Upload
ngoxuyen
View
230
Download
0
Embed Size (px)
Citation preview
Tese de Doutorado
UNIVERSIDADE FEDERAL DE GOIÁS
PROGRAMA DE PÓS-GRADUAÇÃO EM MEDICINA TROPICAL
E SAÚDE PÚBLICA
ADELIANE CASTRO DA COSTA
AVALIAÇÃO DA MODULAÇÃO DA RESPOSTA IMUNE INDUZIDA POR
VACINA CONTRA TUBERCULOSE: rBCG-CMX
Goiânia,
2016
i
TERMO DE CIÊNCIA E DE AUTORIZAÇÃO PARA DISPONIBILIZAR AS
TESES E DISSERTAÇÕES ELETRÔNICAS (TEDE) NA BIBLIOTECA
DIGITAL DA UFG
Na qualidade de titular dos direitos de autor, autorizo a Universidade Federal de Goiás (UFG) a disponibilizar, gratuitamente, por
meio da Biblioteca Digital de Teses e Dissertações (BDTD/UFG), sem ressarcimento dos direitos autorais, de acordo com a Lei nº 9610/98, o
documento conforme permissões assinaladas abaixo, para fins de leitura, impressão e/ou download, a título de divulgação da produção
científica brasileira, a partir desta data.
1. Identificação do material bibliográfico: [ ] Dissertação [ x ] Tese
2. Identificação da Tese ou Dissertação
Autor (a): Adeliane Castro da Costa
E-mail: [email protected]
Seu e-mail pode ser disponibilizado na página? [ x ]Sim [ ] Não
Vínculo empregatício do autor Aluno
Agência de fomento: Sigla: CNPq
País: Brasil UF: GO CNPJ:
Título: AVALIAÇÃO DA MODULAÇÃO DA RESPOSTA IMUNE INDUZIDA POR VACINA
CONTRA TUBERCULOSE: rBCG-CMX
Palavras-chave: Tuberculose, Vacinas, BCG e rBCG-CMX
Título em outra língua: EVALUATION OF THE IMMUNE RESPONSE MODULATION
INDUCED BY VACCINE AGAINST TUBERCULOSIS: rBCG-CMX
Palavras-chave em outra língua: Tuberculosis, Vaccine, BCG and rBCG-CMX
Área de concentração: Imunologia
Data defesa: (dd/mm/aaaa) 01/03/2016
Programa de Pós-Graduação: Programa de Pós Graduação em Medicina Tropical e Saúde Pública
Orientador (a): Prof. Dr. Ana Paula Junqueira Kipnis
E-mail: [email protected]
Co-orientador (a):* Prof. Dr. André Kipnis
E-mail: [email protected]
*Necessita do CPF quando não constar no SisPG
3. Informações de acesso ao documento: Concorda com a liberação total do documento [ x ] SIM [ ] NÃO1
Havendo concordância com a disponibilização eletrônica, torna-se imprescindível o envio do(s)
arquivo(s) em formato digital PDF ou DOC da tese ou dissertação.
O sistema da Biblioteca Digital de Teses e Dissertações garante aos autores, que os arquivos contendo
eletronicamente as teses e ou dissertações, antes de sua disponibilização, receberão procedimentos de segurança,
criptografia (para não permitir cópia e extração de conteúdo, permitindo apenas impressão fraca) usando o padrão
do Acrobat.
_____________________________________ Data: ____ / ____ / _____
Assinatura do (a) autor (a)
1 Neste caso o documento será embargado por até um ano a partir da data de defesa. A extensão deste
prazo suscita justificativa junto à coordenação do curso. Os dados do documento não serão
disponibilizados durante o período de embargo.
ii
ADELIANE CASTRO DA COSTA
AVALIAÇÃO DA MODULAÇÃO DA RESPOSTA IMUNE INDUZIDA POR
VACINA CONTRA TUBERCULOSE: rBCG-CMX
Tese de Doutorado apresentada ao
Programa de Pós-Graduação em
Medicina Tropical e Saúde Pública da
Universidade Federal de Goiás para
obtenção do Título de Doutor em
Medicina Tropical e Saúde Pública.
Orientador: Profa. Dr. Ana Paula
Junqueira Kipnis
Co-orientador: Prof. Dr. André
Kipnis
Goiânia,
2016
iii
iv
Programa de Pós-Graduação em Medicina Tropical e Saúde Pública
da Universidade Federal de Goiás
BANCA EXAMINADORA DA DEFESA DE DOUTORADO
Aluno (a): Ms. Adeliane Castro da Costa
Orientador (a): Profa. Dr. Ana Paula Junqueira Kipnis
Co-orientador (a): Prof. Dr. André Kipnis
Membros:
1. Membro 1 (Presidente da Banca): Profa. Dr. Ana Paula Junqueira Kipnis
2. Membro 2: Profa. Dr. Jaime Martins de Santana
3. Membro 3: Profa. Dr. Luciana Cezar Cerqueira Leite
4. Membro 4: Profa. Dr. Mariane Martins de Araújo Stefani
5. Membro 5: Profa. Dr. Mara Rúbia Nunes Celes
Data: 01/03/16
v
DEDICATÓRIA...
Este trabalho é dedicado
Á Deus, meu pai, companheiro e amigo fiel.
“A Ele Toda Honra e Toda Glória”
Aos meus pais
Antônio Dias da Costa e
Aidê Castro da Costa
Por serem o alicerce da minha vida.
Aos meus irmãos
Vagner Castro da Costa e
Graciélia Castro da Costa,
Por me apoiarem em minhas escolhas.
"Há mais mistérios entre o céu e a terra do que pode sonhar a nossa vã filosofia".
(Shakespeare)
vi
AGRADECIMENTOS
À professora Drª Ana Paula Junqueira-Kipnis, por ser mais que orientadora. Ao me dar
crédido para me orientar no doutorado, investiu em mim suas expectativas, sendo
exigente em suas cobranças. Com ela aprendi fazer minhas escolhas, com objetividade
e foco. Em todo o tempo que estive trabalhando com ela, tive muitas conquitas, mas
também tivemos perdas, porém, todas as perdas foram compensadas com mais
conquistas. Quando falo que conquistamos, parece até que foi fácil, porém foram as
mais árduas tarefas para obtermos as vitórias. Porém, por mais difíceis que tenha sido
a caminhada, a cada vitória vibramos juntas, com muita alegria. Mas não acabou, pois
não foram apenas orientações, há muita amizade envolvida, ao ponto de apenas ela
perceber que eu estava com problemas. Apenas ela conseguiu me mostrar alegrias onde
apenas havia tristezas. Até em minha saúde ela me orientou, onde parecia não haver
saída. Hoje posso dizer que renascemos, que a caminhada foi árdua mas estamos
vencendo. Muito obrigada por ser tudo isso em minha vida. Meus sinceros
agradecimentos.
Ao professor Drº André Kipnis não existem palavras para agradecer o quanto foi
importante... não somente no desenvolvimento deste trabalho, mas sobretudo no meu
crescimento como ser humano. Com seu empenho, dedicação e paciência conduziu a
orientação deste trabalho de maneira sábia. Sabemos que passamos por muitas
dificuldades, muitas no desempenhar do trabalho em si, mas muitas nas relações entre
os colegas... porém com sua sabedoria conseguimos vencer ao ponto de chegarmos na
defesa deste trabalho o qual é muito importante para mim. Além disso, a colaboração
de seu laboratório foi essencial no desenrolar de todo o processo, uma vez que foi
cedido seu tempo, orientações e materiais ao laboratório. Não há dúvidas do quanto o
senhor é importante neste trabalho. No mais, tenho muito a agradecê-lo por fazer parte
deste trabalho.
À colega, companheira e amiga Sarah Veloso Nogueira por fazer parte deste momento,
tanto a elaboração dos trabalhos quanto em sua amizade que foi preciosa. Fui muito
vii
feliz em ter sua presença no laboratório e em nossas atividades. Passamos por
momento difíceis, porém sua amizade me deu forças para continuar. Muito obrigada.
Ao colega e amigo Ms. Danilo Pires de Resende por estar presente durante a
realização dos experimentos. Com sua paciência, bom ânimo e bom coração me
proporcionou forças para continuar e até a conclusão deste trabalho.
Ao colega e amigo Bruno de Paula Oliveira, muitas vezes fui motivada por seu ânimo e
determinação. Deus te deu o dom de iluminar o ambiente em que você está, além de
trabalhar muito bem. Foi muito bom trabalhar com você e conviver com você desde o
primerio momento em que esteve no laboratório. Você foi peça fundamental na
construção deste trabalho. Muito Obrigada.
Ao colega e amigo Fábio Muniz de Oliveira por participar diretamente das atividades
deste trabalho. Com seu entususiasmo, boa vontade e bom ânimo fez com que este
trabalho se tornasse prazeroso em ser realizado. Obrigada por sua amizade sincera e
palavras sábias nos momentos mais difíceis. Muito obrigada.
À colega, companheira e amiga Monalisa Martins Trentini. Podemos dizer que
começamos juntas. É umas das pessas mais inesquecíveis que há em minha vida. Por
ser uma pessoa muito esforçada e animada, trouxe ao laboratório um novo momento,
momento este que se prolonga até hoje. Passamos por muitos momentos juntas, e
compartilhamos muitas alegrias, tristezas e sobretudo conquistas. Levarei suas
lembranças por toda a vida. Muito obrigada por me ensinar, por me animar e por estar
por perto sempre.
Aos colegas Dr. Lorena Cristina dos Santos, Dr. Alxexander Algusto da Silveira e Ms.
Abadio de Oliveira Costa Júnior por terem realizado a construção e produção em larga
escala da vacina rBCG-CMX.
Ao colega e amigo Lázaro Moreira Marques Neto, muito obrigada por proporcionar
bons momentos de profundo conhecimento, visto que é uma pessoa genial e muito
agradável convivência. Por muitos momento, foi responsável por acalentar situaçãoes,
viii
pois é uma pessoa de muita paz de espírito. Muito obrigada por fazer parte da minha
vida.
André França Correa. Muito obrigada por me ensinar a trabalhar com o citômetro de
fluxo FACS Verse da UNB. Agradeço toda paciência e boa vontade. Muito Obrigada.
Ao colega Eduardo Martins de Sousa, muito obrigada por se lembrar de mim, mesmo
depois de passarmos momentos difíceis juntos. Que Deus possa te abençoar
grandemente e possa te fortalecer para que continue conquistando seus objetivos.
A colega e Amiga Adrielle Zagmignan por ter me ajudado na formatação final da tese.
Muito obrigada.
A colega e amiga Viviane Lopes que esteve por perto todo esse tempo, auxiliando o
laboratório, e com seu auxílio foi possível ter o suporte técnico para a realização dos
trabalhos contidos nesta tese. Não somente participação técnica, a Viviane já foi anjo
de Deus em minha vida, em momentos difíceis. Muito obrigada por fazer parte desta
conquista.
Aos colegas e amigos Rogério Coutinho das Neves, Lucilandia Maria Bezerra, Adrielly
Zagmignan, Tatiane Marlene Galvez Sanches, Stella Francy Vicente de Assunção,
Victor Oliveira Procopio, Clayson Moura Gome, Lucila Àvila, Michelle Cristina
Guerreiro dos Reis, e todos os que já passaram pelo laboratório, que de alguma
maneira tenham contribuído diretamente ou indiretamente para este conquista: Aléx,
André, Bruna, Danilo, Duanne, Fernando, Letícia, Marcos, Mayara, Patrícia, Juliana,
Camilla, Matheus, Vanessa, Aline, Lucas, Joyce, Beatriz, Rayanny, Camila, Larissa,
Thaiz. Agradeço ao companheirismo, a compreensão e a todos os momentos que
passamos juntos, todos contribuíram diretamente para meu crescimento pessoal e
profissional. Muito Obrigada.
A todos os professores do IPTSP especialmente do Setor de Imunologia. Muito
obrigada.
ix
Aos funcionários da secretaria geral e da secretaria do curso de pós-graduação:
Senhor Fernando, Valéria, Divina, José Clementino, Kariny. Agradeço toda
assistência.
Aos Amigos: Louvable Nunes Folha, Estevão Marcos Ferreira, Leandro, Zélia de
Oliveira Meira, Teodora Ataíde, Edmilson Barbosa, Donizete+, Adriana Cândido,
Leonardo, Poliana Candido, Maria A. Borges, Glêisson J. de Jesus, Jailma Bastos,
Patrícia S. de Souza Hélio S. de Souza, Edivânia, Edivân, Jean Carlos pela amizade e
bom ânimo. Muito obrigada.
Às agências de fomento CNPq, Sectec e FAPEG pelo financiamento do projeto.
Certamente seria inviável realizar este trabalho sem este apoio. Muito obrigada.
Ao CNPQ pela bolsa de Doutorado. Muito obrigada.
