaillon JG (1996) Biosurfactant production
by a soil Pseudomonas strain growing on polycyclic aromatic hydrocarbons. Appl Environ
Microb 62: 1908–1912.
Díaz E (2004) Bacterial degradation of aromatic pollutants: a paradigm of metabolic
versatility. International Microbiology 7: 173–180.
Gaylarde CC, Bento FM & Kelley J (1999) Microbial contamination of stored hydrocarbon
fuels and its control. Rev Microbiol 30: 1-10.
Gerhardt KE, Huang X, Glick BR & Greenberg B (2009) Phytoremediation and
rhizoremediation of organic soil contaminants: potential and challenges. Plant Sci 176: 20-30.
Glick BR (2003) Phytoremediation: synergistic use of plants and bacteria to clean up the
environment. Biotechnol Adv 21: 383-393.
Guglieri A, Longhi-Wagner HM & Zuloaga FO (2007) Panicum sect. Dichotomiflora
(Hitchc. & Chase) Honda e P. sect. Virgata Hitchc. & Chase ex Pilg. (Poaceae: Panicoideae:
Paniceae) no Brasil. Acta Bot Bras 21: 785-805.
Hernández-Valencia I & Mager D (2003) Uso de Panicum maximum y Brachiaria brizantha
para fitorremediar suelos contaminados con un crudo de petróleo liviano. Bioagro 15: 149-
155.
Holliger C, Gaspard S, Glod G, Heijman C, Schumacher W, Schwarzenbach RP & Vasquez
F (1997) Contaminated environments in the subsurface and bioremediation: organic
contaminants. FEMS Microbiol Rev 20: 517-523.
Huang X, El-Alawi Y, Gurska J, Glick BR & Greenberg BM (2005) A multi-process
phytoremediation system for decontamination of persistent total petroleum hydrocarbons
(TPHs) from soils. Microchem J 81: 139-147.
Kanaly RA & Harayama S (2000) Biodegradation of high-molecular-weight polycyclic
aromatic hydrocarbons by bacteria. J Bacteriol 182: 2059-2067.
Karima AH, Badawi AM, Fahd MI & Nour MH (1995) Enhancement of Egyptian crude oil
bioremediation using bacterial mutants. Egypt J Pet 4: 45-60.
Kuiper I, Lagendijk EL, Bloemberg GV & Lugtenberg BJJ (2004) Rhizoremediation: A
beneficial plant-microbe interaction. Mol Plant Microbe In 17: 6-15.
Leahy JG & Colwell RR (1990) Microbial degradation of hydrocarbons in the environment.
Microbiol Rev 54: 305-315.
48
Liu PG, Chang TS, Chen C, Wang M & Hsu H (2013) Effects of soil organic matter and
bacterial community shift on bioremediation of diesel-contaminated soil. Int Biodeter Biodegr
85: 661-670.
Makkar RS & Cameotra SS (1998) Production of biosurfactant at mesophilic and
thermophilic conditions by a strain of Bacillus subtilis. J Ind Microbiol Biot 20: 48-52.
Margesin R & Schinner F (2001) Bioremediation (natural attenuation and biostimulation) of
diesel-oil-contaminated soil in an Alpine Glacier Skiing Area. Appl Environ Microb 67: 3127-
3133.
McCutcheon SC & Schonnor JL (2003) Phytoremediation: transformation and control of
contaminants. New York: John Wiley & Sons, 987p.
Merkl N, Schultze-Kraft R & Infante C (2005) Phytoremediation in the tropics e influence of
heavy crude oil on root morphological characteristics of graminoids. Environ Pollut 138: 86-
91.
Michel J, Henry Jr CB & Thumm S (2002) Shoreline assessment and environmental impacts
from the M/T Westchester oil spill in the Mississippi River. Spill Sci Technol Bull 7: 155-161.
Mishra S, Sarma PM & Lal B (2004) Crude oil degradation efficiency of a recombinant
Acinetobacter baumannii strain and its survival in crude oil-contaminated soil microcosmo.
FEMS Microbiol Lett 235: 323-331.
Omotayo AE, Ojo OY & Amund OO (2012) Crude oil degradation by microorganisms in
soils composts. Research Journal of Microbiology 7: 209-218.
Pandey J, Chauhan A & Jain RK (2009) Integrative approaches for assessing the ecological
sustainability of in situ bioremediation. FEMS Microbiol Rev 33: 324-375.
Parales RE & Haddock JD (2004) Biocatalytic degradation of pollutants. Curr Opin Biotech
15: 374–379.
Paul D, Pandey G, Pandey J & Jain RK (2005) Accessing microbial diversity for
bioremediation and environmental restoration. Trends Biotechnol 23: 135–142.
Qin X, Tang JC, Li DS & Zhang QM (2012) Effect of salinity on the bioremediation of
petroleum hydrocarbons in a saline-alkaline soil. Lett Appl Microbiol 55: 210-217.
Rahman PKSM, Rahman T, Lakshmanaperumalsamy P & Banat IM (2002) Occurrence of
crude oil degrading bacteria in gasoline and diesel station soils. J Basic Microb 42: 284-291.
Röling WFM, Milner MG, Jones DM, Fratepietro F, Swannell RPJ, Daniel F, Head IM (2004)
Bacterial community dynamics and hydrocarbon degradation during a field-scale evaluation
of bioremediation on a mudflat beach contaminated with buried oil. Appl Environ Microb 70:
2603–2613.
49
Schwab AP, Su J, Wetzel S, Pekarek S & Banks M. K (1999) Extraction of petroleum
hydrocarbons from soil by mechanical shaking. Environ Sci Technol 30: 1940-1945.
Sloan NA (1999) Oil impacts on cold-water marine resources: A review relevant to Parks
Canada’s evolving Marine Mandate. Occasional Paper 11: 1-61.
Van Hamme JD, Singh A & Ward OP (2003) Recent advances in petroleum microbiology.
Microbiol Mol Biol R 67: 503-549.
Vidali M (2001) Bioremediation. An overview. Pure Appl Chem 73: 1163-1672.
Wang J, Zhang Z, Su Y, He W, He F & Song H (2008a) Phytoremediation of petroleum
polluted soil. Pet Sci 5: 167-171.
Wang Z, Gao D, Li F, Zhao J, Xin Y, Simkins S & Xing B (2008b) Petroleum hydrocarbon
degradation potential of soil bacteria native to the Yellow River Delta. Pedosphere 18: 707-
716.
Watanabe K (2001) Microorganisms relevant to bioremediation. Curr Opin Biotech 12: 237-
241.
Xu SY, Chen YX, Wu WX, Wang KX, Lin Q & Lian XQ (2006) Enhanced dissipation of
phenanthrene and pyrene in spiked soils by combined plants cultivation. Sci Total Environ
363: 206-215.
Zafra G, Absalón, ÁE, Cuevas MDC & Cortés-Espinosa DV (2014) Isolation and selection of
a highly tolerant microbial consortium with potential for PAH biodegradation from heavy
crude oil-contaminated soils. Water Air Soil Poll 225: 1-18.
Zhang, J., Fan, S., Yang, J., Du, X., Li, F., Hou, H. 2014. Petroleum contamination of soil and
water, and their effects on vegetables by statistically analyzing entire data set. Sci. Total
Environ. 476-477, 258-265.
50
CONCLUSÕES
Panicum aquaticum Poir. é uma espécie tolerante em solos contaminados com
petróleo, demonstrando assim o seu potencial para a fitorremediação. A partir da rizosfera,
comprovou-se que é possível selecionar bactérias com capacidadade de degradação de
petróleo. A seleção e utilização de bactérias com este potencial poderá proporcionar maior
efetividade aos processos de rizodegradação, ao selecionar bactérias com elevada eficiência
metabólica.
Os resultados obtidos na presente pesquisa servirão como ferramentas para o
desenvolvimento de produtos biotecnológicos que axiliem na descontaminação ambiental.
Sugere-se a realização de testes de degradação de petróleo com concentrações maiores ou
menores de petróleo, a fim de verificar a maior produção de biomassa de cada bactéria. Com
esses dados, há a possibilidade de geração de um consórcio de bactérias como um produto
para ser usado na biorremediação.
51
REFERÊNCIAS
Achuba, F.I. 2006. The effect of sublethal concentrations of crude oil on the growth and
metabolism of Cowpea (Vigna unguiculata) seedlings. The Environmentalist 26, 17-20.
Agamuthu, P., Abioye, O.P, Aziz, A.A., 2010. Phytoremediation of soil contaminated with
used lubricating oil using Jatropha curcas. J. Hazard. Mater. 179, 891-894.
Agbogidi, O.M., Eruotor, P.G., Akparobi, S.O., 2007. Effects of crude oil levels in the growth
of maize (Zea mays L.). Am. J. Food Techn. 2, 529-535.
Al-Wasify R & Hamed SR (2014) Bacterial biodegradation of crude oil using local isolates.
International Journal of Bacteriology 2014: 1-8
Andrade JA, Augusto F & Jardim, ICSF (2010) Biorremediação de solos contaminados por
petróleo e seus derivados. Eclet quim 35: 17-43.
Anoliefo, G.O., Vwioko, D.E., Mpamah, P., 2003. Regeneration of Chromolaena odorata (L.)
K. & R. in crude oil polluted soil: A possible phytoremediating agent. Benin Science Digest 1,
9-16.
Atagana HI (2011) Bioremediation of co-contamination of crude oil and heavy metals in soil
by phytoremediation using Chromolaena odorata (L) King & H.E. Robinson. Water Air Soil
Pollut 215: 261-271.
Atekwana EA, Werkema DD, Duris JW, Rossbach S, Atekwana EA, Sauck WA, Cassidy DP,
Means J & Legall FD (2004) In-situ apparent conductivity measurements and microbial
population distribution at a hydrocarbon-contaminated site. Geophysics 69: 56-63.
Baker JM (1970) The effects of oils on plants. Environ Pollut. England: Elsevier Publishing
Company Ltd.: 27-44.
Balachandran, C., Duraipandiyan, V., Balakrishna, K., Ignacimuthu, S., 2012. Petroleum and
polycyclic aromatic hydrocarbons (PAHs) degradation and naphthalene metabolism in
Streptomyces sp. (ERI-CPDA-1) isolated from oil contaminated soil. Bioresource Technol.
112, 83-90.
Banat IM, Makkar MS & Cameotra SS (2000) Potential commercial applications of microbial
surfactants. Appl Microbiol Biotech 53: 495-508.
Bisht S, Pandey P, Sood A, Sharma, S & Bisht NS (2010) Biodegradation of naphthalene and
anthracene by chemotactically active rhizobacteria of Populus deltoides. Brazilian Journal of
Microbiology 4: 922-930.
Bona, C., Silva, M.B., Rezende, I.M., Santos, G.O., Souza, L.A., Inckot, R.C., 2011. Efeito do
solo contaminado com óleo diesel na estrutura da raiz e da folha de plântulas de Sebastiania
commersoniana (Euphorbiaceae) e Schinus terebinthifolius (Anacardiaceae). Acta bot. bras.
25, 277-285.
52
Borzani W, Schmidell W, Lima UA, Aquarone E (2001) Biotecnologia Industrial:
fundamentos. São Paulo: Edgard Blucher, 274p.
Bramley-Alves, J., Wasley, J., King, C.K., Powell, S., Robinson, S.A., 2014.
Phytoremediation of hydrocarbon contaminants in subantarctic soils: An effective
management option. J. Environ. Manage 142, 60-69.
British Petroleum (BP), 2014. BP Statistical Review of World Energy June 2014, London,
England.
Callegari-Jacques SM (2003) Bioestatística: Princípios e Aplicações. Porto Alegre: Artmed,
255p.
Carneiro MAC, Siqueira JO & Moreira FMS (2001) Estabelecimento de plantas herbáceas em
solo com contaminação de metais pesados e inoculação de fungos micorrízicos arbusculares.
Pesqui Agropecu Bras 6: 1443-1452.
Chaineau CH, Yepremian C, Vidalie JF, Ducreux J & Ballerini D (2003) Bioremediation of a
crude oil-polluted soil: biodegradation, leaching and toxicity assessments. Water Air Soil
Pollut 144: 419–440.
Chaîneau, C.H., Morel, J.L., Oudot, J., 1997. Phytotoxicity and plant uptake of fuel oil
hydrocarbons. J. Environ. Qual. 26, 1478-1483.
Chen HJ, Guo GL, Tseng DH, Cheng CL & Huang SL (2006) Growth factors, kinetics and
biodegradation mechanism associated with Pseudomonas nitroreducens TX1 grown on
octylphenol polyethoxylates. J Environ Manage 80: 279–286.
Clark, R.B., 1997. Marine pollution. Oxford, Oxford University Press.
Colle JG, Fraser AG, Marmion BP, Simmons A (1996) Practical Medical Microbiology. New
York: Churchill Livingstone, 425p.
Coulon F, Pelletier E, Gourhant L & Delille D (2005) Effects of nutrient and temperature on
degradation of petroleum hydrocarbons in contaminated sub-Antarctic soil. Chemosphere 58:
1439–1448.
Cunningham SD & Ow DW (1996) Promises and prospects of phytoremediation. Plant
Physiol 110: 715-719.
Cunningham SD, Anderson TA, Schwab AP & Hsu FC (1996) Phytoremediation of soils
contaminated with organic pollutants. Adv Agron 56: 55-114.
Daane LL, Harjono I, Zylstra GJ & Häggblom MM (2001) Isolation and characterization of
polycyclic aromatic hydrocarbon-degrading bacteria associated with the rhizosphere of Salt
Marsh Plants. Appl Environ Microbiol 67: 2683-2691.
53
Dandie CE, Weber J, Aleer S, Adetutu EM, Ball AS & Juhasz AL (2010) Assessment of five
bioaccessibility assays for predicting the efficacy of petroleum hydrocarbon biodegradation in
aged contaminated soils. Chemosphere 81: 1061-1068.
Das K & Mukherjee AK (2007) Crude petroleum-oil biodegradation efficiency of Bacillus
subtilis and Pseudomonas aeruginosa strains isolated from a petroleum-oil contaminated soil
from North-East India. Bioresour Technol 98: 1339-1345.
David ND & Sharon LD (2009) Improving phytiremediation through biotechnology. Curr
Opin Biotechnol 20: 1-3.
Deng M, Li J, Liang F, Meisheng Y, Xu X, Yuang J, Peng J, Wu C & Wang J (2014)
Isolation and characterization of a novel hydrocarbon-degrading bacterium Achromobacter
sp. HZ01 from the crude oil-contaminated seawater at the Daya Bay, southern China. Mar
Pollut Bull 83: 79-86.
Déziel E, Paquette G, Villemur G, Lépine F & Bisaillon JG (1996) Biosurfactant production
by a soil Pseudomonas strain growing on polycyclic aromatic hydrocarbons. Appl Environ
Microb 62: 1908–1912.
Diaz E (2004) Bacterial degradation of aromatic pollutants: a paradigm of metabolic
versatility. Int Microbiol 7: 173–180.
Escalante-Espinosa E, Gallegos-Martínez ME, Favela-Torres E & Gutiérrez-Rojas M (2005)
Improvement of the hydrocarbon phytoremediation rate by Cyperus laxus Lam. inoculated
with a microbial consortium in a model system. Chemosphere 59: 405-413.
Farias, V., Maranho, L.T., Vasconcelos, E.C., Carvalho Filho, M.A.S., Lacerda, L.G.,
Azevedo, J.A.M., Pandey, A., Soccol, C.R., 2009. Phytodegradation potential of Erythrina
crista-galli L., Fabaceae, in petroleum-contaminated soil. Appl. Biochem. Biotech. 157, 10-22.
Freedman, B., 1993. Environmental ecology: the ecological effects of pollution, disturbance,
and other stresses. San Diego, Academic Press.
Gans J, Wolinsky M & Dunbar J (2005) Computational improvements reveal great bacterial
diversity and high metal toxicity in soil. Science 309: 1387–1390.
Garcia-Blanco S, Venosa AD, Suidan MT, Lee K, Cobanli S & Haines JR (2007)
Biostimulation for the treatment of an oil-contaminated coastal salt marsh. Biodegradation
18: 1–15.
Gaskin, S., Soole, K., Bentham, R., 2008. Screening of Australian Native Grasses for
rhizoremediation of aliphatic hydrocarbon-contaminated soil. Int. J. Phytoremediation 10,
378-389.
Gaylarde CC, Bento FM & Kelley J (1999) Microbial contamination of stored hydrocarbon
fuels and its control. Rev Microbiol 30: 1-10.
54
Gerhardt KE, Huang X, Glick BR & Greenberg B (2009) Phytoremediation and
rhizoremediation of organic soil contaminants: potential and challenges. Plant Sci 176: 20-30.
Glick BR (2003) Phytoremediation: synergistic use of plants and bacteria to clean up the
environment. Biotech Adv 21: 383-393.
Gogosz, A.M., Bona, C., Santos, G.O., Botosso, P.C., 2010. Germination and initial growth of
Campomanesia xanthocarpa O. Berg. (Myrtaceae), in petroleum-contaminated soil and
bioremediated soil. Braz. J. Biol. 70, 977-986.
Guglieri A, Longhi-Wagner HM & Zuloaga FO (2007) Panicum sect. Dichotomiflora
(Hitchc. & Chase) Honda e P. sect. Virgata Hitchc. & Chase ex Pilg. (Poaceae: Panicoideae:
Paniceae) no Brasil. Acta Bot Bras 21: 785-805.
Hernández-Valencia I & Mager D (2003) Uso de Panicum maximum y Brachiaria brizantha
para fitorremediar suelos contaminados con un crudo de petróleo liviano. Bioagro 15: 149-
155.
Holliger C, Gaspard S, Glod G, Heijman C, Schumacher W, Schwarzenbach RP & Vasquez
F (1997) Contaminated environments in the subsurface and bioremediation: organic
contaminants. FEMS Microbiol Rev 20: 517-523.
Huang X, El-Alawi Y, Gurska J, Glick BR & Greenberg BM (2005) A multi-process
phytoremediation system for decontamination of persistent total petroleum hydrocarbons
(TPHs) from soils. Microchem J 81: 139-147.
Hutchinson, S.L., Banks, M.K., Schwab, A.P., 2001. Phytoremediation of aged petroleum
sludge: Effects of inorganic fertilizer. J. Environ. Qual. 30, 395-403.
Inckot, R.C, Santos, G.O., Souza, L.A, Bona, C. 2011. Germination and development of
Mimosa pilulifera in petroleum-contaminated soil and bioremediated soil. Flora, 261-266.
Johnsen AR & Karlson U (2004) Evaluation of bacterial strategies to promote the
bioavailability of polycyclic aromatic hydrocarbons. Appl Microbiol Biotech 63: 452–459.
Kanaly RA & Harayama S (2000) Biodegradation of high-molecular-weight polycyclic
aromatic hydrocarbons by bacteria. J Bacteriol 182: 2059-2067.
Karima AH, Badawi AM, Fahd MI & Nour MH (1995) Enhancement of Egyptian crude oil
bioremediation using bacterial mutants. Egypt J Pet 4: 45-60.
Khan AG (2005) Role of soil microbes in the rhizospheres of plants growing on trace metal
contaminated soils in phytoremediation. J Trace Elem Med Biol 18: 355-364.
Kisic, I., Mesic, S., Basic, F., Brkic, V., Mesic, M., Durn, G., Zgorelec, Z., Bertovic, L., 2009.
The effect of drilling fluids and crude oil on some chemical characteristics of soil and crops.
Geoderma 149, 209-216.
55
Kuiper I, Bloemberg GV & Lugtenberg BJJ (2001) Selection of a plant-bacterium pair as a
novel tool for rhizostimulation of polycyclic aromatic hydrocarbon-degrading bacteria. MPMI
14: 1197-1205.
Kuiper I, Lagendijk EL, Bloemberg GV & Lugtenberg BJJ (2004) Rhizoremediation: A
beneficial plant-microbe interaction. MPMI 17: 6-15.
Lai C, Huang YC, Wei Y & Chang J (2009) Biosurfactant-enhanced removal of total
petroleum hydrocarbons from contaminated soil. J Hazard Mater 167: 609-614.
Larcher, W., 2004. Ecofisiologia Vegetal. São Carlos: Rima.
Leahy JG & Colwell RR (1990) Microbial degradation of hydrocarbons in the environment.
Microbiol Rev 54: 305-315.
Lee S, Ka JO & Gyu SH (2012). Growth promotion of Xanthium italicum by application of
rhizobacterial isolates of Bacillus aryabhattai in microcosm soil. The Journal of Microbiology
50: 45-49.
Lin, Q., Mendenssohn, I.A., 1998. The combined effects of phytoremediation and
biostimulation in enhancing habitat restoration and oil degradation of petroleum contaminated
wetlands. Ecol. Engi. 10, 263-274.
Liste H & Felgentreu D (2006) Crop growth, culturable bacteria, and degradation of petrol
hydrocarbons (PHCs) in a long-term contaminated field soil. Appl Soil Ecol 31: 43-52.