A todos que contribuíram direta ou indiretamente para realização deste trabalho.
Muito obrigada.
x
SUMÁRIO
1 INTRODUÇÃO.............................................................................................................. 1
1.1 TUBERCULOSE........................................................................................................ 1
1.2 Resposta Imune ao Mycobacterium Tuberculosis........................................................ 2
1.3 Modulação da Resposta Imune Inata por Antígenos de Mycobacterium tuberculosis
e produtos micobacterianos................................................................................................
1.3.1. Proteínas de M. tuberculosis reconhecidas por TLR-2.....................................
1. 1.3.2. Proteínas de M. tuberculosis reconhecidas por TLR-4.............................................
1.3.3. Proteínas de M. tuberculosis reconhecidas que interagem com TLR-2, TLR-4 e
e outros receptores..................................................................................................................
6
7
8
9
2 JUSTIFICATIVA.......................................................................................................... 11
3 OBJETIVOS.................................................................................................................. 12
3.1 OBJETIVO GERAL.................................................................................................. 12
3.2 OBJETIVOS ESPECÍFICOS................................................................................... 12
4 ARTIGOS....................................................................................................................... 13
Artigo 1. Recombinant BCG: Innovations on an old vaccine. Scope in BCG strains and
strategies to improve long lasting memory.........................................................................
14
Artigo 2. A New Recombinant BCG Vaccine Induces Specific Th17 and Th1 Effector
Cells with Higher Protective Efficacy against Tuberculosis.............................................
42
Manuscrito. Modulation of the immune response induced by the recombinant fusion
protein CMX involves IL-6 and TGF-β production and TLR-4
stimulation..........................................................................................................................
83
5 DISCUSSÃO.................................................................................................................. 115
6 CONCLUSÕES.............................................................................................................. 120
7 REFERÊNCIAS............................................................................................................. 121
8 ANEXOS....................................................................................................................... 132
xi
TABELAS, FIGURAS E ANEXOS
Table 1
Artigo 1
BCG sub strains genetic background used for recombinant BCG
vaccines development and ability to induce memory and protection
against tuberculosis.
20
Table 2 Description of strains and antigens used in the papers visited for this
review. References published and indexed in PubMed from 2008
April 2013
28
Figure 1
Artigo 2 Plasmid construction and CMX expression for three different
rBCG-CMX vacines
53
Figure 2 Stability of rBCG-CMX in vivo 55
Figure 3 Levels of phagocytosis by peritoneal macrophages of BCG and
rBCG-CMX after infection (MOI = 10)
57
Figure 4 Immunogenicity of rBCG-CMX in BALB/c mice 59
Figure 5 Levels of CD4+IFN-y+ T cells induced by ex vivo stimulation
with recombinant Ag85, MPT51, and HspX
61
Figure 6 Levels of CD4+IL-17+ T cells induced by ex vivo stimulation with
recombinant Ag85, MPT51, and HspX
62
Figure 7 Levels of polyfunctional CD4+ T cells induced by BCG and rBCG-
CMX vacines
64
Figure 8 Bacterial load in the lungs of BALB/c mice 45 days after
Mycobacterium tuberculosis challenge
66
Figura 9 Representative lung pathology of BALB/c mice after challenge 68
Figure 1
Manuscrito
The ex vivo and in vitro induction of cytokines involved in Th17
differentiation
93
Figure 2 In vivo induction of macrophage profile 94
Figure 3 The rBCG-CMX vaccine induces more macrophage apoptosis and
better vaccine processing than does BCG-Moreau
96
Figura 4 Production of cytokines by rAg85c, rMPT51, rHspX and rCMX
proteins in RAW cels and BMMs
98
Figura 5 Production of cytokines by rAg85c, rMPT51, rHspX and rCMX
proteins in BMMs
99
Figure 6 Production of cytokine IL-6 by rAg85c, rMPT51, rHspX and rCMX
proteins in alveolar and peritoneal macrophages
100
Figure 7 TLR receptors related to the recognition of rAg85c, rMPT51, rHspX
and rCMX in BMM from TLR-2 KO and TLR-4 KO mice
101
Suplementar
1
rBCG-CMX vaccine expresses the CMX protein 24 h after infection
in macrophages
102
xii
SÍMBOLOS, SIGLAS E ABREVIATURAS
AERAS-402 Vacina de Adenovirus 35 (rAd35) expressando Ag85A, Ag85B e TB10.4
Ag Antígeno
AIDS Síndrome da Imunodeficiência Adquirida
AP-1 Activator Protein 1
APC Aloficocianina (do inglês Allophycocyanin)
APCs Células Apresentadoras de Antígeno
BAAR Bacilo Álcool Ácido Resistente
BCG Bacillus Calmette–Guérin
BM Medula óssea (do inglês Bone Marrow)
C3 Proteína do Complemento
CCR7 C-C chemokine receptor type 7
CD1 Claster de Diferenciação (do inglês Cluster of Differentiation)
CEUA Comitê de Ética para Uso Animal
CFP-10 Culture Filtrate Protein 10
CFU Unidade Formadora de Colônia (do inglês Colony-Forming Unit)
CO2 Dióxido de Carbono
ConA Concavalina A
COX-2 Cicloxigenase 2
CpG DNA DNA contendo dinucleotídeos CpG não-metilados
cPLA2 Calcium-dependent Phospholipase A2
CR Receptor do Complemento
cRPMI Meio RPMI contendo antibiótico, SBF, Piruvato e Glutamina
CTLs Células T Citolíticas
DAB 3,3'-diaminobenzidina
DATIN Dormancy Associated Translation Inhibitor
DCs Células Dendríticas
DMEM Meio Eagle Modificado por Dulbecco (do ingles Dulbecco's Modified
Eagle's Medium)
DNA Ácido Desoxirribonucleico
E. coli Escherichia coli
ELISA Ensaio Imunoenzimático
ELISA Ensaio Imunoezimático
ESAT-6 Early Secreted Antigen Targed 6
ESX-1 type VII secretion system
F4/80 Marcador de macrófago de camundongo
FACS Fluorescence-activated Cell Sorting
fbp Proteína ligadora de fibronectina (do ingles Fibronectin-binding
protein)
Fc Fragmento Cristalizável (Região do anticorpo)
FITC Isotiocianato de Fluorceína (do inglês Fluorescein Isothiocyanate)
GM-CSF Fator Estimulador de Colônia de Monócitos e Granulócitos
H2O2 Peróxido de Hidrogênio
H37Rv Cepa do Mycobacterium tuberculosis
HE Hematoxilina e Eosina
HIV Vírus da Imunodeficiência Humana (do inglês Human Immunodeficiency
Virus)
xiii
HspX Proteína de Shoque Térmico X (do inglês Heat shock protein X)
IFN-γ Interferon –γ
IgG Imunoglobulina
IL Interleucina
iNOS Óxido Nítrico Sintase Induzível
IPTG Isopropil β-D-1-tiogalactopiranosídio
kan Canamicina
kb Kilobases
LB meio de cultura Lúria Bertanii
LPS Lipopolissacarídeo
LXA4 Lipoxina A4
M. bovis Mycobacterium bovis
mc2-CMX Mycobacterium smegmatis expressando a proteína de fusão CMX
MCP-1 Proteína 1 Quimioatraente de Monócitos (do ingles Monocyte
Chemoattractant Protein-1)
MHC Complexo de Histocompatibilidade Principal (do ingles Major
Histocompability Complex)
miR microRNA
MOI Multiplicidade de Infecção
Mpt-64 uma proteína de 24-kDa do Mtb
MR Receptor de Manose
Mtb Mycobacterium tuberculosis
MTBVAC Vacina de Mtb atenuado
Myd88 Myeloid Differentiation Primary Response 88
NF-κB Nuclear Factor κB
NO Óxido Nítrico
nRD18 non-Region of Differentiation 18
OADC Ácido oléico, dextrose e catalase
ORF Frase de leitura aberta ( do inglês Reading Frames)
PAMPs Padrões Moleculares Associados a Patógeno
PBMC Células Mononucleares do Sangue Periférico ( do ingles Peripheral
Blood Mononuclear Cell)
PBS Tampão Fosfato Salina (do ingles Phosphate Buffered Saline)
PC Positive Control
PCR Reação em Cadeia da Polimerase
PE Ficoeritrina (do ingles Phycoerythrin)
PE35 Membro da família PE M. tuberculosis
PE-PGRS Polymorphic GC-rich Sequences
PERCP Peridina Clorofila ( do inglês Peridinin Chlorophyll)
PGE2 Prostaglandina E2
PI Iodeto de Propídeo
PPD Derivado Proteico Purificado (do ingles Purified Protein Derivative
Test)
PPE Ácido Prolina-prolina-glutâmico
PPE68 Membro da família PPE M. tuberculosis
rBCG AFRO-1 BCG expressing Ag85A, Ag85B and TB10.4
rBCG BCG recombinante
rBCG:30 r30-Ag85B
rBCG-AE rBCG expressing the fusion protein Ag85A-ESAT-6
rBCG-AMM BCG expressing Ag85B-MPT64190-198-Mtb8.4
xiv
rBCG-CMX BCG recombinante expressando a proteína de fusão CMX
rBCGΔureC::hly BCG recombinante delta uréase C expressando lysteriolisina
rCMX Antígeno constituído total ou parcialmente pelo Ag85C, MPT51 e HspX
RD Regions of Difference
RNA Ácido Ribonucleico
RPMI Meio Roswell Park Memorial Institute
SBCAL/COBEA Sociedade Brasileira de Ciência em Animais de Laboratório
SBF Soro Bovino Fetal
SDS–PAGE Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis
SEAP do ingles Secreted Embryonic Alkaline Phosphatase
SigI Fator de Sigma Alternativa de RNA Polimerase ( do ingles Alternative
RNA Polymerase Sigma Factor)
SOC do ingles Super Optimal broth with Catabolite repression
SSC do ingles Side Scatter
TB Tuberculose
TCM Célula T de Memória Central ( do ingles T Central Memory Cell)
TEM Célula T de Memória Efetora ( do ingles T Effector Memory Cell)
TGF-β Fator de crescimento tumoral do tipo β (do ingles Tumor Growth Factor-
β)
Th1 T helper 1
Th17 T helper 17
TLR Receptor do tipo Toll ( do ingles Toll Like Receptors)
TNF-α Fator de Necrose Tumoral α
TRAF Fator associado ao receptor de TNF (do ingles TNF receptor-associated
factor)
TRIF TIR-domain-containing adapter-inducing interferon-β
TST Teste de Sensibilidade a Tuberculina ( do inglês Tuberculin Skin Test)
UFC Unidade Formadora de Colônia
ureC Urease C
WHO Organização Mundial de Saúde - OMS (do ingles World Health
Organization)
xv
RESUMO
A Tuberculose (Tb) é uma doença infecto contagiosa, causada pelo Mycobacterium
tuberculosis (Mtb). Apesar de ser uma doença antiga, a Tb continua sendo um dos principais
problemas de saúde pública. A Organização Mundial de Saúde acredita que cerca de um
terço da população mundial está infectado com Mtb, gerando milhões de mortes por ano.
Uma das medidas que podem melhorar a prevenção e bloquear a transmissão do Mtb é o
desenvolvimento de novas vacinas que previnam o estabelecimento e a progressão da TB em
humanos. Embora exista a vacina BCG que é eficiente contra formas graves de TB na
infância, existe a necessidade do desenvolvimento de novas vacinas para controlar a
disseminação da TB, que sejam mais eficientes e seguras que a BCG. Com este intuito, o
objetivo deste trabalho é avaliar a proteção e a modulação da resposta imune induzida por
BCG recombinante expressando espítopos imunodominantes Ag85C, MPT-51 e HspX do
Mycobacterium tuberculosis induzida em modelo murino. Nossos resultados demonstram
que a inserção da proteína CMX na vacina BCG recombinante (rBCG-CMX) foi um fator
determinante para indução de resposta Th1 e Th17, além de células polifuncionais que
possivelmente foram responsáveis pela redução das lesões inflamatórias no pulmão de
camundongos BALB/c, reduzindo significantemente a carga bacilar em comparação com
imunização com BCG Moreau. Além disso mostramos neste trabalho que a proteína rCMX
é capaz de modular a vacina BCG e ativar a imunidade inata para a indução de uma melhor
resposta protetora. Nossos resultados demonstram que a vacina rBCG-CMX induz ativação
de macrófagos pulmonares por meio da expressão de moléculas de ativação CD86 e CD206.