Liu PG, Chang TS, Chen C, Wang M & Hsu H (2013) Effects of soil organic matter and
bacterial community shift on bioremediation of diesel-contaminated soil. Int Biodeter Biodegr
85: 661-670.
Lopes, A., Piedade, M.T.F., 2009. Estabelecimento de Echinochloa polystachya (H.B.K.)
Hitchcock (Poaceae) em solo de várzea contaminado com petróleo de Urucu. Acta Amazon.
39, 583-590.
Lu XX, Zhang X, Li GH & Zhang WH (2003) Production of biosurfactant and its role in the
biodegradation of oil hydrocarbons. J Environ Sci Health A 38: 483–492.
Luo Q, Zhang X, Wang H & Qian Y (2005) The use of non-uniform electrokinetics to
enhance in situ bioremediation of phenol-contaminated soil. J Hazard Mater 121: 187–194.
Ma B, He Y, Chen HH & Xu JM (2009) Dissipation of polycyclic aromatic hydrocarbons
(PAHs) in the rhizosphere: Synthesis through metaanalysis. Environ Pollut 159: 855-861.
Makkar RS & Cameotra SS (1998) Production of biosurfactant at mesophilic and
thermophilic conditions by a strain of Bacillus subtilis. J Ind Microbiol Biot 20: 48-52.
56
Maranho LT, Galvão F, Preussler KH, Muñiz GIB & Kuniyoshi YS (2006) Efeitos da
poluição por petróleo na estrutura da folha de Podocarpus lambertii Klotzsch ex Endl.,
Podocarpaceae. Acta bot bras 20: 615-624.
Maranho, L.T., Dziedzic, M.A., Muñiz, G.I.B., Kuniyoshi, Y.S., Galvão, F., 2009. Effects of
the pollution by petroleum on the tracheids along the stem of Podocarpus lambertii Klotzsch
ex Endl., Podocarpaceae. Braz. J. Biol. 69, 263-269.
Margesin R & Schinner F (1997) Bioremediation of diesel-oil contaminated alpine soils at
low temperatures. Appl Microbiol Biotechnol 47: 462-468.
McCutcheon SC & Schonnor JL (2003) Phytoremediation: transformation and control of
contaminants. New York: John Wiley & Sons, 987p.
Mendes R, Garbeva P & Raaijmakers JM (2013) The rhizosphere microbiome: significance of
plant beneficial, plant pathogenic, and human pathogenic microorganisms. FEMS Microbiol
Rev 37: 634-663.
Merkl, N., Schultze-Kraft, R., Infante, C., 2004a. Phytoremediation in the tropics - The effect
of crude oil on the growth of tropical plants. Biorem. J. 8, 177-184.
Merkl, N., Schultze-Kraft, R., Infante, C. 2004b. Phytoremediation of petroleum-
contaminated soils in the tropics - Pre-selection of plant species from eastern Venezuela. J.
Appl. Bot. Food Qual. 78, 185-192.
Merkl, N., Schultze-Kraft, R., Infante, C., 2005. Phytoremediation in the tropics e influence
of heavy crude oil on root morphological characteristics of graminoids. Environ. Pollut. 138,
86-91.
Michel J, Henry Jr CB & Thumm S (2002) Shoreline assessment and environmental impacts
from the M/T Westchester oil spill in the Mississippi River. Spill Sci Technol Bull 7: 155-161.
Mishra S, Sarma MP & Lal B (2004) Crude oil degradation efficiency of a recombinant
Acinetobacter baumannii strain and its survival in crude oil-contaminated soil microcosm.
FEMS Microbiol Lett 235: 323-331.
Moreira, I.T.A., Oliveira, O.M.C., Triguis, J.A., Queiroz, A.F.S., Barbosa, R.M., Anjos,
J.A.S.A., Reyes, C.Y., Silva, C.S., Trindade, M.C.L.F., Rios, M.C., 2013. Evaluation of the
effects of metals on biodegradation of total petroleum hydrocarbons. Microchem. J. 110, 215-
220.
Morelli IS, Vecchioli GI, Del Panno MT & Painceira MT (2001) Effect of petrochemical
sludge concentrations of changes in mutagenic activity during soil bioremediation process.
Environ Toxicol Chem 20: 2179–2183.
Obayori OS, Ilori MO, Adebusoye SA, Oyetibo GO, Omotayo AE & Amund OO (2009)
Degradation of hydrocarbons and biosurfactant production by Pseudomonas sp. strain LP1.
World J Microbiol Biotechnol 25:1615-1623.
57
Omotayo AE, Ojo OY & Amund OO (2012) Crude oil degradation by microorganisms in
soils composts. Res J Microbiol 7: 209-218.
Pandey J, Chauhan A & Jain RK (2009) Integrative approaches for assessing the ecological
sustainability of in situ bioremediation. FEMS Microbiol Rev 33: 324-375.
Parales RE & Haddock JD (2004) Biocatalytic degradation of pollutants. Curr Opin Biotech
15: 374–379.
Paul D, Pandey G, Pandey J & Jain RK (2005) Accessing microbial diversity for
bioremediation and environmental restoration. Trends Biotechnol 23: 135–142.
Peña-Castro, J.M., Barrera-Figueroa, B.E., Fernández-Linares, L., Ruiz-Medrano, R.,
Xoconostle-Cázares, B., 2006. Isolation and identification of up-regulated genes in
bermudagrass roots (Cynodon dactylon L.) grown under petroleum hydrocarbon stress. Plant
Science 170, 724-731.
Peng, S., Zhou, Q., Cai, Z., Zhang, Z., 2009. Phytoremediation of petroleum contaminated
soils by Mirabilis Jalapa L. in a greenhouse plot experiment. J. Hazard. Mater. 168, 1490–
1496.
Petukhov,V.N., Fomchenkov, V.M., Chugunov, V.M., Kholodenko, V.P., 2000. Plant biotests
for soil and water contaminated with oil and oil products. Appl. Bioch. Microbiol. 36, 652-
655.
Pezeshki, S.R., DeLaune, R.D., 1993. Effect of crude oil on gas exchange functions of Juncus
roemerianus and Spartina alterniflora. Water Air Soil Pollut. 68, 461-468.
Pezeshki, S.R., Hester, M.W., Lin, Q., Nyman, J.A., 2000. The effects of oil spill and clean-
up on dominant US Gulf coast marsh macrophytes: a review. Environ. Pollut. 108, 129-139.
Phale PS, Basu A, Majhi PD, Deveryshetty J, Vamsee-Krishna C & Shrivastava R (2007)
Metabolic diversity in bacterial degradation of aromatic compounds. OMICS 11: 252–279.
Qin X, Tang JC, Li DS & Zhang QM (2012) Effect of salinity on the bioremediation of
petroleum hydrocarbons in a saline-alkaline soil. Lett Appl Microbiol 55: 210-217.
Rahman PKSM, Rahman T, Lakshmanaperumalsamy P & Banat IM (2002) Occurrence of
crude oil degrading bacteria in gasoline and diesel station soils. J Basic Microbiol 42: 284-
291.
Rivera-Cruz, M.C, Trujillo-Narcía, A., 2004. Estudio de toxicidad vegetal em suelos com
petróleos nuevo e intemperizado. Interciencia 29: 369-376.
Röling WFM, Milner MG, Jones DM, Fratepietro F, Swannell RPJ, Daniel F, Head IM (2004)
Bacterial community dynamics and hydrocarbon degradation during a field-scale evaluation
of bioremediation on a mudflat beach contaminated with buried oil. Appl Environ Microb 70:
2603–2613.
58
Roy, J.L., McGill, W.B., Lowen, H.A., Johnson, R.L., 2003. Relationship between water
repellency and native and petroleum-derived organic carbon in soils. J. Environ. Qual. 32,
583-590.
Saito M & Magara Y (2003) Removal of organic pollutants and metabolic adaptation of
microorganisms by micro-aeration. J Environ Sci Heal A 38: 991–1005.
Salanitro, J., Dorn, P., Hueseman, M., Moore, K., Rhodes, I., Rice, L., Jackson, T., Viponnd,
M., Western, M., Wisniewsky, H., 1997. Crude oil hydrocarbon bioremediation and soil
ecotoxicity assessment. Environ. Sci. Technol. 31: 1769-1776.
Sangabriel, W., Ferrera-Cerrato, R., Trejo-Aguilar, D., Mendonza-López, M.R., Cruz-
Sánchez, J.S., López-Ortiz, C., Delgadillo-Martínez, J., Alarcón, A., 2006. Tolerancia y
capacidad de fitorremediación de combustóleo en el suelo por seis especies vegetales. Rev.
Int. Contam. Ambient. 22, 63-73.
Sarkar D, Ferguson M, Dalla R & Birnbaum S (2005) Bioremediation of petroleum
hydrocarbons in contaminated soils: Comparison of biosolids addition, carbon
supplementation, and monitored natural attenuation. Environ Pollut 136: 187-195.
Schippers A, Bosecker K, Spröer C & Schumann P (2005) Microbacterium oleivorans sp.
nov. and Microbacterium hydrocarbonoxydans sp. nov., novel crude-oil-degrading Gram-
positive bacteria. Int J Syst Evol Micr 55: 655-660.
Schwab AP, Su J, Wetzel S, Pekarek S & Banks M. K (1999) Extraction of petroleum
hydrocarbons from soil by mechanical shaking. Environ Sci Technol 30: 1940-1945.
Scullion J (2006) Remediating polluted soils. Naturwissenschaften 93: 51-65.
Shirdam, R., Zand, A.D., Bidhendi, G.N., Mehrdadi, N., 2008. Phytoremediation of
hydrocarbon-contaminated soils with emphasis on the effect of petroleum hydrocarbons on
the growth of plant species. Phytoprotection 89, 21-29.
Sloan NA (1999) Oil impacts on cold-water marine resources: A review relevant to Parks
Canada’s evolving Marine Mandate. Occasional Paper 11: 1-61.
Strickland, R.M., 1990. The Pacific Northwest coast: fossil fuel frontier. Environ. J. 6, 25-77.
Thomassin-Lacroix EJ, Eriksson M, Reimer KJ & Mohn WW (2002) Biostimulation and
bioaugmentation for on-site treatment of weathered diesel fuel in Arctic soil. Appl Microbiol
Biotechnol 59: 551–556.
Toledo FL, Calvo C, Rodelas B & González-López J (2006) Selection and identification of
bacteria isolated from waste crude oil with polycyclic aromatic hydrocarbons removal
capacities. Syst Appl Microbiol 29: 244-252.
Udell KS, Grubb DG & Sitar N (1995) Technologies for in situ cleanup of contaminated sites.
Cent Eur J Public Health 3: 67–76.
59
Van der Heijden MGA, Bardgett RD & Van Straalen NM (2008) The unseen majority: soil
microbes as drivers of plant diversity and productivity in terrestrial ecosystems. Ecol Lett 11:
296–310.
Van Hamme JD, Singh A & Ward OP (2003) Recent advances in petroleum microbiology.
Microbiol Mol Biol Rev 67: 503-549.
Vasconcellos SP, Crespim E, Cruz GF, Cruz GF, Senatore DB, Simioni KCM, Santos Neto
EV, Marsaioli AJ & Oliveira VM (2009) Isolation, biodegradation ability and molecular
detection of hydrocarbon degrading bacteria in petroleum samples from a Brazilian offshore
basin. Org Geochem 40: 574-588.
Vidali M (2001) Bioremediation. An overview. Pure Appl Chem 73: 1163-1672.
Walker TS, Bais HP, Grotewold E & Vivanco JM (2003) Root exudation and rhizosphere
biology. Plant Physiol 132: 44-51.
Wang J, Hongke X & Shaohui G (2007) Isolation and characteristics of a microbial
consortium for effectively degrading phenanthrene. Pet Sci 4: 68-75.
Wang J, Zhang Z, Su Y, He W, He F & Song H (2008a) Phytoremediation of petroleum
polluted soil. Pet Sci 5: 167-171.
Wang Z, Gao D, Li F, Zhao J, Xin Y, Simkins S & Xing B (2008b) Petroleum hydrocarbon
degradation potential of soil bacteria native to the Yellow River Delta. Pedosphere 18: 707-
716.
Watanabe K (2001) Microorganisms relevant to bioremediation. Curr Opin Biotechnol 12:
237-241.
Wenzel WW (2009) Rhizosphere processes and management in plant-assisted bioremediation
(phytoremediation) of soils. Plant Soil 321: 385-408.
White PM, Wolf DC, Thoma GJ & Reynolds C (2006) Phytoremediation of alkylated
polycyclic aromatic hydrocarbons in a crude oil-contaminated soil. Water Air Soil Pollut 169:
207-220.
Xu N, Bao M, Sun P & Li Y (2013) Study on bioadsorption and biodegradation of petroleum
hydrocarbons by a microbial consortium. Bioresour Technol 149: 22-30.
Xu SY, Chen YX, WO, WX, Wang KX, Lin Q & Lian XQ (2006) Enhanced dissipation of
phenanthrene and pyrene in spiked soils by combined plants cultivation. Sci Total Environ
363: 206-215.
Yanto DHY & Tachibana S (2013) Biodegradation of petroleum hydrocarbons by a newly
isolated Pestalotiopsis sp. NG007. Int Biodeterior Biodegrad 85: 438-450.
60
Yateem A, Al-Sharrah T & Bin-Haji A (2008) Investigation of microbes in the rhizosphere of
selected trees for the rhizoremediation of hydrocarbon-contaminated soils. Int J Phytorem 10:
311-324.
Zafra G, Absalón AE, Cuevas MD, Cortés-Espinosa DV (2014) Isolation and selection of a
highly tolerant microbial consortium with potential for PAH biodegradation from heavy crude
oil-contaminated soils. Water Air Soil Pollut 225: 1826-1844.
Zhang, J., Fan, S., Yang, J., Du, X., Li, F., Hou, H. 2014. Petroleum contamination of soil and
water, and their effects on vegetables by statistically analyzing entire data set. Sci. Total
Environ. 476-477, 258-265.
61
ANEXO I
Your Paper Your Way
We now differentiate between the requirements for new and revised submissions. You may
choose to submit your manuscript as a single Word or PDF file to be used in the refereeing
process. Only when your paper is at the revision stage, will you be requested to put your
paper in to a 'correct format' for acceptance and provide the items required for the publication
of your article.
To find out more, please visit the Preparation section below.
Introduction
Environmental Pollution is an international journal that seeks to publish papers that report
results from original, novel research that addresses significant environmental pollution issues
and problems and contribute new knowledge to science.
The editors welcome high quality papers where the pollutants are clearly defined and
measured and can be directly related to biological, ecological, and human health effects. This
includes air, water, and soil pollution and climate change. New techniques for the study and
measurement of pollutants are also encouraged. Papers, such as meta analyses, that report
findings from re-examination and interpretation of existing data are welcome Modeling
papers are also welcome Critical review papers are also of interest as are letters to the editor.
The editors do not wish to publish papers that describe results from routine surveys and
monitoring programs that are primarily of local interest. Descriptions of well-known
pollutants, such as legacy pollutants, in yet another location are not of interest. Papers about
sewage, waste and wastewater treatment and management, agronomy, remediation,
biomonitoring, bioremediation and phytoremediation are not acceptable.
The editors welcome the following contributions:
Full research papers: Results from completed investigations
Review papers: In-depth critical reviews of special subjects
Commentaries: Opinions and concerns about current scientific issues, invited or unsolicited
Letters to the Editor: short focused letters to raise issues or concerns about papers published
in the journal and solicit a reply from the authors of those papers
Types of paper
•Full Research Papers: Full Research Papers should not exceed 5000 words (including
abstract but excluding references). If this is not possible, please contact the Editor in Chief.
To facilitate the review process line numbers should be inserted into the text of the
manuscript.
•Short Communications: These follow the same format as full papers, except that Results
and Discussion sections should be combined. Manuscripts should not exceed 2000 words.
• Rapid Communications: These are Short Communication papers that are submitted for
consideration for publication on an accelerated schedule. These papers report highly
significant new findings and indicate new directions for research. Authors should fax or E-
62
mail the abstract of their manuscript to the Editor-in-Chief, or appropriate Associate Editor
before submitting a Rapid Communication manuscript.
•Special Issues: Proposals for Special Issues of Full Research Papers that focus on a specific
topic or theme will also be considered.
• New Initiatives: Intended as very brief reports of significant new findings indicating new
directions in research. Manuscripts should be no more than 6-8 double spaced manuscript
pages, including no more than 10 references and 1-3 short tables and/or small figures. An
abstract is not required. Include a very brief Introduction, Materials and Methods, and
Discussion of Results, including speculation about their meaning and implications. Please
submit the name and complete mailing address (including e-mail address) of one appropriate
referee who has agreed to review the manuscript. Authors should contact the Editor-in-Chief,
or appropriate Associate Editor by e-mail before submitting a New Initiatives manuscript.
•Review Papers: Authors may submit manuscripts that provide in-depth critical review of a
special subject. These reviews must provide a Synthesis and Critical Evaluation of the state of
the knowledge of the subject and indicate research directions. The Editors also periodically
invite review articles.
•Commentary: Commentary papers may be submitted that express opinions and concerns,
suggest research priorities and question conventional methodologies and conclusions.
Manuscripts should include an Abstract, Introduction, Presentation of the Concerns or
Analysis and Conclusions. References, Tables and Illustrations should be used sparingly. The
manuscript should not exceed 12 double-spaced pages. The Editors will evaluate all
manuscripts, for suitability of publication.
•Letters to Editor: Readers are encouraged to write to any of the Editors and raise issues and
concerns about papers published in the journal. Editors or authors will reply to letters.
Please note that the word count does not include figures, tables or the reference list
Ethics in publishing
For information on Ethics in publishing and Ethical guidelines for journal publication see
http://www.elsevier.com/publishingethics and http://www.elsevier.com/journal-
authors/ethics.
Conflict of interest
All authors are requested to disclose any actual or potential conflict of interest including any
financial, personal or other relationships with other people or organizations within three years
of beginning the submitted work that could inappropriately influence, or be perceived to
influence, their work. See also http://www.elsevier.com/conflictsofinterest. Further
information and an example of a Conflict of Interest form can be found at:
http://help.elsevier.com/app/answers/detail/a_id/286/p/7923.
63
Submission declaration
Submission of an article implies that the work described has not been published previously
(except in the form of an abstract or as part of a published lecture or academic thesis or as an
electronic preprint, see http://www.elsevier.com/sharingpolicy), that it is not under
consideration for publication elsewhere, that its publication is approved by all authors and
tacitly or explicitly by the responsible authorities where the work was carried out, and that, if
accepted, it will not be published elsewhere including electronically in the same form, in
English or in any other language, without the written consent of the copyright-holder.
Changes to authorship This policy concerns the addition, deletion, or rearrangement of author names in the
authorship of accepted manuscripts:
Before the accepted manuscript is published in an online issue: Requests to add or remove an
author, or to rearrange the author names, must be sent to the Journal Manager from the
corresponding author of the accepted manuscript and must include: (a) the reason the name
should be added or removed, or the author names rearranged and (b) written confirmation (e-
mail, fax, letter) from all authors that they agree with the addition, removal or rearrangement.
In the case of addition or removal of authors, this includes confirmation from the author being
added or removed. Requests that are not sent by the corresponding author will be forwarded
by the Journal Manager to the corresponding author, who must follow the procedure as
described above. Note that: (1) Journal Managers will inform the Journal Editors of any such
requests and (2) publication of the accepted manuscript in an online issue is suspended until
authorship has been agreed.
After the accepted manuscript is published in an online issue: Any requests to add, delete, or
rearrange author names in an article published in an online issue will follow the same policies
as noted above and result in a corrigendum.
Article transfer service
This journal is part of our Article Transfer Service. This means that if the Editor feels your
article is more suitable in one of our other participating journals, then you may be asked to
consider transferring the article to one of those. If you agree, your article will be transferred
automatically on your behalf with no need to reformat. Please note that your article will be
reviewed again by the new journal. More information about this can be found here:
http://www.elsevier.com/authors/article-transfer-service.
Copyright Upon acceptance of an article, authors will be asked to complete a 'Journal Publishing
Agreement' (for more information on this and copyright, see
http://www.elsevier.com/copyright). An e-mail will be sent to the corresponding author
confirming receipt of the manuscript together with a 'Journal Publishing Agreement' form or a
link to the online version of this agreement.
Subscribers may reproduce tables of contents or prepare lists of articles including abstracts for
internal circulation within their institutions. Permission of the Publisher is required for resale
or distribution outside the institution and for all other derivative works, including
compilations and translations (please consult http://www.elsevier.com/permissions). If
excerpts from other copyrighted works are included, the author(s) must obtain written
permission from the copyright owners and credit the source(s) in the article. Elsevier has
64
preprinted forms for use by authors in these cases: please consult
http://www.elsevier.com/permissions.
For open access articles: Upon acceptance of an article, authors will be asked to complete an
'Exclusive License Agreement' (for more information see
http://www.elsevier.com/OAauthoragreement). Permitted third party reuse of open access
articles is determined by the author's choice of user license (see
http://www.elsevier.com/openaccesslicenses).
Author rights
As an author you (or your employer or institution) have certain rights to reuse your work. For
more information see http://www.elsevier.com/copyright.