O aumento da expressão dessas moléculas é acompanhada por produção de TGF-β e IL-1α,
sendo prováveis responsáveis pela menor indução de necrose e maior indução de apoptose
pela vacina rBCG-CMX. Este fenômeno pode estar proporcionando a esta vacina maior
capacidade de sobrevivência celular, colaborando para um melhor processamento e
apresentação por MHC-II. Devido a proteína rCMX ser capaz de induzir produção de IL-1α,
IL-6 e TGF-β por uma via que parece haver a participação de TLR-4. In vivo demonstramos
que a vacina rBCG-CMX depende de TLR-2 e TLR-4 para induzir respostas Th1 e Th17,
após imunização de camundongos com esta vacina. Neste trabalho hipotetizamos que a
proteína CMX pode modular a resposta imune inata e adaptativa, por uma via em que há a
participação do TLR-4. Esta pode ser a via pela qual a CMX, quando expressa por BCG
favorece uma boa resposta protetora em animais desafiados com Mtb.
xvi
ABSTRACT
In the first chapter of this thesis we demonstrate, in a review article, some of the
successful strategies employed in the construction of Bacillus Calmette-Guérin (BCG)
vaccines, among others being: overexpression of promising Mycobacterium tuberculosis
(Mtb) immunodominant antigens already expressed by BCG introduction of Mtb
immunodominant antigens not expressed by BCG, such as antigens in the regions of
difference (RD) 1 thru 16; combination of overexpression and introduction of novel antigens
to BCG; BCG modification to skew immune response toward TCD8+, as for example
recombinant BCG (rBCG) expressing cytokines. In the second chapter, we demonstrate that
the recombinant fusion protein CMX is capable of aggregating important immunogenic
properties to vaccine vectors, by inducing an effective response for the control of Mtb
infection in the mouse tuberculosis infection model. It is hypothesized that the introduction
of the rCMX protein in the BCG vaccine could add immunological properties that are absent
in BCG, thus leading to the induction of important cell populations for the control of Mtb
infection. Our results demonstrate that the introduction of the rCMX in the BCG vaccine,
resulting the recombinant BCG vaccine (rBCG-CMX) was an important factor for the
observed Th1 and Th17 responses, as well as polyfunctional cells, that could be responsible
for the reduced inflammatory lesions seen in the lungs of Mtb infected BALB/c mice,
significantly reducing the bacillary load in comparison to in comparison to mice immunized
with BCG Moreau vaccine. Lastly, in the third chapter of this thesis we propose that rCMX
protein could be responsible for modulating the BCG vaccine to activate a more adequate
and protective innate immunity. Our results show that the rBCG-CMX vaccine induces the
activation of alveolar macrophages by means of expression of activation-associated
molecules CD86 and CD206. The increase in the expression of those molecules are
accompanied by the production of TGF-β e IL-1α which in turn could be responsible for the
decreased necrosis and higher apoptosis induction promoted by rBCG-CMX vaccination.
This phenomenon could be providing a higher cellular survival rate of the recombinant
vaccine, leading to a better processing and presentation by MHC-II. As rCMX was shown to
induce the production of IL-1α, IL-6 e TGF-β by a pathway that seems to involve the
participation of TLR-4, we hypothesize that this recombinant protein could be modulating
the BCG vaccine to induce a more appropriate and protectiveresponse for Mtb infection.
xvii
PRÓLOGO
Meu nome é Adeliane Castro da Costa, sou graduada em Biomedicina pela Pontifícia
Universidade Católica de Goiás (PUC-2009/2). Durante a graduação, em meados de
2008, realizei estágio no Laboratório de Imunopatologia das Doenças Infecciosas, sob a
supervisão da professora Dr. Ana Paula Junqueira Kipnis, com a qual fui iniciada nas
atividades de pesquisa científica. No ensejo, tive a oportunidade de realizar um curso de
Imunologia de verão na USP, sendo de grande importância, por me fazer entender como
funciona um ambiente em que se aspira ciência. Ao concluir a graduação (2009/2)
retornei ao laboratório e tive a oportunidade de ocupar o cargo de Técnico de Nível
Superior do CNPQ. Durante este tempo, aprendi a trabalhar com algumas técnicas de
laboratório e fui responsável pela realização de compras e auxílio em prestação de
contas de projeto de pesquisa. Esse processo foi muito importante, uma vez que me
promoveu a base de como administrar um projeto de pesquisa e seus recursos. Ao final
deste período tive a oportunidade de realizar o processo seletivo para o Mestrado
(2010).
Durante o mestrado realizei a padronização de ELISA para diagnóstico de
Tuberculose, utilizando proteínas de Mtb (rGroES e rCMX). Foi uma importante etapa,
uma vez que participei da finalização da caracterização de proteínas de Mtb para o
diagnóstico da TB. Como resultado deste trabalho com a proteína rGroES, após um ano
de mestrado, publicamos meu primeiro artigo (Revista de Patologia Tropical e Saúde
Pública, 2011). Ao mesmo tempo, participei do início de outra pesquisa no laboratório,
que veio a ser a utilização da proteína de fusão rCMX no diagnóstico e em modelos
vacinais. Deste trabalho com a proteína rCMX publicamos meu segundo artigo (PLOS
one, 2012). Este momento representou o início de minhas atividades em pesquisa, sendo
muito importante em minha carreira, uma vez que tive a oportunidade de participar da
geração de patente da proteína CMX. Além disso, durante o mestrado tive a
oportunidade de participar de outros projetos de pesquisa. Dentre esses posso citar uma
participação em projeto com TB humana, do qual obtive minha terceira publicação
(Immunology Letters, 2014). Em outra linha de pesquisa, trabalhamos com DPOC
(Doença Pulmonar Obstrutiva Crônica), numa colaboração com o Pneumologista
professor Dr. Marcelo Fouad Rabahi, com o qual estive vinculada a um projeto de
xviii
mestrado e um projeto de doutorado. Por meio do trabalho de mestrado, obtivemos
minha quarta publicação (International Journal of COPD, 2014).
Após finalizarmos o meu mestrado, tive a oportunidade de trabalhar durante um ano
na Clínica do Aparelho Respiratório e Medicina do Sono (CLARE), cujo responsável é
o professor Dr. Marcelo Fouad Rabahi. Nesta clínica atuei no diagnóstico de distúrbios
respiratórios e relacionados ao sono, realizando exames de Espirometria e
Polissonografia. Na oportunidade, fui inserida em outro projeto, o qual havia
investimentos de Indústrias Farmaceuticas, nos proporcionando mais uma publicação,
sendo meu quinto artigo (International Journal of COPD, 2015).
Ao final de um ano (2013), retornei ao laboratório da professora Dr. Ana Paula
Junqueira Kipnis, pela qual fui convidada a fazer o Doutorado. Na oportunidade, o
laboratório estava finalizando a construção de uma vacina BCG recombinante
expressando a proteína CMX (rBCG-CMX). A rCMX é uma proteína de fusão
construída por nosso grupo, composta por epítopos imunodominantes dos antígenos
Ag85c, MPT51 e HspX inteiro de Mtb. Esta vacina ativou a resposta imune em
camundongos e de ser antigênica em indivíduos com TB ativa (de Sousa et al., 2012).
Com o intuito de utilizar a rCMX em um modelo vivo de crescimento rápido, a proteína
foi expressa por vetor Mycobacterium smegmatis (mc2-CMX), por meio da qual mostrou
ser boa indutora de resposta imune do tipo Th1 e Th17 em pulmão de camundongos
imunizados, sendo também boa indutora de anticorpos IgG1 e IgG2a (Junqueira-Kipnis
et al, 2013). Diante do contexto de que a rCMX favorece uma resposta eficaz contra a
TB, a proteína foi, então, expressa no vetor vivo BCG (rBCG-CMX). Desta maneira,
realizei no meu doutorado a avaliação da resposta imune e proteção induzida por esta
vacina. Durante o primerio ano, realizamos uma revisão de literatura, do qual gerou meu
sexto artigo (Frontiers in Immunology, 2014) e também capítulo de livro da revista
Frontiers in Immunology. No ensejo, testamos a eficácia da vacina rBCG-CMX em
modelo murino, gerando minha sétima publicação (PLOS one, 2014). Seguindo este
período, avaliamos a capacidade da proteína CMX em modular a resposta imune inata,
por meio do qual submetemos um outro artigo, o qual será abordado nesta tese.
Após 6 anos de trabalho com pesquisa (2010-2016) tive a oportunidade estar em 7
artigos publicados. Além da participação em uma patente e capítulo de livro, podemos
contar como produto mais de 35 resumos apresentados em congressos nacionais e
internacionais. Concomitantemente, realizei minha primeira orientação de Trabalho de
xix
Conclusão de Curso, cujo aluno defendeu recentemente (2016). Atualmente (2015-
2017), ocupo o cargo de Professor Substituto do setor de Imunologia do Instituto de
Patologia Tropical e Saúde Pública, no qual ministro aulas para os cursos de
Biomedicina, Farmácia e Medicina.
1
1. INTRODUÇÃO
1.1. TUBERCULOSE
O agente causador da Tuberculose (TB) é o bacilo de Koch Mycobacterium
tuberculosis (Mtb), o qual foi descoberto em 1882 por Robert Koch (Prémio Nobel em
1905), é responsável por mais mortes do que qualquer outro patógeno (OTTENHOFF, 2009;
KAUFMANN, HUSSEY e LAMBERT, 2010). O Mtb pertencente à ordem
Actinomycetales, subordem Corynebacteriaceae, família das Mycobacteriaceae e gênero
Mycobacterium, e a um complexo denominado complexo Mycobacterium tuberculosis, no
qual faze parte: M. africanus, M. bovis, M. canettii, M. microti, M. pinnipedii e M. caprae.
Entretanto, somente M. africanus, M. bovis e M. tuberculosis (Mtb) causam TB humana
(ROBERTS et al., 1991). A TB pode afetar vários órgãos, mas acomete principalmente os
pulmões (TB Pulmonar), por meio do qual os pacientes acometidos apresentam tosse
produtiva com mais de 15 dias, febre vespertina baixa, suor noturno, dor no tórax e perda de
peso (WHO, 2015).
A TB é uma doença infecto contagiosa que causa, no mundo, em torno de 9 milhões
de novos casos e 1,5 milhões de morte no ano. O Brasil faz parte do grupo que responde por
quase 50% dos casos de TB no mundo. Dentro deste grupo encontra-se Brasil, Federação
Rússia, India, China e África do Sul (BRICS). O Brasil apresenta uma população em torno
de 200,4 milhões de habitantes, sendo notificados 83,310 mil novos casos de TB (WHO,
2015). Dentre esses, 41,885 mil novos casos foram de TB pulmonar bacteriologicamente
diagnosticada, 18,303 mil casos de TB pulmonar diagnosticados clinicamente e 10,148 mil
casos de TB extrapulmonar, dentre outros (WHO, 2015). No Brasil, Goiás é o segundo
estado com menor número de casos, no entanto, esses não mostram redução, sendo
notificados em torno de 867 casos, sendo 546 de TB pulmonar (TB primária). Dados do
Sinan revelam que Goiânia apresenta em torno de 16 casos para cada 100.000 habitantes
(BRASIL, 2014). Uma das principais preocupações da Organização Mundial de Saúde
(OMS) em relação a TB são os casos em que a doença está associada ao Vírus da
Imunodeficiência Humana (HIV). Segundo a WHO, em 2014 a TB é responsável por 1,5
milhões de mortes, sendo que desses 0.4 milhões eram HIV positivas (WHO, 2015).
O tratamento para TB é baseado na administração de Rifampicina, Pirazinamida,
Isoniazida e Etambutol por 2 meses, seguido pela administração de Rifampicina e
Isoniazida por 4 meses. O paciente com TB que apresenta resistência a, no mínimo,
rifampicina e isoniazida é definido como Multi-Droga Resistência (MDR) enquanto que
2
aquele resistente a, no mínimo, fluoroquinolona e a uma segunda linha injetável é definido
como Extensivamente Droga Resistente (XDR). Em geral 3,5% dos novos casos de TB
pulmonar notificados no mundo e 20,5 % dos casos previamente tratados são pacientes TB
Multi Droga Resistentes (MDR). Dos casos de MDR e XDR representam em torno de 9%
dos casos de TB notificados no mundo. Esses dados refletem em torno de 480 mil novos
casos de pacientes com TB MDR, dos quais desencadearam 210 mil mortes em 2013
(WHO, 2015).
Atualmente, a vacina utilizada para prevenção da TB é a BCG (Bacilo Calmette-
Guérin), uma cepa atenuada derivada do Mycobacterium bovis, a qual foi atenuada após
mais de 13 anos de cultura in vitro, sendo utilizada desde 1921 (CALMETTE et al., 1929).
É uma das vacinas mais largamente administradas mundialmente e a única vacina disponível
que previne infecções contra M. tuberculosis (RAPPUOLI e ADEREM, 2011), sendo
produzida em vários laboratórios no mundo. Apesar de ser a única vacina aprovada para uso
humano, e conferir proteção em crianças contra meningite tuberculosa e TB miliar, seu
efeito protetor continua questionável, uma vez que não protege adultos contra TB pulmonar
(WHO, 2015).