Role of the funding source You are requested to identify who provided financial support for the conduct of the research
and/or preparation of the article and to briefly describe the role of the sponsor(s), if any, in
study design; in the collection, analysis and interpretation of data; in the writing of the report;
and in the decision to submit the article for publication. If the funding source(s) had no such
involvement then this should be stated.
Funding body agreements and policies
Elsevier has established a number of agreements with funding bodies which allow authors to
comply with their funder's open access policies. Some authors may also be reimbursed for
associated publication fees. To learn more about existing agreements please visit
http://www.elsevier.com/fundingbodies.
Language (usage and editing services)
Please write your text in good English (American or British usage is accepted, but not a
mixture of these). Authors who feel their English language manuscript may require editing to
eliminate possible grammatical or spelling errors and to conform to correct scientific English
may wish to use the English Language Editing service available from Elsevier's WebShop
(http://webshop.elsevier.com/languageediting/) or visit our customer support site
(http://support.elsevier.com) for more information.
Submission
Manuscript Submission
The complete manuscript can be submitted via EES at http://www.ees.elsevier.com/envpol ,
following all instructions exactly.
Complete manuscripts received via EES will be further evaluated by an Editor. Authors are
requested to choose an editor most appropriate to their research field during the submission
process. This final evaluation will determine whether or not a manuscript will be sent out for
review.
Submission to this journal proceeds totally online and you will be guided stepwise through the
creation and uploading of your files. The system automatically converts source files to a
single PDF file of the article, which is used in the peer-review process. Please note that even
65
though manuscript source files are converted to PDF files at submission for the review
process, these source files are needed for further processing after acceptance. All
correspondence, including notification of the Editor's decision and requests for revision, takes
place by e-mail removing the need for a paper trail.
Please note that authors have a maximum of 6 weeks to resubmit a revised manuscript, unless
an extension is requested from the editor.
The resubmission of previously rejected manuscripts is by invitation only.
Referees
Please submit, with the manuscript, the names, addresses and e-mail addresses of five
potential referees who are well-qualified to review the manuscript, if they are asked to review
it. Reviewers are asked to evaluate the originality, significance and technical quality of the
work, as well as the clarity of the manuscript, and the relevance of the subject matter to the
journal. The final decision for publication of all manuscripts is made by the Editor-in-Chief.
Additional information
US National Institutes of Health (NIH) voluntary posting (" Public Access") policy Elsevier
facilitates author response to the NIH voluntary posting request (referred to as the NIH
"Public Access Policy"; see http://www.nih.gov/about/publicaccess/index.htm ) by posting the
peer-reviewed author's manuscript directly to PubMed Central on request from the author, 12
months after formal publication. Upon notification from Elsevier of acceptance, we will ask
you to confirm via e-mail (by e-mailing us at NIHauthorrequest@elsevier.com) that your
work has received NIH funding and that you intend to respond to the NIH policy request,
along with your NIH award number to facilitate processing. Upon such confirmation, Elsevier
will submit to PubMed Central on your behalf a version of your manuscript that will include
peer-review comments, for posting 12 months after formal publication. This will ensure that
you will have responded fully to the NIH request policy. There will be no need for you to post
your manuscript directly with PubMed Central, and any such posting is prohibited.
If excerpts from other copyrighted works are included, the Author(s) must obtain written
permission from the copyright owners and credit the source(s) in the article. Elsevier has
preprinted forms for use by authors in these cases: contact ES Global Rights Department, P.O.
Box 800, Oxford, OX5 1DX, UK; phone: (+44) 1865 843830, fax: (+44) 1865 853333,
Elsevier's Rights Department, Oxford, UK: phone (+44) 1865 843830, fax (+44) 1865
853333, e-mail permissions@elsevier.com . Requests may also be completed on-line via the
Elsevier homepage (http://www.elsevier.com/locate/permissions ).
NEW SUBMISSIONS
Submission to this journal proceeds totally online and you will be guided stepwise through the
creation and uploading of your files. The system automatically converts your files to a single
PDF file, which is used in the peer-review process.
As part of the Your Paper Your Way service, you may choose to submit your manuscript as a
single file to be used in the refereeing process. This can be a PDF file or a Word document, in
any format or lay-out that can be used by referees to evaluate your manuscript. It should
contain high enough quality figures for refereeing. If you prefer to do so, you may still
provide all or some of the source files at the initial submission. Please note that individual
figure files larger than 10 MB must be uploaded separately.
66
References
There are no strict requirements on reference formatting at submission. References can be in
any style or format as long as the style is consistent. Where applicable, author(s) name(s),
journal title/book title, chapter title/article title, year of publication, volume number/book
chapter and the pagination must be present. Use of DOI is highly encouraged. The reference
style used by the journal will be applied to the accepted article by Elsevier at the proof stage.
Note that missing data will be highlighted at proof stage for the author to correct.
Formatting requirements There are no strict formatting requirements but all manuscripts must contain the essential
elements needed to convey your manuscript, for example Abstract, Keywords, Introduction,
Materials and Methods, Results, Conclusions, Artwork and Tables with Captions.
If your article includes any Videos and/or other Supplementary material, this should be
included in your initial submission for peer review purposes.
Divide the article into clearly defined sections.
Please ensure your paper has consecutive line numbering - this is an essential peer review
requirement.
Figures and tables embedded in text
Please ensure the figures and the tables included in the single file are placed next to the
relevant text in the manuscript, rather than at the bottom or the top of the file.
REVISED SUBMISSIONS Use of word processing software
Regardless of the file format of the original submission, at revision you must provide us with
an editable file of the entire article. Keep the layout of the text as simple as possible. Most
formatting codes will be removed and replaced on processing the article. The electronic text
should be prepared in a way very similar to that of conventional manuscripts (see also the
Guide to Publishing with Elsevier: http://www.elsevier.com/guidepublication). See also the
section on Electronic artwork.
To avoid unnecessary errors you are strongly advised to use the 'spell-check' and 'grammar-
check' functions of your word processor.
Cover Letter
A cover letter must be sent with the manuscript and must include:
•The novelty, scientific significance and importance of the manuscript.
•The names and valid, current e-mail addresses for five (5) potential reviewers who are well-
qualified to review the manuscript if they are asked to review it. Potential reviewers should be
from the international scientific community and not from one country or region.
•The name and e-mail address of the corresponding author.
Article structure
Subdivision - unnumbered heads
Full Research Papers should not exceed 5000 words (including abstract but excluding
references). If this is not possible, please contact the Editor in Chief.
67
Divide your article into clearly defined sections. Each subsection is given a brief heading.
Each heading should appear on its own separate line. Subsections should be used as much as
possible when cross-referencing text: refer to the subsection by heading as opposed to simply
"the text".
Introduction
State the objectives of the work and provide an adequate background, avoiding a detailed
literature survey or a summary of the results.
Material and methods
Provide sufficient detail to allow the work to be reproduced. Methods already published
should be indicated by a reference: only relevant modifications should be described.
Results
Results should be clear and concise.
Discussion
This should explore the significance of the results of the work, not repeat them. A combined
Results and Discussion section is often appropriate. Avoid extensive citations and discussion
of published literature.
Conclusions
The main conclusions of the study may be presented in a short Conclusions section, which
may stand alone or form a subsection of a Discussion or Results and Discussion section.
Essential title page information
Full Research Papers: Provide the following data on the title page (in the order given).
• Title. Concise and informative. Titles are often used in information-retrieval systems. Avoid
abbreviations and formulae where possible.
• Author names and affiliations. Where the family name may be ambiguous (e.g., a double
name), please indicate this clearly. Present the authors' affiliation addresses (where the actual
work was done) below the names. Indicate all affiliations with a lower-case superscript letter
immediately after the author's name and in front of the appropriate address. Provide the full
postal address of each affiliation, including the country name, and, if available, the e-mail
address of each author.
• Corresponding author. Clearly indicate who will handle correspondence at all stages of
refereeing and publication, also post-publication. Ensure that telephone and fax numbers (with
country and area code) are provided in addition to the e-mail address and the complete postal
address.
• Present/permanent address. If an author has moved since the work described in the article
was done, or was visiting at the time, a "Present address" (or "Permanent address") may be
indicated as a footnote to that author's name. The address at which the author actually did the
work must be retained as the main, affiliation address. Superscript Arabic numerals are used
for such footnotes.
68
Abstract
A concise and factual abstract is required. (maximum length 100-150 words).
The abstract should state briefly the purpose of the research, the principal results and major
conclusions. An abstract is often presented separately from the article, so it must be able to
stand alone. For this reason, References should be avoided, but if essential, then cite the
author(s) and year(s). Also, non-standard or uncommon abbreviations should be avoided, but
if essential they must be defined at their first mention in the abstract itself.
Capsule: In addition to the abstract for the manuscript, authors are required to submit a one-
sentence statement that describes the significance of their work to the rest of the scientific
community. When necessary, the capsule may be edited before publication.
Graphical abstract
Although a graphical abstract is optional, its use is encouraged as it draws more attention to
the online article. The graphical abstract should summarize the contents of the article in a
concise, pictorial form designed to capture the attention of a wide readership. Graphical
abstracts should be submitted as a separate file in the online submission system. Image size:
Please provide an image with a minimum of 531 × 1328 pixels (h × w) or proportionally
more. The image should be readable at a size of 5 × 13 cm using a regular screen resolution of
96 dpi. Preferred file types: TIFF, EPS, PDF or MS Office files. See
http://www.elsevier.com/graphicalabstracts for examples.
Authors can make use of Elsevier's Illustration and Enhancement service to ensure the best
presentation of their images and in accordance with all technical requirements: Illustration
Service.
Highlights
Highlights are mandatory for this journal. They consist of a short collection of bullet points
that convey the core findings of the article and should be submitted in a separate editable file
in the online submission system. Please use 'Highlights' in the file name and include 3 to 5
bullet points (maximum 85 characters, including spaces, per bullet point). See
http://www.elsevier.com/highlights for examples.
Keywords
Keywords: Immediately after the abstract, provide a maximum of 5 keywords, avoiding
general and plural terms and multiple concepts (avoid, for example, "and", "of"). Be sparing
with abbreviations: only abbreviations firmly established in the field may be eligible. Note
that these keywords will be used for indexing purposes.
Acknowledgements
Collate acknowledgements in a separate section at the end of the article before the references
and do not, therefore, include them on the title page, as a footnote to the title or otherwise.
List here those individuals who provided help during the research (e.g., providing language
help, writing assistance or proof reading the article, etc.).
69
Units
Units and symbols: The SI system should be used for all scientific and laboratory data: if in
certain instance, it is necessary to quote other units, these should be added in parentheses.