Neste ultimo ano (2014), o Brasil investiu 79 milhões de dólares no controle da TB,
sendo que 87% deste investimento foi a partir de financeamento interno e 2% de
financiamento internacional. No entanto, há um fraco financiamento no desenvolvimento de
novas vacinas, a qual tem sido desenvolvida com base em recursos próprios do país (WHO,
2015). Diante deste cenário, o desenvolvimento de novas vacinas para a prevenção da TB é
de extrema urgência, uma vez que a vacina utilizada atualmente apresenta uma variação na
proteção de indivíduos na fase adulta (WHO, 2015).
1.2. Resposta Imune ao Mycobacterium tuberculosis
Após a entrada de Mtb nos pulmões, os macrófagos alveolares são as primeiras
células a interagirem com o bacilo. Tanto em humanos como em camundongos os
macrófagos alveolares reconhecem os PAMPs (Padrões Moleculares associados a
Patógenos) do Mtb por meio de receptores de reconhecimento do padrão (PRR’s) presentes
nessas células, permitindo a ativação e fagocitose do bacilo. Entre os PRRs podem-se citar
os receptores para Fc de imunoglobulinas, complemento, manose, proteína surfactante,
CD14, e CD43 (STURGILL-KOSZYCKI, SCHLESINGER, CHAKRABORTY et al.,
1994; PETERSON, GEKKER, HU et al., 1995; ZIMMERLI, EDWARDS e ERNST, 1996;
3
RANDHAWA, ZILTENER, MERZABAN et al., 2005). Fragmentos da proteína C3 do
complemento são capazes de opsonizar antígenos do Mtb, permitindo uma interação com os
receptores CR1, CR3 e CR4 presentes nos macrófagos (MAGLIONE e CHAN, 2009). É
importante observar que, independente do receptor utilizado na interação com o macrófago,
o colesterol, presente na membrana celular, favorece a ancoragem e assim a internalização
da bactéria (GATFIELD e PIETERS, 2000). Ao interagir com os bacilos de Mtb, por meio
dos receptores Fc de imunoglobulinas, os macrófagos aumentam a produção de
intermediários reativos de oxigênio, permitindo que ocorra a fusão dos fagossomos com os
lisossomos (ARMSTRONG e HART, 1975). Em contrapartida, quando as bactérias
interagem com o CR3 há impedimento da explosão respiratória, em um processo que
impede a fusão dos fagossomos com os lisossomos (STURGILL-KOSZYCKI,
SCHLESINGER, CHAKRABORTY et al., 1994).
Uma outra maneira que Mtb utiliza para interagir com os macrófagos é por meio da
Trealose de mycolato (TDM) presente em sua parede celular. TDM ancora em MARCO
(Scanveger receptor) SR e CD14, presente nos macrófagos promovendo a sinalização nos
receptores TLR2. Por meio destes receptores, TDM modula a resposta dos macrófagos
induzindo a ativação de NF-B e promovendo a produção de IL-6, IL-1 e TGF-. A
afinidade de TDM com MARCO é muito grande, o que induz alto recrutamento de MARCO
na membrana do macrófago, favorecendo a ativação de TLRs e a indução de fagocitose
(BOWDISH, SAKAMOTO, KIM et al., 2009). A capacidade de inibir a fusão do fagossoma
com o lisossoma, a modulação do padrão de morte de células infectadas, além da
propriedade de se reproduzir dentro do compartimento endossomal, promovendo o retardo
da acidificação fagossomal, dá ao bacilo a capacidade de sobrevivência dentro dessas células
(FLYNN e CHAN, 2001).
Um importante mecanismo que Mtb utiliza para sobreviver dentro dos macrófagos é
sua capacidade de sobreviver dentro de vacúolos (RUSSELL, MWANDUMBA e
RHOADES, 2002). Dentro dos macrófagos esta bactéria promove um processo de
dislipidemia tanto dos macrófagos, quanto das células presentes naquele microambiente da
infecção. Após a análise do transcriptoma do granuloma humano, foi possível observar mais
de 30 genes ativos relacionados com o metabolismo lipídico (KIM, WAINWRIGHT,
LOCKETZ et al., 2010). Alguns desses genes promovem o sequestro de lipídio do
hospedeiro para dentro do macrófago. O acúmulo de lipídio dentro do macrófago gera uma
alteração celular conhecida como foamy macrophage. Os lipídeos presentes nos macrófagos
4
servem de fonte de alimento para Mtb, permitindo sua sobrevivência nessas células
(PEYRON, VAUBOURGEIX, POQUET et al., 2008). Em macrófagos provenientes de
granuloma humano foi demonstrado que a presença de colesterol que está envolvendo Mtb,
bem como a presença de proteínas não dobradas (UPR) induz stress do retículo
endoplasmático (RE) e a ativação de CHOP (fator de transcrição ativado em resposta a
proteínas não dobradas). Consequentemente, a ativação de CHOP promove a indução de
apoptose celular (SEIMON, KIM, BLUMENTHAL et al., 2010).
Após a entrada no bacilo no macrófago, este continua interagindo com a célula.
Dentro do fagossoma, Mtb libera vesículas, conhecidas como vesículas de membrana
bacteriana (BMV). Estas vesículas são ricas em lipoproteínas, como lipomananas,
lipoarabnomananas, DNAK dentre outras, capazes de induzir resposta pro-inflamatória ao
interagir com TLR-2 (PRADOS-ROSALES, BAENA, MARTINEZ et al., 2011). 2011).
Estas vesículas são liberadas para o meio extracelular e desempenham atividades pró-
inflamatórias ao interagir com TLR-2 e CD14, induzindo a produção de IL-8 e TNF-α
(ATHMAN, WANG, MCDONALD et al., 2015).
No decorrer da infecção devido a liberação de citocinas pró-inflamatórias, outros
monócitos, assim como células dendríticas são recrutados da corrente sanguínea, sendo
responsáveis pela manutenção da infecção no hospedeiro (DANNENBERG, 1991;
STURGILL-KOSZYCKI, SCHLESINGER, CHAKRABORTY et al., 1994; PEDROZA-
GONZALEZ, GARCIA-ROMO, AGUILAR-LEON et al., 2004). Os monócitos recrutados
para os pulmões, aumentam a expressão de CD11c e tornam-se CD11b+/mid/CD11c+/mid, os
quais se diferenciam em macrófagos alveolares (CD11b-/mid CD11c+/high) e células
dendríticas (CD11b+/high/CD11c+/high) (GONZALEZ-JUARRERO, HATTLE, IZZO et al.,
2005). Após a ativação, as células dendríticas sofrem um processo de maturação que é
acompanhada por um aumento da síntese de MHC de classe I, pela expressão de moléculas
co-estimuladoras, como CD80 (B7.1) e CD86 e CD40, sendo observados nos primeiros dias
de infecção ao Mtb (GONZALEZ-JUARRERO, HATTLE, IZZO et al., 2005).
No modelo de infecção por Mtb no Zebrafish postulou-se que durante o processo de
infecção com os bacilos, ocorre a formação de granulomas epitelióides, antes de se
estabelecer a imunidade adaptativa (DAVIS e RAMAKRISHNAN, 2009). Também
chamada de infecção primária ou primo-infecção, esta fase é caracterizada por apresentar
lesões exsudativas com reação inflamatória aguda, contendo leucócitos circundando os
bacilos. Este tipo de exsudato é absorvido em 90% dos casos, com cicatrização. Com o
estabelecimento da infecção dos macrófagos estes recrutam outras células do sistema imune
5
e formam uma estrutura organizada chamada de granuloma (DANNENBERG, 1991).
Trabalhos utilizando camundongos isogênicos demonstram que a expansão das
micobactérias nos granulomas se dá por ciclos de morte de macrófagos infectados e a
fagocitose por múltiplos macrófagos que são constantemente recrutados (DAVIS e
RAMAKRISHNAN, 2009).
Nos primeiros estágios da TB, a necrose é o evento celular responsável pela morte
dos macrófagos (DANNENBERG, 1989). Entretanto, essas células também podem morrer
por apoptose, sendo causado pela indução de TNF-α, stress oxidativo, ou pela presença de
Mtb (WYLLIE, KERR e CURRIE, 1980). O fenômeno da apoptose se caracteriza por
condensação citoplasmática e nuclear com formação de fragmentos celulares ligados à
membrana. Esses fragmentos são chamados de corpos apoptóticos sendo fagocitados por
outras células e degradados dentro de fagossomas (FINK e COOKSON, 2005). Os corpos
apoptóticos formados carreiam antígenos micobacterianos que podem ser absorvidos e
apresentados de maneira cruzada por células dendríticas para as células TCD8+
(SCHAIBLE, WINAU, SIELING et al., 2003). Durante o processo de maturação das células
dendríticas, os antígenos de Mtb são apresentados aos linfócitos T auxiliares (CD4+), T
citotóxicas (CD8+), células Th17 e linfócitos B nos nódulos linfáticos.
A geração das populações celulares Th1 e Th17 pode ocorrer quando bacilos de Mtb
induzem os fagócitos a produzirem IL-12 ou IL-23, as quais contribuem para a diferenciação
das duas populações celulares, respectivamente, de acordo com a persistência de Mtb
(VELDHOEN, HOCKING, ATKINS et al., 2006; GEROSA, BALDANI-GUERRA,
LYAKH et al., 2008; GORIELY, NEURATH e GOLDMAN, 2008). Porém, após infecção
por Mtb, os linfócitos Tγδ são as primeiras células a induzirem produção da citocina IL-17
(LOCKHART, GREEN e FLYNN, 2006). Inicialmente a IL-17 promove o aumento de
recrutamento de neutrófilos e formação do granuloma (GRODE, SEILER, BAUMANN et
al., 2005). Com a persistência do estímulo por Mtb, a elevada produção de IL-17 por células
Th17, promove aumento nos níveis de infiltrado neutrofílico no pulmão, induzindo dano
tecidual e contribuindo para a imunopatologia da TB (CRUZ, FRAGA, FOUNTAIN et al.,
2010). Enquanto isso, os linfócitos Th1 atuam na produção e secreção de IFN-γ que
aumentam atividade microbicida dos fagócitos e inibem o crescimento de Mtb (NORTH e
JUNG, 2004; TORRADO e COOPER, 2010).
Os linfócitos B são um dos principais componentes do sistema imune, sendo
responsáveis pela imunidade humoral. Em se tratando de proteção para TB, os anticorpos
poderiam aumentar a imunidade por meio da neutralização de toxinas, opsonização, ativação
6
do complemento, promoção da liberação de citocinas, citotoxicidade dependente de
anticorpos, e apresentação de antígenos reforçada (IGIETSEME, EKO, HE et al., 2004;
RELJIC e IVANYI, 2006). Por meio da opsonização, os anticorpos podem aumentar a
internalização dos bacilos do Mtb pelos neutrófilos, monócitos ou macrófagos, por meio dos
receptores Fcγ presentes nos fagócitos. Esta internalização permite o processamento e
apresentação de antígenos pelos macrófagos e células dendríticas, desencadeando atividade
microbicida dessas células e permitindo assim maior estimulação das células TCD4+ e
TCD8+ (SCHUURHUIS, VAN MONTFOORT, IOAN-FACSINAY et al., 2006;
GEISSMANN, MANZ, JUNG et al., 2010). As vacinas para TB podem focar estratégias
que atinjam a imunidade das mucosas, agindo nos linfócitos B, permitindo melhorar a
proteção durante a infecção pelo M. tuberculosis (OTTENHOFF, 2012).
No modelo de infecção por Mtb em Zebrafish, com o estabelecimento da resposta
imune adaptativa, a formação do granuloma coincide com a expansão bacteriana, sugerindo
que a aceleração do estabelecimento da resposta imune adaptativa é impulsionada pelo
crescimento bacteriano (VOLKMAN, CLAY, BEERY et al., 2004; DAVIS e
RAMAKRISHNAN, 2009). É então estabelecida a tuberculose ativa com formação de lesão
tecidual caracterizada por uma inflamação granulomatosa de três zonas: uma com células
gigantes multinucleadas contendo os bacilos, uma camada média de células epitelióides e
uma camada periférica de fibroblastos, células mononucleares e linfócitos T e B dispersos.
A primeira zona apresenta necrose caseosa central, sendo denominados tubérculos.
Posteriormente ocorre a cicatrização por tecido fibroso ou calcificação (COSMA,
SHERMAN e RAMAKRISHNAN, 2003). Os granulomas parecem ser benéficos para o
indivíduo por conter e restringir a micobactéria (ULRICHS e KAUFMANN, 2006). No
entanto, resultados sugerem que a formação do granuloma é uma ferramenta para a
expansão da infecção pelo Mtb (DAVIS e RAMAKRISHNAN, 2009).