Temperatures should be given in degrees Celsius.
Footnotes
Footnotes should be used sparingly. Number them consecutively throughout the article. Many
word processors build footnotes into the text, and this feature may be used. Should this not be
the case, indicate the position of footnotes in the text and present the footnotes themselves
separately at the end of the article.
Electronic artwork
General points
• Make sure you use uniform lettering and sizing of your original artwork.
• Preferred fonts: Arial (or Helvetica), Times New Roman (or Times), Symbol, Courier.
• Number the illustrations according to their sequence in the text.
• Use a logical naming convention for your artwork files.
• Indicate per figure if it is a single, 1.5 or 2-column fitting image.
• For Word submissions only, you may still provide figures and their captions, and tables
within a single file at the revision stage.
• Please note that individual figure files larger than 10 MB must be provided in separate
source files.
A detailed guide on electronic artwork is available on our website:
http://www.elsevier.com/artworkinstructions.
You are urged to visit this site; some excerpts from the detailed information are given here.
Formats
Regardless of the application used, when your electronic artwork is finalized, please 'save as'
or convert the images to one of the following formats (note the resolution requirements for
line drawings, halftones, and line/halftone combinations given below):
EPS (or PDF): Vector drawings. Embed the font or save the text as 'graphics'.
TIFF (or JPG): Color or grayscale photographs (halftones): always use a minimum of 300 dpi.
TIFF (or JPG): Bitmapped line drawings: use a minimum of 1000 dpi.
TIFF (or JPG): Combinations bitmapped line/half-ton (color or grayscale): a minimum of 500
dpi is required.
Please do not:
• Supply files that are optimized for screen use (e.g., GIF, BMP, PICT, WPG); the resolution
is too low.
• Supply files that are too low in resolution.
• Submit graphics that are disproportionately large for the content.
Color artwork
Please make sure that artwork files are in an acceptable format (TIFF (or JPEG), EPS (or
PDF), or MS Office files) and with the correct resolution. If, together with your accepted
article, you submit usable color figures then Elsevier will ensure, at no additional charge, that
these figures will appear in color online (e.g., ScienceDirect and other sites) regardless of
whether or not these illustrations are reproduced in color in the printed version. For color
reproduction in print, you will receive information regarding the costs from Elsevier after
receipt of your accepted article. Please indicate your preference for color: in print or online
70
only. For further information on the preparation of electronic artwork, please see
http://www.elsevier.com/artworkinstructions.
Please note: Because of technical complications that can arise by converting color figures to
'gray scale' (for the printed version should you not opt for color in print) please submit in
addition usable black and white versions of all the color illustrations.
Figure captions
Ensure that each illustration has a caption. A caption should comprise a brief title (not on the
figure itself) and a description of the illustration. Keep text in the illustrations themselves to a
minimum but explain all symbols and abbreviations used.
Tables
Please submit tables as editable text and not as images. Tables can be placed either next to the
relevant text in the article, or on separate page(s) at the end. Number tables consecutively in
accordance with their appearance in the text and place any table notes below the table body.
Be sparing in the use of tables and ensure that the data presented in them do not duplicate
results described elsewhere in the article. Please avoid using vertical rules.
References
Responsibility for the accuracy of bibliographic citations lies entirely with the authors.
Citation in text
Please ensure that every reference cited in the text is also present in the reference list (and
vice versa). Any references cited in the abstract must be given in full. Unpublished results and
personal communications are not recommended in the reference list, but may be mentioned in
the text. If these references are included in the reference list they should follow the standard
reference style of the journal and should include a substitution of the publication date with
either 'Unpublished results' or 'Personal communication'. Citation of a reference as 'in press'
implies that the item has been accepted for publication.
Reference links
Increased discoverability of research and high quality peer review are ensured by online links
to the sources cited. In order to allow us to create links to abstracting and indexing services,
such as Scopus, CrossRef and PubMed, please ensure that data provided in the references are
correct. Please note that incorrect surnames, journal/book titles, publication year and
pagination may prevent link creation. When copying references, please be careful as they may
already contain errors. Use of the DOI is encouraged.
Web references
As a minimum, the full URL should be given and the date when the reference was last
accessed. Any further information, if known (DOI, author names, dates, reference to a source
publication, etc.), should also be given. Web references can be listed separately (e.g., after the
reference list) under a different heading if desired, or can be included in the reference list.
Reference management software
This journal has standard templates available in key reference management packages EndNote
(http://www.endnote.com/support/enstyles.asp) and Reference Manager
(http://refman.com/support/rmstyles.asp). Using plug-ins to wordprocessing packages, authors
71
only need to select the appropriate journal template when preparing their article and the list of
references and citations to these will be formatted according to the journal style which is
described below.
Reference formatting
There are no strict requirements on reference formatting at submission. References can be in
any style or format as long as the style is consistent. Where applicable, author(s) name(s),
journal title/book title, chapter title/article title, year of publication, volume number/book
chapter and the pagination must be present. Use of DOI is highly encouraged. The reference
style used by the journal will be applied to the accepted article by Elsevier at the proof stage.
Note that missing data will be highlighted at proof stage for the author to correct. If you do
wish to format the references yourself they should be arranged according to the following
examples:
Reference style
Name and year style in the text
Text: All citations in the text should refer to:
1. Single author: the author's name (without initials, unless there is ambiguity) and the year of
publication;
2. Two authors: both authors' names and the year of publication;
3. Three or more authors: first author's name followed by 'et al.' and the year of publication.
Citations may be made directly (or parenthetically). Groups of references should be listed first
alphabetically, then chronologically.
Examples: "as demonstrated (Allan, 1996a, 1996b, 1999; Allan and Jones, 1995). Kramer et
al. (2000) have recently shown ..."
List: References should be arranged first alphabetically and then further sorted
chronologically if necessary. More than one reference from the same author(s) in the same
year must be identified by the letters "a", "b", "c", etc., placed after the year of publication.
Note that any (consistent) reference style and format may be used: the Publisher will ensure
that the correct style for this journal will be introduced for the proof stages, the final print
version and the PDF files for electronic distribution.
Examples:
Reference to a journal publication:
Van der Geer, J., Hanraads, J.A.J., Lupton, R.A., 2000. The art of writing a scientific article.
Journal of Scientific Communications 163, 51-59.
Reference to a book:
Strunk Jr., W., White, E.B., 1979. The Elements of Style, third ed. Macmillan, New York.
Reference to a chapter in an edited book:
Mettam, G.R., Adams, L.B., 1999. How to prepare an electronic version of your article, in:
Jones, B.S., Smith, R.Z. (Eds.), Introduction to the Electronic Age. E-Publishing Inc., New
York, pp. 281-304.
Video data
Elsevier accepts video material and animation sequences to support and enhance your
scientific research. Authors who have video or animation files that they wish to submit with
their article are strongly encouraged to include links to these within the body of the article.
This can be done in the same way as a figure or table by referring to the video or animation
72
content and noting in the body text where it should be placed. All submitted files should be
properly labeled so that they directly relate to the video file's content. In order to ensure that
your video or animation material is directly usable, please provide the files in one of our
recommended file formats with a preferred maximum size of 50 MB. Video and animation
files supplied will be published online in the electronic version of your article in Elsevier Web
products, including ScienceDirect: http://www.sciencedirect.com. Please supply 'stills' with
your files: you can choose any frame from the video or animation or make a separate image.
These will be used instead of standard icons and will personalize the link to your video data.
For more detailed instructions please visit our video instruction pages at
http://www.elsevier.com/artworkinstructions. Note: since video and animation cannot be
embedded in the print version of the journal, please provide text for both the electronic and
the print version for the portions of the article that refer to this content.
AudioSlides
The journal encourages authors to create an AudioSlides presentation with their published
article. AudioSlides are brief, webinar-style presentations that are shown next to the online
article on ScienceDirect. This gives authors the opportunity to summarize their research in
their own words and to help readers understand what the paper is about. More information
and examples are available at http://www.elsevier.com/audioslides. Authors of this journal
will automatically receive an invitation e-mail to create an AudioSlides presentation after
acceptance of their paper.
Supplementary data
Elsevier accepts electronic supplementary material to support and enhance your scientific
research. Supplementary files offer the author additional possibilities to publish supporting
applications, high-resolution images, background datasets, sound clips and more.
Supplementary files supplied will be published online alongside the electronic version of your
article in Elsevier Web products, including ScienceDirect: http://www.sciencedirect.com. In
order to ensure that your submitted material is directly usable, please provide the data in one
of our recommended file formats. Authors should submit the material in electronic format
together with the article and supply a concise and descriptive caption for each file. For more
detailed instructions please visit our artwork instruction pages at
http://www.elsevier.com/artworkinstructions.
Data at PANGAEA
Electronic archiving of supplementary data enables readers to replicate, verify and build upon
the conclusions published in your paper. We recommend that data should be deposited in the
data library PANGAEA (http://www.pangaea.de). Data are quality controlled and archived by
an editor in standard machine-readable formats and are available via Open Access. After
processing, the author receives an identifier (DOI) linking to the supplements for checking.
As your data sets will be citable you might want to refer to them in your article. In any case,
data supplements and the article will be automatically linked as in the following example:
doi:10.1016/0016-7037(95)00105-9. Please use PANGAEA's web interface to submit your
data (http://www.pangaea.de/submit/).
Interactive plots
This journal encourages you to include data and quantitative results as interactive plots with
your publication. To make use of this feature, please include your data as a CSV (comma-
73
separated values) file when you submit your manuscript. Please refer to
http://www.elsevier.com/interactiveplots for further details and formatting instructions.
Submission checklist
The following list will be useful during the final checking of an article prior to sending it to
the journal for review. Please consult this Guide for Authors for further details of any item.
Ensure that the following items are present:
One author has been designated as the corresponding author with contact details:
• E-mail address
• Full postal address
All necessary files have been uploaded, and contain:
• Keywords
• All figure captions
• All tables (including title, description, footnotes)
Further considerations
• Manuscript has been 'spell-checked' and 'grammar-checked'
• All references mentioned in the Reference list are cited in the text, and vice versa
• Permission has been obtained for use of copyrighted material from other sources (including
the Internet)
Printed version of figures (if applicable) in color or black-and-white
• Indicate clearly whether or not color or black-and-white in print is required.
• For reproduction in black-and-white, please supply black-and-white versions of the figures
for printing purposes.
For any further information please visit our customer support site at
http://support.elsevier.com.
Use of the Digital Object Identifier
The Digital Object Identifier (DOI) may be used to cite and link to electronic documents. The
DOI consists of a unique alpha-numeric character string which is assigned to a document by
the publisher upon the initial electronic publication. The assigned DOI never changes.