1.3. Modulação da Resposta Imune Inata por Antígenos de Mycobacterium tuberculosis
e produtos micobacterianos
Sabe-se que Mtb pode ser reconhecido por receptores em macrófagos como CR3,
TLR-2 e TLR-4, dentre outros (KIM, SOHN, KIM et al., 2012; TIWARI, SOORY e
RAGHUNAND, 2014). Durante muito tempo acreditou-se que proteínas isoladamente não
poderiam ser reconhecidas por TLRs em macrófagos ou células dendríticas. No entanto,
recentemente vem sendo demonstrado que algumas proteínas de Mtb são reconhecidas por
7
TLRs por meio dos quais modulam a resposta de macrófagos (VOSKUIL, VISCONTI e
SCHOOLNIK, 2004; CHATTERJEE, DWIVEDI, SINGH et al., 2011). Algumas dessas
proteínas já foram descritas na literatura, dentre elas HSP60, DNAK, PstS2, DATIN, ESAT-
6, PE35, PPE68 e Rv0652.
1.3.1. Proteínas de M. tuberculosis reconhecidas por TLR-2
Algumas das proteínas de Mtb que interagem com o TLR-2 parecem estar
relacionadas com regiões de virulência desta micobactéria. Dentre estas proteínas, algumas
foram destacadas neste contexto da revisão, sendo essas DATIN, ESAT-6, PE/PPE e
HSP60.
DATIN, também conhecida como Rv0079, é codificada pela ORF Rv0079, e
regulada pelo gene DosR de Mtb (VOSKUIL, VISCONTI e SCHOOLNIK, 2004). Seus
mecanismos de atuação nos macrófagos se dá por meio de sua interação com TLR-2 nessas
células, e indução de processos inibitórios associados a dormência. Estes fatores favorecem
uma atividade pró-inflamatória, ao induzir a produção das citocinas IL-1β, TNF-α, IL-8 e
IFN-γ nos macrófagos estimulados (KUMAR, LEWIN, RANI et al., 2013).
ESAT-6 (do inglês Early Secreted Antigen Targed 6) é uma proteína produzidas por
Mtb durante a fase ativa deste bacilo, a qual é codificada pela região RD-1 do gene (do
inglês Regions of Difference 1) de várias espécies do complexo M. tuberculosis, exceto nos
subtipos do M. bovis BCG (SORENSEN, NAGAI, HOUEN et al., 1995). Esta proteína
interage com TLR-2 e inibe a produção de citocinas pró-inflamatórias, como IL-12p40, IL-6
e TNF-α. Desta mandeira, modula os macrófagos a desempenharem funções anti-
inflamatórias (PATHAK, BASU, BASU et al., 2007). Porém, foi demonstrado que ao
interagir com TLR-2 em células dendríticas, ESAT-6 induz produção de IL-6 e TGF-β, bem
como a indução de células Th17, desempenhando um importante papel na virulência de Mtb
(CHATTERJEE, DWIVEDI, SINGH et al., 2011).
Proteínas do complexo PE/PPE fazem parte do sistema de secreção ESX, o qual é
composto por PE26, PE35, PE68, Rv 3425, dentre outras (FISHBEIN, VAN WYK,
WARREN et al., 2015). Duas importantes proteínas que participam formação do ESAT-6
são as proteínas PE35 e PPE68. Elas fazem parte do sistema de secreção ESX-1 e interagem
in vivo para a expressão de ESAT-6. Foi demonstrado recentemente que essas duas
proteínas, só ou combinadas, interagem com TLR-2 e induzem resposta anti-inflamatória em
macrófagos, por meio do aumento da produção de IL-10 e MCP-1 e redução da produção de
8
IL-12 em macrófagos (TIWARI, SOORY e RAGHUNAND, 2014). Uma outra proteína
pertencente a família PPE é a Rv3425. Esta proteína pertence a RD11 de Mtb (ZHANG,
WANG e LEI et al. 2007). A proteína Rv3425 tem sido intensamente estudada para ser
utilizada em modelo de vacina, tanto recombinanda com BCG, quanto como vacina de
subunidade proteica. Recentemente, a proteína Rv3425 foi fusionada com o Ag85B e
recombinada com a vacina BCG-Danish (BCG:Ag85B-Rv3425). A vacina BCG
expressando a proteína fusionada não melhora a proteção em relação a vacina BCG
(WANG, QIE E LIU et al. 2012). Porém, quando esta vacina é utilizada no sistema de prime
boost (rBCG:Ag85B-Rv3425 + Rv3425), seguido de desafio com Mtb, observou-se melhora
na proteção em relação ao BCG, tanto no baço quanto no pulmão dos camundongos, mesmo
após 22 semanas de infecção Mtb (YANG, GU, WANG, et al. 2016).
1.3.2. Proteínas de M. tuberculosis reconhecidas por TLR-4
Algumas proteínas de Mtb, não pertencentes às regiões de virulência, interagem com
macrófagos por meio da ligação com receptores do tipo TLR-4. Dentre estas proteínas
encontram-se Rv0652, DNAK e as proteínas que se encontram no complexo RpfA-E.
Uma dessas proteínas é o Rv0652 a qual pertence a cepa K de Mycobacterium
tuberculosis da família Beijing. Esta proteína desempenha atividades pró inflamatória com
indução de citocinas IL-12p40, IL-6, TNF-α e IL-1β por uma via dependente de Myd88 e
TRIF (KIM, SOHN, KIM et al., 2012; LEE, SHIN, LEE et al., 2014). Ela possue a
capacidade de promover o recrutamento e o amadurecimento de macrófagos e células
dendríticas, induzindo essas células a expressarem CD80, CD86 e MHC de classe I e MHC
de classe II (LEE, SHIN, LEE et al., 2014).
DNAK (Rv0350) é uma proteína extracelular de Mtb, também conhecida como
proteína de choque térmico 70 (HSP70) (HARTL, BRACHER e HAYER-HARTL, 2011).
Esta proteína ativa o macrófago a expressar molécula CD206 (MR) ao induzir para um perfil
anti-inflamatório (M2) produtor de arginase e citocina IL-10 (LOPES, BORGES, ARAUJO
et al., 2014). Ao interagir com TLR-4 ela induz aumento do processamento e apresentação
via MHC-II em macrófagos (TOBIAN, CANADAY e HARDING, 2004).
Mtb codifica 5 importantes proteínas associadas a sua ressuscitação do estado de
dormência, denomidadas Rpf (do inglês Ressucitation prototing fator). Compreendem as
RpfA-E (Rv0867c, Rv1009, Rv1884c, Rv2389c e Rv2450c) (Mavrici et al. 2014), as quais
são codificadas pela Região DosR (VOSKUIL, VISCONTI e SCHOOLNIK, 2004),
9
Recentemente foi demonstrado que a proteína RpfE de Mtb induz maturação de células
dendríticas, as quais passam a expressar CD80, CD86, MHCI e MHCII, bem como a
secretar IL-6, IL-1 beta, TNF-alfa. Neste estudo foi constadado que ao induzir maturação de
células dendríticas, esta proteína favorece o desenvolvimento de resposta imune adaptativa
Th1 e Th17 por via dependente de TLR-4, mas não de TLR-2 (CHOI, KIM E BACK et al.
2015).
Outras proteínas envolvidas na virulência de Mtb são o Ag85c (Rv 0129c) e o
MPT51 (Rv3803c), as quais possuem peso molecular que varia entre 27 a 32-kDa. Estas
proteínas fazem parte do mesmo complexo, porém com funções diferentes (OHARA,
OHARA-WADA, KITAURA et al., 1997). Enquanto o MPT51 garante a virulência de Mtb,
o Ag85C participa da síntese de mais de 40% do ácido micólico de Mtb, contribuindo para
manutenção da sua integridade e patogênese (KITAURA, OHARA, NAITO et al., 2000;
HARTH, HORWITZ, TABATADZE et al., 2002; SANKI, BOUCAU, RONNING et al.,
2009). O antígeno HspX (Rv2031c), que é uma proteína de choque térmico, provavelmente
participa na conformação final das proteínas de Mtb e favorece a adaptação do crescimento
do Mtb dentro dos macrófagos (CHANG, PRIMM, JAKANA et al., 1996; YUAN, CRANE,
SIMPSON et al., 1998; QAMRA, MANDE, COATES et al., 2005).
1.3.3. Proteínas de M. tuberculosis que interagem com TLR-2, TLR-4 e outros
receptores
HSP60 (do inglês Heat Shock Protein of 60 kDa) é uma proteína de choque térmico
de Mtb (Mtbhsp60), promove o aumento de fagocitose por macrófagos ao interagir com
TLR-2. Após interação, esta proteína induz a produção de IL-10, culminando na modulação
desses macrófagos a um perfil anti inflamatório. Porém, esta proteína também interage com
TLR-4 em macrófagos, induzindo a produção de TNF-α por essas células (PARVEEN,
VARMAN, NAIR et al., 2013). Por meio dos dois receptores a proteína Mtb hsp60 parece
induzir um perfil misto de macrófagos.
O Rv0934 é uma lipoproteína de 38-KDa, também conhecida como PstS2 (do inglês
Phosfatase transporte protein) (MALEN, SOFTELAND e WIKER, 2008). Esta lipoproteína
é uma adesina, atuando no processo de adesão ao se ligar ao receptor de manose (MR-
CD206) em macrófagos, por meio do qual ela induz a fagocitose por essas células
(ESPARZA, PALOMARES, GARCIA et al., 2015). Esta proteína é capaz de induzir Stress
do Retículo endoplasmático (ER stress) e apoptose de macrófagos. Ao interagir com os
10
receptores TLR-4 e TLR-2, ela induz macrófagos a produzirem MCP, TNF-α e IL-6
apresentando uma potente função pró-inflamatória (LIM, CHOI, LEE et al., 2015).
Recentemente tem sido demonstrado que produtos de Mycobacterium bovis BCG
também podem ser reconhecido por receptores PRRs em macrófagos. RNA de BCG pode
interagir com TLR-3 em macrófagos e induzir produção de IL-10, desempenhando um papel
anti-inflamatório (BAI, LIU, JI et al., 2014). O reconhecimento de RNA de BCG por TLR3
está relacionado com a regulação da resposta imune, uma vez que será induzido aumento de
infiltrado inflamatório, lesão tecidual e replicação bacteriana, devido ao desbalanço da
resposta pró-inflamatória (BAI, LIU, JI et al., 2014). Além disso, BCG induz aumento na
expressão de microRNAs (miR), especificamente o miR-124, em macrófagos alveolares.
Esta inibição parece estar relacionada com redução da expressão de TLR-6 e MyD88 e
TRAF6 por miR-124 (MA, LI, LI et al., 2014).
1.3.4. Proteína de Fusão CMX e resultados preliminares que comprovam sua
imunogenicidade.
Após observar a capacidade imunogência e antigênica do Ag85c, MPT51 e HspX,
foi escolhido as sequências de nucleotídeos correspondentes aos epítopos 85 a 159 do
Ag85C, 91 a 112 de MPT51 e o gene HspX, os quais amplificados por PCR a partir do
genoma de M. tuberculosis H37Rv usando primers específicos. Da fusão desses epítopos
construiu-se a proteína recombinante de fusão CMX (Ag85c_MPT51_HspX) (de Sousa et
al. 2012). Posteriormente, esta proteína foi utilizada em modelo de diagnóstico sorológico
da Tb, em modelo de vacina de subunidade protéica e em modelo vivo de vacina.
A proteína CMX foi utilizada em modelo de diagnóstico sorológico da Tuberculose,
utilizando uma pequena corte de 53 pacientes com TB comparando-os com 43 controles
saudáveis. Neste teste foi observado se a proteína CMX é capaz de distinguir pacientes com
TB de indivíduos saudáveis, tanto pela dosagem de IgM quanto pela dosagem de IgG, em
amostras de soros de indivíduos. Os indivíduos TB ativa apresentaram níveis de anticorpos
IgG superiores aos dos controles saudáveis (TB=0,407±0,141; C=0,167±0,072; p< 0,0001).
Ao se fixar uma sensibilidade de 100% com intervalo de confiança de 95% variando de
89,7% a 100% obteve-se uma especificidade de 71,4% (IC 95% de 53,7% a 85,3%). Para
IgM, os indivíduos com TB pulmonar ativa apresentaram média de leituras de anticorpos
IgM específicos para a proteína de fusão superiores (TB=0,305±0,09;C= 0,212±0,057;
p<0,0001). Ao se fixar uma sensibilidade de 80,0% com intervalo de confiança de 95%
11
variando de 63,06% a 91,56% obteve-se uma especificidade de 61,54% (IC 95% de 44,62%
a 76,64%) (De Souza et al. 2012).
Na tentativa de desenvolver uma vacina de subunidade utilizando a proteína de fusão
(CMX), nosso grupo de pesquisa formulou uma vacina contendo lipossoma e CpG DNA
como adjuvante e verificou a indução de resposta imune celular e humoral em camundongos
BALB/c, após receberem 3 imunizações subcutâneas com CMX e CpG DNA. Os grupos
controles foram vacinados somente com CpG DNA encapsulado com lipossoma, somente
lipossoma ou salina. Os resultados mostraram que a vacina CMX é eficaz na indução da
resposta imune humoral específica, pois foi capaz de induzir elevados níveis de IgG1 e
IgG2a no grupo imunizado com CMX encapsulado com lipossoma e CpG DNA. Para
avaliação da resposta imune celular foi verificada se a vacina CMX seria capaz de induzir
resposta imune específica aos linfócitos TCD4+. Resultados mostraram que a percentagem
de linfócitos TCD4+ expressando IFN-γ foram maiores no grupo imunizado com CMX que
os outros grupos. Similarmente, a percentagem de linfócitos TCD4+ expressando TNF-α
foram maiores no grupo imunizado com CMX que os outros grupos (De Souza et al. 2012).
Com o objetivo utilizar a proteína CMX em modelo de vacina viva, foi realizada
uma construção utilizando o Mycobacterium smegmatis recombinante expressando a
proteína CMX (mc2-CMX). Ao imunizar camundongos com esta vacina, ela manteve as
características imunogênicas da CMX, sendo boa indutora de anticorpos do tipo IgG1 e
IgG2a, bem como de linfócitos TCD4+IL-17+ em pulmão dos camundongos imunizados.
Esta resposta pareceu favorecer a capacidade protetora da vacina, quando os animais foram
desafiados com Mtb (Junqueira-Kipnis et al. 2013).
A proteína CMX também foi expressa em outro modelo vacinal, IKE-CMX. Neste
modelo, a vacina IKE-CMX induziu altos níveis de anticorpos IgG2a específicos, bem como
linfócitos TCD4+IL-17+ em pulmão de camundongos imunizados. Análise de populações de
macrófagos em pulmão desses camundongos revelou que esta vacina induz macrófagos
ativados (F4/80+CD11bmid CD11clow), demontrando uma possível modulação da resposta
imune inata (Junqueira-Kipnis et al. 2013).
12
2 JUSTIFICATIVA
Apesar do avanço da ciência desde a sua descoberta, a Tuberculose continua
sendo um dos principais problemas de saúde pública. Uma das medidas que podem
melhorar a prevenção e bloquear a transmissão do Mtb é o desenvolvimento de novas
vacinas que previnam o estabelecimento e a progressão da TB em humanos. Embora
exista a vacina BCG que é eficiente contra formas graves de TB na infância existe a
necessidade do desenvolvimento de novas vacinas para controlar a disseminação da TB,
uma vez que a BCG não proteje indivíduos na fase adulta contra a TB ativa.
Neste sentido, nosso grupo realizou a construção da rCMX, uma proteína de
fusão composta por epítopos imunodominantes dos antígenos Ag85c, MPT51 e HspX
inteiro de Mtb. Foi demonstrado que essa construção manteve a imunogenicidade dos
epítopos em camundongos e se mostrou antigênica em indivíduos com TB ativa.
Quando a proteína rCMX foi expressa por vetor vivo Mycobacterium smegmatis (mc2-
CMX) mostrou-se boa indutora de resposta imune do tipo Th1 e Th17 em pulmão de
camundongos imunizados, com proteção similar a BCG Moreau. Esta construção
também foi boa indutora da produção de anticorpos IgG1 e IgG2a importantes no
controle da TB.
No contexto atual da TB e da BCG, é necessário o desenvolvimento de uma
vacina que tenha melhor desempenho que a BCG usada atualmente, principalmente
devido à insuficiente indução de memória imunológica capaz de proteger jovens
adultos. Dentre as estratégias utilizadas para se desenvolver uma nova vacina está a
construção de uma rBCG e a associação desta com vacinas de subunidade proteica,
capaz de promover melhor desempenho que a BCG, quanto a indução de proteção e
memória.
Neste sentido, este trabalho visou apresentar o desenvolvimento de uma vacina
BCG recombinante expressando a proteína rCMX (rBCG-CMX) e avaliação da
capacidade da proteína rCMX em ativar macrófagos.
13
3. OBJETIVOS
3.1. OBJETIVO GERAL
Avaliar a proteção e a modulação da resposta imune induzida por BCG recombinante
expressando epítopos imunodominantes Ag85C, MPT-51 e HspX do Mycobacterium
tuberculosis induzida em modelo murino.
3.2. OBJETIVOS ESPECÍFICOS
- Realizar uma revisão de literatura sobre vacinas BCGs recombinantes, abordando os
artigos publicados entre os anos de 2008 e 2013, apresentado no artigo intitulado:
Recombinant BCG: Innovations on an old vaccine. Scope in BCG strains and
strategies to improve long lasting memory
- Estudar a indução de resposta imune adaptativa pela vacina rBCG-CMX, apresentada
no artigo intitulado: A New Recombinant BCG Vaccine Induces Specific Th17 and
Th1 Effector Cells with Higher Protective Efficacy against Tuberculosis
- Entender os mecanismos inatos induzidos pela proteína rCMX, apresentada no artigo
intitulado: Modulation of the immune response induced by the recombinant fusion
protein CMX involves IL-6 and TGF-β production and TLR-4 stimulation
14
4 ARTIGOS
Artigo 1 – Recombinant BCG: Innovations on an old vaccine. Scope in BCG
strains and strategies to improve long lasting memory
Autores: Adeliane Castro da Costa, Sarah Veloso Nogueira, André Kipnis and
Ana Paula Junqueira-Kipnis.
Frontiers in Immunology (Publicado)
Artigo 2 – A New Recombinant BCG Vaccine Induces Specific Th17 and Th1
Effector Cells with Higher Protective Efficacy against Tuberculosis
Autores: Adeliane Castro da Costa, Abadio de Oliveira da Costa Júnior, Fábio
Muniz de Oliveira, Sarah Veloso Nogueira, Joseane Damaceno Rosa, Danilo
Pires Resende, André Kipnis e Ana Paula Junqueira-Kipnis.
PLOS one (Publicado)
Manuscrito – Modulation of the immune response induced by the recombinant
fusion protein CMX involves IL-6 and TGF-β production and TLR-4 stimulation
Autores: Adeliane Castro da Costa, Danilo Pires de Rezende, Bruno de Paula
Oliveira Santos, Karina Furlani Zoccal, Lúcia Helena Faccioli, André Kipnis e
Ana Paula Junqueira-Kipnis.
PLOS One (Submetido)
15
Artigo 1
Recombinant BCG: Innovations on an old vaccine. Scope in BCG strains and
strategies to improve long lasting memory
Adeliane Castro da Costa1, Sarah Veloso Nogueira1, André Kipnis1 and Ana Paula
Junqueira-Kipnis1*
1Microbiology, Immunology, Parasitology and Pathology Department. Federal
University of Goias.
*Dr. Ana Paula Junqueira-Kipnis
Laboratório de Imunopatologia das Doenças Infecciosas
Instituto de Patologia Tropical e Saúde Pública
Universidade Federal de Goiás
Rua 235 esquina com Primeira Avenida
Setor Universitário. Goiânia GO Brazil
74605-050
Abstract
BCG (Bacille Calmette Guérin), an attenuated vaccine derived from Mycobacterium
bovis, is the current vaccine against tuberculosis (TB). Despite its protection of active
TB in children, BCG has failed to protect adults against TB infection and active disease
development, especially in developing countries where the disease is endemic. There is
significant effort towards the development of a new TB vaccine. This review article
aims to address publications on recombinant BCG (rBCG) developed in the last five
years and highlight the strategies used to build an rBCG, trying to understand the
criteria used to improve their immunological memory and protection compared to BCG.
The literature review was done on April 2013, using the key words tuberculosis, rBCG
vaccine and memory. This review discusses the BCG strains and the strategies currently
used for the modification of BCG, including: overexpression of M. tuberculosis (Mtb)
immunodominant antigens already present in BCG; gene insertion of immunodominant
16
antigens from Mtb absent in the BCG vaccine; combination of introduction and over
expression of genes that were lost during the attenuation process of BCG; BCG
modifications for induction of T CD8+ immune response and cytokines expressing
rBCG. Among the vaccines visited, VPM1002, also called rBCGΔureC::hly is in human
clinical trials. Much progress has been made in the effort to improve BCG, with some
promising candidates, but considerable work is still needed to address functional long
last memory.
Key words: rBCG, tuberculosis, vaccine
Introduction
Tuberculosis (TB) is an infectious disease caused by Mycobacterium
tuberculosis (Mtb), an intracellular pathogen that, after infecting a host, can cause
disease or latency. TB continues to kill some 1.3 million people annually and 2 billion
people worldwide are infected with Mtb (Kamath et al., 2005; WHO, 2009). The
attenuated Mycobacterium bovis strain, known as BCG (Bacille Calmette-Guérin), is
currently the only TB vaccine approved for human use, but its protective efficacy
remains doubtful (WHO, 1998; Partnership WST, 2010). BCG was initially obtained
from a virulent strain and was developed in France between 1908 and 1921 by Albert
Calmette (1863-1933) and Camille Guérin (1872-1961). Although BCG is efficient in
some regions of the world, such as in Alaskan American Indians (Aronson et al, 2004;
Mangtani et al, 2014), the protection conferred by BCG varies between 0 and 80%
(WHO, 1979; Colditz et al., 1994; Trunz et al., 2006), protecting children from severe
forms.
To achieve BCG attenuation, more than 10 years of research with more than 230
serial passages were done in vitro (Calmette et al., 1926). This attenuation promoted
genomic deletions, that together with the evolution of M. bovis, resulted in 16 genomic
regions of differentiation (RD1-RD16, plus nRD18), when compared to Mtb genome
(Brosch et al., 2000; Joung & Ryoo, 2014). Of the region of differentiation lost during
attenuation, RD1 is a DNA segment comprising 9.5 kb, which was deleted in all other
BCG strains and it encodes epitopes, such as ESAT-6, CFP-10, Rv3873, PPE protein,
among others, that can be recognized by T lymphocytes (Cole et al., 1998); RD2 is a
10.7 kb DNA segment which encodes for the proteins Mpt-64, CFP-21, to name a few
17
(Joung & Ryoo, 2014); RD14 is a 9.1 kb section of DNA encoding proteins of the PE-
PGRS and Rv1771 families (gulonolactone dehydrogenase) (Behr et al.,1999); RD16 is
a 7.6 kb DNA section encoding Rv3405 which is responsible for colony morphology
characteristic, and formation of cell membrane constituent (Honda et al., 2006); nRD18
is a 1.5 kb segment containing the genes encoding SigI, an alternative RNA polymerase
sigma factor, that was only lost in the strains BCG Pasteur, Phipps, Frappier, Connaught
and Tice (Joung & Ryoo, 2014). During BCG attenuation process and the years that
followed, more than 14 sub-strains emerged: BCG-Russia (ATCC 35740), BCG-
Moreau/Rio de Janeiro, BCG-Tokyo, BCG-Sweden, BCG-Birkhaug (ATCC 35731),
BCG-Denmark 1331 (ATCC 35733), BCG-China, BCG-Prague, BCG-Glaxo (ATCC
35741), BCG-Tice (ATCC 35743), BCG-Frappier (ATCC 35735), BCG-Connaught,
BCG-Phipps (ATCC 35744), and BCG-Pasteur 1173 (Leung et al., 2008). They are
distributed throughout the world and they have been used for vaccine development to
prevent TB. The main concern is that BCG administration does not provide a reliable
protection for adults in the developing world, protecting just against the main causes of
infants TB, tuberculosis meningitis and miliary tuberculosis (WHO, 2009).
In order to address the evolution of new recombinant BCG vaccines, one must
have a defined immunological status goal desired for such vaccine. This is a
controversial issue, as there are no consensuses as to what is the ideal immune memory
phenotype that can confer protection. For instance, in animal models such as mouse,
both Mtb infection or BCG vaccine induce increased levels of lung CD4+ effector T
cells presenting the phenotype CD44hi CD62Llo CCR7lo, as well as memory cells. The
current memory cell phenotypes accepted are effector memory T cells (TEM) and
central memory T cells (TCM), characterized by CD44hi CD62Llo CCR7lo and CD44hi
CD62Lhi CCR7hi expression, respectively (Henao-Tamayo, et al, 2010; Junqueira-
Kipnis, et al, 2004; Kipnis et al, 2005). A cornerstone set for tuberculosis protection is
the importance of IFN-γ production by T cells (Flynn, et al, 1993; Cooper et al, 1997), a
cytokine crucial to stimulate the microbicide functions of macrophages. More recently,
some authors have proposed that the desired protective memory against TB infection
should have a central memory characteristic, with polyfunctional ability to produce
IFN-γ, TNF-α, and IL-2 cytokines (Ottenhoff, 2012) or a balance between IFN-γ and
IL-17 levels in order to avoid excessive pathology (Desel, et al, 2011).