Therefore, it is an ideal medium for citing a document, particularly 'Articles in press' because
they have not yet received their full bibliographic information. Example of a correctly given
DOI (in URL format; here an article in the journal Physics Letters B):
http://dx.doi.org/10.1016/j.physletb.2010.09.059
When you use a DOI to create links to documents on the web, the DOIs are guaranteed never
to change.
Online proof correction
Corresponding authors will receive an e-mail with a link to our online proofing system,
allowing annotation and correction of proofs online. The environment is similar to MS Word:
in addition to editing text, you can also comment on figures/tables and answer questions from
the Copy Editor. Web-based proofing provides a faster and less error-prone process by
allowing you to directly type your corrections, eliminating the potential introduction of errors.
If preferred, you can still choose to annotate and upload your edits on the PDF version. All
instructions for proofing will be given in the e-mail we send to authors, including alternative
methods to the online version and PDF.
We will do everything possible to get your article published quickly and accurately. Please
use this proof only for checking the typesetting, editing, completeness and correctness of the
74
text, tables and figures. Significant changes to the article as accepted for publication will only
be considered at this stage with permission from the Editor.It is important to ensure that all
corrections are sent back to us in one communication. Please check carefully before replying,
as inclusion of any subsequent corrections cannot be guaranteed. Proofreading is solely your
responsibility.
Offprints
The corresponding author, at no cost, will be provided with a personalized link providing 50
days free access to the final published version of the article on ScienceDirect. This link can
also be used for sharing via email and social networks. For an extra charge, paper offprints
can be ordered via the offprint order form which is sent once the article is accepted for
publication. Both corresponding and co-authors may order offprints at any time via Elsevier's
WebShop (http://webshop.elsevier.com/myarticleservices/offprints). Authors requiring
printed copies of multiple articles may use Elsevier WebShop's 'Create Your Own Book'
service to collate multiple articles within a single cover
(http://webshop.elsevier.com/myarticleservices/booklets).
Additional information
Language editing
Information on author-paid and pre-accept language editing services available to authors can
be found at http://authors.elsevier.com/LanguageEditing.html .
Online Publication
Your article will appear on Elsevier's online journal database ScienceDirect as an "Article in
Press" within approximately 4-6 weeks of acceptance. Articles in Press for this journal can be
viewed at http://www.sciencedirect.com/science/journal/02697491 . An Article in Press may
be cited prior to its publication by means of its unique digital object identifier (DOI) number,
which does not change throughout the publication process.
75
ANEXO II
FEMS MICROBIOLOGY REVIEWS
AIMS AND SCOPE
This journal publishes reviews dealing with all aspects of microbiology that have not been
surveyed recently. Reviews should be devoted to topics of current interest and provide
comprehensive, critical and authoritative coverage. They should provide new perspectives and
critical, detailed discussions of significant trends in the areas being reviewed and may contain
elements of a speculative and selective nature. All reviews should address both specialists and
the general reader. Whenever possible, reviews should be put into the framework of general
microbiology and biology. Manuscripts of lectures delivered at symposia that do not review
the related field are not acceptable, nor are unevaluated compilations of the literature.
EDITORIAL POLICY
Members of the Editorial Board and other appropriate experts will referee the papers. Editors
handling papers will independently make decisions on acceptance, revision or rejection based
on the referees’ reports. Authors who feel that there are substantial grounds for disagreement
with an Editor’s decision should contact the Chief Editor, whose decision will be final.
Authors who wish to withdraw their manuscript (at any stage of the process) should contact
their Editor.
ARTICLE TYPES
Review Articles The length of the review should be at least eight pages and normally not
exceed 25 pages upon publication in the journal. High quality colour figures, diagrams or
photographs are encouraged and will be printed free of charge providing that the use of colour
adds value to the Review. Supporting information is published free of charge. Letters to the
Editor are brief communications focusing on an article that has been published in the journal
within the previous six months. They should focus on some aspect(s) of the paper that is, in
the author's opinion, incorrectly stated or interpreted, controversial, misleading or in some
other way worthy of comment. All Letters to the Editor must address a scientific issue in an
objective fashion, should be fewer than 1000 words, and will be externally refereed. If
acceptable for publication, they will be offered to the original authors for comment. The
manuscript should be sent directly by e-mail to the Editor who was the handling Editor of the
review paper the letter is referring to.
SUBMISSION PROCEDURES FEMS Microbiology Reviews does not provide the option to submit uninvited manuscripts.
Review manuscripts may be solicited from international leading investigators by one of the
Editors or proposals for reviews may be sent to the Chief Editor or one of the Editors with
appropriate interests. Editors’ contact details and fields of interest are listed in each issue and
on the journal web site. Authors are encouraged to contact Editors directly by e-mail. Such
proposals should contain: an outline (1–3 pages) a short statement describing the aim, scope
and relevance of the review, and an indication of why the review is timely. This should
typically be no more than 40 words information on whether there has been any review
covering this or a related field in the past few years, and, if so, the specific importance of the
proposed review a statement as to when the completed review might be expected full contact
details of four experts in the field who are familiar with the topic a list of recent key
76
references showing the contributions to the field made by the author(s). The proposals are
evaluated and authors may be invited to submit the review if the material is satisfactory and of
general interest.
Manuscripts should be submitted through ScholarOne Manuscripts®
http://mc.manuscriptcentral.com/femsre. Instructions for the submission procedure can be
found in the authors quick start guide
(http://mchelp.manuscriptcentral.com/tutorials/Author.pdf) under ‘Get help now’, reached via
the ‘Get help now’ button at the top right of all ScholarOne Manuscripts pages. There must be
only one corresponding author.
Nominated Reviewers. When suggesting reviewers for manuscripts, authors should choose
suitably qualified scientists who have no close affiliation with the authors and who can give
an objective review of the manuscript. Professional e-mail addresses must be provided, if
available, rather than private e-mail addresses. The Editors retain the right to use their
discretion to select reviewers they deem appropriate, who may or may not include those
nominated by authors.
Revised Manuscripts. Manuscripts may be returned to authors for modification of the
scientific content and/or for shortening and layout corrections and/or figure improvement.
Revised versions must be submitted online through ScholarOne Manuscripts by clicking on
the link to upload a revised manuscript provided in the authors’ decision letter. This can also
be achieved by clicking on the ‘‘create a revision’’ button in the corresponding author’s
submitting author centre. A source file is required with text and tables (.doc, .docx or .rtf
format, but not .pdf). Information must be provided on responses to Editor’s and referees’
comments through a cover letter. A clear indication is also required of changes that have been
made. Authors must also upload a file as a supporting document in which original and revised
text are compared.
Figures. should be uploaded in separate files and at sufficient resolution (see section on
Preparation of data). All obsolete files of the previous version should be deleted from the
revised submission. If a paper that is returned to the authors for amendment is not resubmitted
in revised form within two month after minor and three months after a major revision, the
paper will be regarded as withdrawn, unless request for extension is made to the Editor
dealing with the paper.
Rejected Manuscripts. In some cases, authors are offered the possibility to transfer a paper
that cannot be accepted for publication to Wiley’s open access journal, MicrobiologyOpen
(www.microbiologyopen.com/info). Related reviewer comments are also transferred and
articles can be transferred without rewriting or reformatting. The paper is then considered by
the Editor of MicrobiologyOpen and a rapid decision is made (usually within 15 days),
providing the potential for rapid publication.
PREPARATION OF MANUSCRIPTS
Language. Manuscripts should be in English (consistent with either UK or US spelling).
Authors who are unsure of correct English usage should have their manuscripts checked by
someone proficient in the language. You are strongly advised to ensure that the English is of a
publishable standard prior to submission. Manuscripts that are seriously deficient in this
77
respect will be rejected without peer review. Authors for whom English is a second language
may choose to have their manuscript professionally edited before submission to improve the
English. A list of independent suppliers of editing services can be found at
http://authorservices.wiley.com/bauthor/english_language.asp. All services are paid for and
arranged by the author and use of one of these services does not guarantee acceptance or
preference for publication.
Layout of manuscripts. FEMS politely requests you compile your manuscript in MS Word
and save it as a .doc or .docx file (not a .pdf file), using the following layout. Title page, the
abstract, main text in one single column and references. Tables, each on a separate page.
Figure legends. Figures, placing each figure on a separate page and ensuring that the figure is
at least twice the size it will be in the published document. Include the figure number (e.g.
Fig. 1) and optionally including the figure legend well outside the boundary of the space
occupied by the figure. ScholarOne Manuscripts will combine your separately uploaded
figure files and the manuscript main body into one online file. Please ensure that you upload
the figures only once, i.e. either embedded at the end of the text document or as separate files.
Include page and line numbering (continuous). The right-hand margin justification should be
switched off. Artificial word breaks at the end of lines must be avoided. If you do not use MS
Word then save in MS Word format in the word processor that you use. Rich text (.rtf) format
may also be used. Use standard fonts (Arial, Times New Roman, Symbol, Helvetica, Times).
In your Word document, on the Tools menu, click Options, select the Embed TrueType fonts
check box and then click the Save tab. There is no maximum length for papers, but authors
are urged to be concise. The length should be justified by the content and normally should not
exceed 25 journal pages (one journal page is equivalent to about 1000 words). Excessively
long reference lists should be avoided. Repetition of information in the text and illustrations
should not occur. A table should not occupy more than one journal page.
Title, authors, keywords and running title. Reviews published in FEMS Microbiology
Reviews should appeal to both specialist microbiologists and the general reader. Therefore,
the manuscript should be headed by a concise, informative title. Authors are reminded that
titles are widely used in information-retrieval systems. The name, full postal address,
telephone and fax numbers, and e-mail address of one corresponding author should be
provided in a footnote. FEMS journals only accept one corresponding author.
The title should be followed by a one-sentence summary (typically no more than 40 words)
describing the most important message of the review. When assigned to an issue, this
summary will appear immediately under the title of each article in the online Table of
Contents and will be free to all readers, but will not be published in print. This short, non-
technical summary should comprise information on the novelty of the review, and the
language used should be understood by a non-specialist. For further guidelines, please check
http://authorservices.wiley.com/bauthor/seo.asp. Keywords should not include words in the
title or abstract and authors should supply a running title of up to 60 characters (including
spaces).
Abstract. This should be a single paragraph of less than 200 words and must be intelligible
without reference to the full paper. Ideally, references are not cited. Abbreviations should be
avoided, but if necessary, they must be defined the first time they are used in the main text.
Do not abbreviate genus in the title, keywords, or at first use in the Abstract and Introduction.
78
Introduction. This should state the aims, scope and relevance of the review, and an
introduction to the subject area being reviewed. The body of the review should be organized
into sub-sections headed by informative sub-titles. Concluding remarks should not repeat the
Introduction or main sections but may, for example, point to future directions.