The ultimate goal of a vaccine is its use among humans; consequently the
characterization of memory T cells in humans is also crucial. The major surface
18
biomarkers for human memory T cell population with effector phenotype are
CD45RAhi, CD45ROneg, CCR7neg, while central memory T cell populations present
CD45RAhi, CD45ROneg, CCR7pos. A follow up study conducted among children
vaccinated with BCG showed that specific memory T cells where stimulated and
present in the peripheral blood of those individuals for at least 52 weeks following
vaccination (Soares et al., 2013). It is interesting to observe that those induced memory
cells where polyfunctional (IFN-γ, TNF-α, and IL-2). Although several studies have
characterized the memory phenotypes induced by BCG, it is still not well established
the direct association of those populations with TB protection. Nowadays a long lasting
T cell memory population expressing CD127 has been associated with Mtb infection
and maybe also correlated to the protection shown by some exposed individuals (Jeong,
YH, et al, 2014). For the proposal of this review, it was considered as memory T cell
population the phenotype CD4+ CD44hi CD62Llo or specific CD4+ IFN-γ producing
cells.
A significant limitation in TB vaccine development and testing is the lack of an
optimal animal model that truly reflects the TB disease and immunity progress. While
there are several new vaccines being made in different laboratories, there are a diversity
of animal models (mice, rabbits, guinea pigs, non-human primates) and disease
outcomes being used by different laboratories, impairing an adequate comparison
between them. In addition there is no consensus on the protocol to be used for
vaccination and challenge, with different routes of immunization/infection, doses, BCG
and Mtb strains, and time periods being used. Short period of time between vaccination
and challenge does not allow full memory development, thus generating a bias toward
the correlation between memory T cell phenotype and protection. The most accepted
method for evaluating protection is the determination of the bacterial load following the
challenge of vaccinated animals compared to non-vaccinated infected controls.
Although a widely used method, the organs assessed to determine the bacterial load
varies among researchers and make it difficult to establish comparisons. Given all these
different parameters, in this review protection conferred by the different recombinant
BCG vaccines was considered when an overall significant reduction of the bacterial
load when compared to wild type BCG was achieved.
The factors that determine the induction of memory related to BCG are not well
understood. Some assumptions are directed to the characteristics of the BCG sub-
strains, which exhibit genotypic and phenotypic differences after attenuation process as
19
well as distinct residual virulence levels, the number of epitopes of each BCG strain or
the recombination strategy used for the development of a new vaccine (Behr et al.,
1997; Zhang et al, 2013). According to the research tools employed in this study, from
all sub-strains originated after this process, the strain most frequently tested over five
years were BCG Tokyo (BCG Japan), BCG Tice, BCG Danish (BCG Danmark/BCG-
SSI 1331), BCG Pasteur, BCG China (BCG Shanghai) and BCG Prague. It is also
hypothesized that the generation of the immune response and eventually the outcome of
a vaccination could be influenced by the type of strain background used. On the other
hand, there are preclinical animal data and human data demonstrating that different
strains of BCG confer the same level of protection (Castillo-Rodal et al, 2006; Davids et
al, 2006).
The main strategies used to develop new vaccines are based on the formulation
of subunit vaccines; on the production of non-recombinant viral vector vaccines that can
be used as BCG prime boost; and the construction of a recombinant BCG (rBCG),
which would confer the same protection with better induction of memory than BCG.
Some ways to construct a rBCG include over expression of promising Mtb
immunodominant antigens which are expressed by BCG, such as α-crystallin HspX
protein and complex 85 proteins (Ag85A, Ag85B and Ag85C) (DasGupta et al., 1998);
insertion of Mtb immunodominant antigens absent on BCG, such as those codified by
genes from RD1, RD2, RD3, RD14, RD15, RD16 and nRD18 (Zhang et al., 2013); the
combination of over expression with reintroduction of genes lost during BCG
attenuation; and BCG modification in order to induce CD8+ T immune response
proteins and cytokines (Tables 1 and 2).
Therefore, the aim of this review was to analyze which factors associated with
recombinant BCG could be able to induce long lasting memory and promote better
protection than the conventional BCG.
Does BCG epitope number influence in the induction of memory and protection of
rBCG vaccines?
As stated by Zhang et al. (2013), the number of epitopes in a particular strain
can be important for the development of a better vaccine that could replace BCG. If that
was the case, the strain more capable of inducing a good immune response would be
BCG Tokyo, since it comprises 359 epitopes suitable for being recognized by
20
lymphocytes (Zhang et al., 2013). To verify if there is sufficient data to support this
hypothesis in the last five years, we selected some criteria as summarized on Table 1.
The different rBCG vaccines were compared according to their ability to improve
protection by reducing the bacterial load relative to wild type BCG and to generate
specific memory CD4+ T cells. Among three different published studies using
recombinant BCG Tokyo, which exhibits greater number of epitopes, all showed better
protection than BCG that was associated to the recombinant generation strategy: the
over expression with re-introduction of lost genes, as well as with the presence of
cytokines (Table 1). Nevertheless, the strain that has been most widely used is BCG
Danish (BCG Danmark/BCG-SSI 1331), which have an average number of epitopes
(329 epitopes), and also provides improved protection and long lasting memory when
associated with the overexpression of Mtb antigens. Two rBCG Tice (328 epitopes)
vaccine constructions also obtained good results for induction of protection but only one
induced memory. Based on those publications it appears that the genetic background of
the BCG strains (number of epitopes) does not have a major role in inducing/improving
protection and memory.
Contrary to Zhang et al. (2013), other studies reported here, support the idea that
recombinant antigen selection to be expressed by BCG, and not the BCG strain
background, would be the significant aspect to be considered in the construction of an
improved vaccine, which would be a better inducer of memory and protection (Tang et
al., 2008; Dey et al., 2009; Sali et al., 2010). Moreover, it appears that overexpression of
certain antigens have been the key to make the most promising rBCG for induction of
memory and better protection than BCG.
When analyzing only publications of the last five years the conclusions
withdrawn may have been biased because we could be missing important work
addressing whether the BCG strain background (epitopes numbers) or the selected
antigen were important or not to improve memory and protection when compared to
BCG.
21
Table 1. BCG sub strains genetic background used for recombinant BCG vaccines development and ability to induce memory and
protection against tuberculosis.
Sub strains RDs * Epitopes Nº** Protection
better
than BCG?***
Memory?**
**
References
Tokyo/Japan RD1
359 3 Yes
Yes
Yes
No
Lin et al., 2011; Tang et al., 2008
Sugawara et al., 2009
Pasteur RD1,
RD2,RD14
, nRD18,
331 6 Yes
No
No
No
Yes
No
Sali et al., 2010
Tang et al., 2009
Chapman et al., 2012; Christy et al., 2012;Kong et al.,
2011
Danish/
Denmark
RD1, RD2, 329 11 Yes
No
Yes
No
Yes
Yes
No
No
Shi et al., 2010
Rahman et al., 2012
Dey et al., 2011; Sun et al., 2009; Jain et al., 2008; Qie et
al., 2009
Dey et al., 2010; Lu et al., 2012; Magalhães et al., 2008
Tice RD1, RD2,
nRD18
328 2 Yes
Yes
Yes
No
Hoft et al., 2008
Tullius et al., 2008
China /
Shanghai
RD1, RD2 321 6 Yes
No
No
No
Wang et al., 2012
Deng et al., 2010; Deng et al., 2012; Xu et al., 2009; Xu
et al., 2010;Yang et al., 2011
Prague RD1, RD2 318 3 Yes
No
No
No
Desel et al., 2011
Farinacci et al., 2012; Reece et al., 2011
* RD Region of difference;
** Number of publications in the last 5 years; *** Protection was evaluated by CFU analyses and considered when the bacterial load of challenged animals where lower than wild type BCG vaccinated animals;
**** Memory was defined as CD4+ CD44hi CD62Llo or CD4+ IFN- producing T cells specific immune responses.
22
Does the quantity of Mtb antigens incorporated in BCG result in greater
protection and memory development?
rBCG vaccines superexpressing Mtb immunodominant antigens
An important strategy used for the construction of a new TB vaccine is the
development of a rBCG super expressing Mtb immunodominant antigens, such as
proteins from the antigen 85 Complex, HspX protein, and also the association of both
proteins in one vaccine construction, which represents one of the favored approaches for
TB vaccine construction (Jain et al., 2008).
Some of the most important antigens used to construct BCG recombinant
vaccines are those from the Antigen 85 Complex that consists of Ag85A (Rv3804c),
Ag85B (Rv1886c) and Ag85C (Rv0129c), being encoded by fbpA, fbpB and fbpC2
genes, respectively, and presenting molecular weights between 30 and 32-kDa (Ohara et
al., 1997). Proteins of Ag85 complex have mycolyltransferase activity, thus they play a
role in the construction of Mtb cell wall and they are responsible for the mycolate
production of the cell wall, maintaining Mtb integrity and pathogenesis (Belisle et al.,
1997).
The protein Ag85B, used in the construction of the vaccine rBCG:30 (r30-
Ag85B), was able to generate protection in guinea pigs after challenge with Mtb
(Horwitz et al., 2000; Horwitz et al., 2003). This vaccine was in clinical trial I, and
when tested in human volunteers, it induced central and effector memory CD4 and CD8
T cells specific to Ag85B (Hoft et al., 2008). Currently, this vaccine is no longer being
tested on humans. The same antigen was used by Tullius et al. (2008) who developed a
mutant rBCG, rBCG (mbt) 30, resulting in a strain unable to synthesize mycobactin and
exoquelin molecules, which are essential for iron acquisition in deprivation of this
nutrient. The vaccine presented greater protection than conventional BCG. Another
approach was to design a rBCG pantothenate auxotroph, rBCG (panCD) 30. Both
vaccines rBCG (mbt) 30 and rBCG (panCD) 30 were more attenuated than BCG and
induced potent protective immunity, and cell mediated immunity in guinea pigs (Tullius
et al., 2008). These vaccines may have the potential to provide a safe alternative to HIV
positive individuals since BCG is not indicated to immunocompromised individuals.
This vaccine and others over expressing Ag85B were better in conferring
protection and memory than BCG. The 30 kDa antigen 85B is the most abundant
23
protein of the Ag85 complex, and is the most abundant extracellular protein of Mtb,
responsible for nearly one-quarter of the total extracellular protein in broth culture
(Harth et al., 1996). In addition, Ag85B is strongly recognized by T cells, can induce a
type Th1 immune response with IFN-γ production and was shown to have a good
protective capacity when used in DNA vaccine strategies (Palma et al., 2008).
Ag85C is also a major secretory protein and an immunodominant antigen, being
strongly recognized by sera from TB patients. In fact, it is responsible for almost 40%
of the mycolate content of the Mtb and its mycolyltransferase activity cannot be
substituted by Ag85A or Ag85B (Jackson et al., 1999). For this reason, Jain et al.
(2008) developed an rBCG expressing Ag85C under the transcriptional control of
mycobacteria promoters. Again, less granulomatous infiltration and less granuloma
formation were observed when compared to the group immunized with BCG and the
protection (reduced bacterial load in lungs and spleen better than ancestor BCG) was
associated with reduced levels of the mRNA codifying for the cytokines IFN-γ, TNF-α,
IL-12, and TGF-β, when compared to BCG, however, high levels of iNOS were
observed in comparison to BCG. On the other hand, previous studies with DNA
vaccines using Ag85C have demonstrated reduced production of IL-2 and IFN-γ,
displaying insufficient protection when animals were challenged with M. bovis BCG
(Lozes et al., 1997). Hence it is important to stress that not only the antigen can allow a
good protection status, but the association of the antigen expression plus a good vector
(e.g. BCG itself). Here, the strain used was BCG Danish, which may have contributed
for the results. Unfortunately those studies did not provide information regarding the
ability to generate memory cells.
Ag85A is also strongly recognized by T lymphocytes, inducing IL-2 and IFN-γ
production (Lozes et al., 1997). Immunization of mice and guinea pigs with
rBCG::Ag85A promoted reduction of pulmonary pathology severity and increase in
protection (lungs and spleen) (Sugawara et al., 2007). Consequently this vaccine was
also tested in Macaca mulatta, and, after challenge, the group immunized with
rBCG::Ag85A presented light to moderate pneumonia, while the non-vaccinated group
developed multilobar pneumonia, lymphadenopathy and atelectasis. Also, its protective
capacity was already appraised in a DNA vaccine system with Ag85A (Sugawara et al,
2003). Besides, they found that rBCG-Ag85A induced higher protective efficacy than
the parental BCG Tokyo (Sugawara et al., 2009). In that study a strategy of over
expressing the antigen in addition to the use of a BCG strain containing more natural
24
epitopes was employed (Table 1). Hence, this could justify the potential of this vaccine
for further studies such as memory induction.