Acknowledgements can be made to funding agencies, colleagues who assisted with the work
or the preparation of the manuscript, and those who contributed materials or provided
unpublished data.
References.
Tables. All tables must be cited in the text in the order that they appear. Explanatory
footnotes should be related to the legend or table using superscript, lower-case letters. All
abbreviations should be defined after the footnotes below the table. Tables should be supplied
in Word or Excel format, and must be editable (not pasted in as a picture).
Figures. All figures must be cited in the text in the order that they appear. Illustrations are an
important medium through which to convey the meaning in your article, and there is no
substitute for preparing these to the highest possible standard. Therefore, please create your
illustrations carefully with reference to graphics guidelines (see
http://authorservices.wiley.com/electronicartworkguidelines.pdf and
http://authorservices.wiley.com/bauthor/faq.asp). It is very difficult to improve an image that
has been saved or created in an inappropriate format. Not everyone has access to high-end
graphics software, so the following information may help optimise the tools at your disposal.
79
ANEXO III
FEMS Microbiology Letters
AIMS AND SCOPE
FEMS Microbiology Letters gives priority to concise papers that merit urgent publication by
virtue of their originality, general interest and their contribution to new developments in
microbiology. All aspects of microbiology, except virology (other than bacteriophages), are
covered. Areas of special interest include: molecular biology and genetics; genomics;
microbial biochemistry and physiology; structure and development; pathogenicity; medical
and veterinary microbiology; environmental microbiology; applied microbiology and
microbial biotechnology; systematics and bioinformatics. Papers (Research Letters and
MiniReviews) can deal with any type of microorganism: bacteria, archaea, bacteriophage and
archaeal viruses, yeasts, filamentous fungi, protozoa, cyanobacteria and eukaryotic algae. In
addition, the journal will publish Perspective, Current Opinion and Controversy Articles,
Commentaries and Letters to the Editor on topical issues in microbiology. The journal will
consider succinct, one-page genome announcements of scientific interest. Statements that a
sequence has been completed will not be considered without further justification for the
announcement. The sequence must first be deposited in a freely available genome database.
EDITORIAL POLICY
All submitted research papers should be complete in themselves and adequately supported by
experimental detail; they should not be preliminary versions of communications to be
published elsewhere. Papers are expected to have findings that are novel, innovative, of
significance and/or present new hypotheses; descriptions of new methods are acceptable.
Papers that provide confirmatory evidence or merely extend observations firmly established in
one species or field site to another will not be accepted unless there are strong reasons for
doing so. Members of the Editorial Board and other appropriate experts will referee the
papers. Editors handling papers will independently make decisions on acceptance, revision,
resubmission or rejection based on the referees’ reports. The Chief Editor or Editors will
reject papers, with an immediate decision, that are outside the scope of the journal, lack
significance or which they believe do not meet the required standards for other reasons.
Authors who feel that there are substantial grounds for disagreement with an Editor’s decision
should contact the Chief Editor, whose decision will be final. Authors who wish to withdraw
their manuscript (at any stage of the process) should contact their Editor.
ARTICLE TYPES Research Letters describe original experimental work leading to significant advances within
the scope of the journal. Repetition of information in the text and illustrations should not
occur. Priority is given to short papers, the majority of which will occupy only four to six
pages of the journal. The text (including abstract but excluding the title page, references in
text and list, and figure legends) should not exceed 3000 words. References should be kept to
a minimum and a combined total of six figures and tables are permitted. If the paper exceeds
these guidelines, the manuscript will be returned for shortening without review unless the
authors have provided compelling reasons for the exceptional length.
MiniReviews are concise articles reviewing topics of current interest or controversial aspects
of subjects within the scope of the journal. Articles providing new concepts, critical appraisals
and speculation are welcomed. The style for MiniReviews is the same as for research letters,
80
except that the maximum length of the text is about 3,500, with a maximum combined total of
six figures and tables. There is no rigid format for MiniReviews but they should generally
include an Abstract and a brief Introduction in which the background to the article is
presented. The remainder of the text should be arranged under a single, or a maximum two
levels of subheading, finishing with a Conclusion or Outlook section that highlights the
novelty of the MiniReview.
Current Opinion, Perspective and Commentary articles enable authors to present their views
on important topical issues, to discuss new conceptual approaches and to consider, critically,
future developments. Their format is flexible but follows that of MiniReviews, with similar
maximum length. Please choose the manuscript type ‘Other’ when uploading through the
online submission system.
Letters to the Editor are brief communications focusing on an article that has been published
in the journal within the previous six months. They should focus on some aspect(s) of the
paper that is, in the author’s opinion, incorrectly stated or interpreted, controversial,
misleading or in some other way worthy of comment. All Letters to the Editor must address a
scientific issue in an objective fashion, should be fewer than 1000 words, and will be
externally refereed. If acceptable for publication, they will be offered to the original authors
for comment. Please choose the manuscript type ‘Letter to the Editor’ when uploading
through the online submission system.
Current Controversies in Microbiology are short discussion articles that review the benefits
and potential pitfalls of recently developed microbiological methods. Such articles will be in
the form of a discussion section to a paper, with an informative introductory sentence to
indicate the core of the article, but will not include an Abstract, Introduction and other formal
sections. A maximum of two published pages (typically about 1000 words) will be permitted.
Please choose the manuscript type ‘Other’ when uploading through the online submission
system.
Genome announcements. The journal also welcomes announcements of complete genome
sequences, which must succinctly describe especially interesting features that are not already
obvious from previously available datasets. The text (including abstract but excluding the title
page, references in text and as a list, and figure legends) should typically not exceed 1000
words and should always include a relevant accession number linked to a free access public
database. One figure or table would be acceptable, but the total length must not exceed two
printed pages. References should be kept to a minimum. Authors who wish to exceed these
guidelines should contact the Chief Editor.
Nominated Reviewers. When suggesting reviewers for manuscripts, members of the editorial
board and/or suitably qualified scientists should be chosen who have no close affiliation with
the authors and who can give an objective review of the manuscript. Professional e-mail
addresses must be provided, if available, rather than private e-mail addresses. The Editors
retain the right to use their discretion to select reviewers they deem appropriate, which may or
may not include those nominated by authors.
Figures should be uploaded in separate files and at sufficient resolution (see section on
Preparation of data). All obsolete files of the previous version should be deleted from the
revised submission. If a paper that is returned to the authors for amendment is not resubmitted
in revised form within one months, the paper will be regarded as withdrawn, unless request
for extension is made to the Editor dealing with the paper. Any revised version received after
this deadline will be treated as a new, resubmitted manuscript.
81
If you select the OnlineOpen option and your research is funded by certain funders [e.g. The
Wellcome Trust and members of the Research Councils UK (RCUK) or the Austrian Science
Fund (FWF)] you will be given the opportunity to publish your article under a CC-BY license
supporting you in complying with your Funder requirements.
PREPARATION OF MANUSCRIPTS
Language. Manuscripts should be in English (consistent with either UK or US spelling).
Authors who are unsure of correct English usage should have their manuscripts checked by
someone proficient in the language. You are strongly advised to ensure that the English is of a
publishable standard prior to submission. Manuscripts that are seriously deficient in this
respect will be rejected without peer review. Authors for whom English is a second language
may choose to have their manuscript professionally edited before submission to improve the
English. A list of independent suppliers of editing services can be found at
http://authorservices.wiley.com/bauthor/english_language.asp. All services are paid for and
arranged by the author and use of one of these services does not guarantee acceptance or
preference for publication.
Layout of manuscripts. FEMS politely requests you compile your manuscript in MS Word
and save it as a .doc or .docx file (not a .pdf file), using the following layout. Title page, the
abstract, main text in one single column and references. Tables, each on a separate page.
Figure legends.
Figures, placing each figure on a separate page and ensuring that the figure is at least twice
the size it will be in the published document. Include the figure number (e.g. Fig. 1) and
optionally including the figure legend well outside the boundary of the space occupied by the
figure. ScholarOne Manuscripts will combine your separately uploaded figure files and the
manuscript main body into one online file. Please ensure that you upload the figures only
once, i.e. either embedded at the end of the text document or as separate files.
Tables, all tables must be cited in the text in the order that they appear. Explanatory footnotes
should be related to the legend or table using superscript, lower-case letters. All abbreviations
should be defined after the footnotes below the table. Tables should be supplied in Word or
Excel format, and must be editable (not pasted in as a picture).
Use standard fonts (Arial, Times New Roman, Symbol, Helvetica, Times). In your Word
document, on the Tools menu, click Options, select the Embed TrueType fonts check box and
then click the Save tab. In assessing whether the manuscript falls within the recommended
maximum length, one journal page is equivalent to approximately three manuscript pages,
each table is approximately 0.3 of a printed page and each figure is approximately 0.25 of a
printed page. The length of papers should be justified by the content and authors are urged to
be concise. Excessively long reference lists should be avoided. Repetition of information in
the text and illustrations should not occur.
Title, authors, keywords and running title. The manuscript should not form part of a
numbered series but should be headed by a concise, informative title. Authors are reminded
that titles are widely used in information-retrieval systems. The name, full postal address,
telephone and fax numbers, and e-mail address of one corresponding author should be
provided in a footnote. FEMS journals only accept one corresponding author. Keywords
82
should not include words in the title or abstract and authors should supply a running title of up
to 60 characters (including spaces).
General organisation of manuscripts. Materials and Methods and Results are normally
written in the past tense and the present tense is occasionally used in the Introduction and
Discussion.
Abstract. This should be a single paragraph of less than 200 words and must be intelligible
without reference to the full paper. Ideally, references are not cited. Abbreviations should be
avoided, but if necessary, they must be defined the first time they are used in the main text.
Do not abbreviate genus in the title, keywords, or at first use in the Abstract and Introduction.
It is important that the abstract contains a clearly stated hypothesis, a concise description of
the approach and a clear statement of the major novel findings of the study and their
significance.
Introduction. This should place the work in the context of current knowledge, should
indicate the novelty of the study and should conclude with a clear statement of the aims and
objectives, but should not contain a summary of the results.
Materials and Methods. Sufficient detail must be provided to allow the work to be repeated.
Suppliers of materials and a brief address should be mentioned if this might affect the results.
Specific reference must be given for reagents (e.g. plasmids, strains, antibodies) that were not
generated in the study.
Results. Presentation of data is described below.
Discussion. This should not simply repeat the Results. Combined Results and Discussion
sections are encouraged when appropriate.
Acknowledgements. These can include funding agencies, colleagues who assisted with the
work or the preparation of the manuscript and those who contributed materials or provided
unpublished data.
References.
Recommended