Construction of recombinant BCG expressing single proteins resulted in
promising results. Following those studies significant progress started to be made with
the construction and testing of fusion recombinant proteins, combining two or more
protein coding regions, of one or more Mtb proteins because it is believed that the use
of combination of antigens may result in improved protective efficacy than rBCG
expressing only one antigen.
In order to analyze this hypothesis, Wang et al. developed three vaccine
constructions: rBCG::Ag85A (A), rBCG::Ag85B (B) and rBCG::AB, which were used
to immunize mice. The vaccine with fusion antigens: rBCG::AB showed better
protection after challenge with Mtb, when compared to BCG or rBCG expressing
Ag85A or Ag85B alone. Six and 24 weeks after vaccination, splenocytes of mice
immunized with rBCG::AB when stimulated with specific antigen secreted more IFN-γ
than splenocytes from mice immunized with the other rBCG (Wang et al., 2012).
Regrettably, no memory was evaluated in that study, but probably it was because the
memory induction is already known for rBCG::Ag85B (Hoft et al., 2008). On the other
hand, no studies with rBCG expressing Ag85A assessed memory response, so it would
be meaningful to verify if Ag85A could contribute or not for that. Although the
approach of recombinant fusion proteins have been shown of valuable use in the
protection against challenge with M. tuberculosis, the real potential to be used as a new
vaccine requires additional studies regarding the development of functional long lasting
memory.
Another antigen frequently used for recombinant expression in BCG is the
HspX protein. HspX (Rv2031c) is a heat shock protein encoded by the gene acr, with
molecular weight of 16 kDa, also known as α-cristalin (Chang et al., 1996). This protein
is one of the most abundant proteins that are produced during the latent or persistent
Mtb phase. Shi et al. developed a rBCG over expressing the immunodominant Mtb
antigen, HspX (rBCG::X) showing that rBCG::X provided better and long lasting
protection against Mtb infection than BCG, as evidenced by high levels of IFN-γ
production, low bacterial load in tissues and reduced lung pathology associated with
elevated levels of anti-HspX antibodies during week 6 and 24 (168 days) after rBCG::X
immunization, indicating that maybe, BCG::X can persist longer in vivo than BCG (Shi
et al, 2010).
25
Additionally, results obtained by Shi et al. advocate that expression of HspX by
BCG could improve the biological effects of this molecule which would explain the
higher expression of the protein Ag85B on the supernatant of cells as well as on the
lysate after infection with rBCG::X when compared to BCG (Shi et al., 2010). This
theory was also corroborated by Kong et al, (2011) who constructed an rBCG
expressing Mtb Ag85B under the control of hspX promoter. In that case, the expression
and immune response to Ag85B were modulated by hspX promoter. For example,
rBCG::PhspX-85B was able to induce intense specific Ag85B T cell proliferation, IFN-
γ production three weeks after infection with a greater increase after 12 weeks,
demonstrating long lasting cell mediated immunity. Despite its intense induction of
immune cell response, the protection induced by this vaccine, in lungs and spleen, was
similar to the BCG, indicating that in that model of Ag85B expression under the control
of a different promoter there was no improvement in the protective efficacy (Kong et
al., 2011).
Despite the fact that Ag85C is responsible for more than 40% of the mycolate
present in the mycobacteria cell wall (Belisle et al., 1997), evidences have shown that
the antigen Ag85B is the one that stood out in recombinant BCGs (rBCG) when it
comes to induction of memory and better protection than BCG (Tullius et al., 2008;
Hoft et al., 2008).
Although the use of fusion proteins have generated great expectations in the
scientific community, the use of combined proteins yielded no better memory than
BCG, according to the present accepted parameters, generating only better protection.
The increased protection observed among those recombinant vaccines can not be the
only improvement desired for the development of a new vaccine, once vaccination
using the available animal models to study new vaccines to TB do not eliminate all Mtb
bacteria from the tissues of challenged animals. Therefore new definitive protection
parameters are needed.
Association of over expression and reintroduction of antigens lost during
attenuation process
Some virulence regions, such as RD1, were lost during BCG attenuation
process. RD1 is absent in all BCG sub-strains, but present on virulent strains and
clinical isolates of M. bovis and M. tuberculosis. The association of Mtb genes lost in
26
the M. bovis attenuation process within rBCG has been used to improve the vaccine
efficacy (Brosch et al., 2000). The collection of well-defined T cell antigen epitopes has
been a widely used strategy for the construction of new vaccines. This collection is
based on the reintroduction of proteins whose gene regions were deleted during the
attenuation process. Some of those proteins are the 10 kDa culture filtrate protein (CFP-
10, Rv3874), ESAT-6, PPE family protein (Rv3873), INV (Rv1474), MPT64, to name a
few.
When evaluating the induction of immune response, it has been noticed that the
vaccine constructions with epitopes has been the most auspicious, although most of the
studies did not evaluate the protection or memory induced by these vaccines. Vaccine
constructs using those antigens were good inducers of Th1 immune response and
production of IFN-γ and IgG2a, and were excellent DTH (delayed type hypersensitive)
response inducers, superior to BCG, indicating that vaccination prompted specific
immune response. Conversely, some recombinant vaccines (BCG:CFP, BCG:FBP,
BCG:PPE and BCG:INV) showed protection similar to that of BCG (Christy et al.,
2012). Only rBCG vaccine expressing MPT64 antigen fused to a PE antigen (HPE-
ΔMPT64-BCG) showed superior protection than those immunized with BCG. This
protection was related to CD4 and CD8 T cell induction and the emergence of a specific
MPT64 T cell clone (Sali et al., 2010). In spite of the use of the same BCG strain in
those two works, the protection differences observed could point to the importance of
antigen choice, being the fusion a crucial factor that made the difference in providing a
better vaccine in this case.
When using proteins of the Ag85 complex, Qie et al. (2009) compared the
protective efficacy of rBCG-AMM (BCG expressing Ag85B-MPT64190-198-Mtb8.4)
to BCG. Animals vaccinated with rBCG-AMM generated more antigen-specific CD4
and CD8 T cells than those vaccinated with BCG and showed a more efficient response
to protect mice challenged with H37Rv. Moreover, rBCG-AMM was superior to BCG
in reducing the severity of the disease in the target organs like lungs and spleen,
indicating that rBCG-AMM could be a potential vaccine candidate for further studies.
Here again, this vaccine was not evaluated for memory induction though.
Some rBCG vaccines designed over the past 5 years, combined the ability to
generate strong immune response of the Ag85 proteins with the antigen ESAT-6 (Lu et
al., 2012; Xu et al., 2010; Deng et al., 2010). From those studies only one addressed
protection and memory development. For instance, Deng et al. (2010) constructed an
27
rBCG expressing the fusion protein Ag85A-ESAT-6 (rBCG-AE) and this vaccine
showed more potent immunogenicity than native BCG in mice and induced a shift
towards a Th1 type immune response with the increase in the ratio of both CD4 and
CD8T subsets. Thus, rBCG-AE elicited long-lasting and stronger Th1 type cell-
mediated immune responses than BCG. That group further evaluated the protective
efficacy conferred by rBCG-AE against Mtb infection in BALB/c mice (Deng et al.,
2012). Once more, an rBCG vaccine expressing ESAT-6 alone did not exceed the
parental BCG vaccine in the protection from Mtb H37Rv infection. That vaccine was
developed with a BCG-China strain, while others used BCG-Tokyo, BCG-Danish, or
BCG-Pasteur. As we previously stated, vaccine constructions overexpressing proteins
of the Antigen 85 Complex seem to be better than BCG when it comes to protection
efficacy while recombinant BCG-ESAT-6 presented protection similar or even inferior
to BCG. Still, using combined epitopes from proteins of the Ag85 complex or other
proteins and ESAT-6 improved macrophage activation and antigen presentation (Xu et
al., 2010), and strong humoral and cellular immune responses were induced (Lu et al.,
2012), although protection or memory generation were not addressed.
The development of rBCG vaccines associating or re-introducing genes lost
during BCG attenuation appears to improve protection and memory most frequently
when proteins from the complex Ag85 were associated to the fusion protein. This
observation could be biased due to the fact that the Ag85 proteins were the ones most
frequently used in the development of those rBCG vaccines. The combined results
attested that those were probably genes evolutionary kept by Mtb and were able to
induce strong immune response in animal models or humans, no matter what type of
BCG strains were used. The best combination though, was the fusion protein composed
by Ag85 and MPT64. Most of the studies presented here have not evaluated functional
memory, a crucial step if one intends to develop a long lasting protective vaccine.
rBCG vaccine expressing mammalian cytokines and Mtb proteins
Interleukins (ILs) play a central role in the immune system and have multiple
effects on different immune cells. IL-2, for example, has been used for the treatment of
some diseases, including tuberculosis, but the toxicity correlated with high dose of this
interleukin restricted its use. So, the solution to overcome that problem pointed to the
expression of rIL-2 and other cytokines by BCG (Kong & Kunimoto, 1995). Another
28
example is IL-15, an important cytokine to maintain survival and proliferation of CD8+
T cells with memory phenotype (McShane et al., 2002). In order to develop new
vaccines capable of improving BCG, some research strategies included the use of
recombinant BCG expressing interleukin, such as IL-2, IL-12, IL-15, GM-CSF, among
others.
Recombinant vaccines expressing cytokines induced effector polyfunctional
CD8 T cells and CD4 T cells (producing IFN-γ, IL-2 and TNF-α), as well as humoral
immune response with increase of specific IgG2a/IgG1 levels (Tang et al., 2008- rBCG-
Ag85B-IL-15; Lin et al., 2011- BCG :: Ag85B-CFP10-IL-12; Yang et al., 2011-rBCG:
GMCSF-ESAT6). Among those types of vaccines, the ones that stood out were those
expressing IL-15 and IL-12, as they induced CD8+ T (CD8+ CD44hi CD62Llo) and CD4+
T (CD4+ CD44hi CD62Llo) memory cells (Tang et al., 2008; Lin et al., 2011).
Although those types of vaccines showed better protection than BCG, the rBCG-
Ag85B-IL-15 vaccine seemed more promising because it presented greater induction of
memory CD8 T cells than memory CD4 T cells, in support to the theory that CD8 T
cells rather than CD4 T cells are important in long lasting protection against TB (Tang
et al., 2008). It is important to note that despite the positive influence of IL-15 in
inducing memory cells, its in vivo administration after priming with rBCG and followed
by challenge with Mtb, does not induce increase of CD8 T memory cells, phenomena
seen only when IL-15 is expressed by rBCG (Tang et al., 2008).
It seems as the induction of CD8+ T cells and polyfunctional CD8+ and CD4+ T
cells (producing IFN-γ, IL-2 and TNF-α) are responsible for the improvement of the
protection generated by rBCG while secretion of interleukins might play an important
role in the proliferation and maintenance of memory T cells.
29
Table 2. Description of strains and antigens used in the papers visited for this review. References published and indexed inPubMed from 2008 April 2013.
Reference Model Strain Antigen Challenge Protection
Lin et al., 2011 Mice 1.1.1.1.1.1.1.1.1 BCG Tokyo
rBCG1::Ag85B-CFP10(rBCG1)/BCG2::Ag85B-
CFP10-IL-12 (rBCG2)
No Yes + (In vitro)
Hoft et al., 2008 Human BCG Tice rBCG30 (Ag 85B) No Yes + (In vitro)
Dey et al., 2010
Guinea pigs BCG Danish rBCG-E6 (ESAT-6)
50–100 bacilli of Mtb Yes +
Dey et al., 2011 Guinea pigs BCG Danish rBCGacr 50–100 bacilli of Mtb Yes +
Shi et al., 2010 Mice BCG Danish BCG::HspX/ rBCG::85B 106 CFU of Mtb Yes +
Deng et al., 2012 Mice BCG China rBCG-AE 106 CFU of Mtb Yes –
Reece et al., 2011 Mice BCG Prague rBCGureC::hly or rBCGureC::hly 102 CFU of Mtb
Yes
Qie et al., 2009 Mice BCG Danish BCG: rBCG-Ag85B-Mpt64-Mtb8.4 106 CFU of Mtb
Yes +
Lu et al., 2012 Mice BCG Danish rBCG::Ag85B-ESAT6-Rv2608 No NA
Sugawara et al., 2009 Monkey BCG Tokyo rBCG-Ag85A 3000 CFU of Mtb Yes +
Magalhaes et al., 2008 Monkey BCG Danish rBCG AFRO 1 No NA
Xu et al., 2010 In vitro BCG China rBCG:Quimera 85B+ESAT-6 No NA
Sali et al., 2010 Mice BCG
Pasteur
rBCG:PE-MPT64/rBCG/HSP60MPT64 ~200 CFU of Mtb Yes +
Desel et al., 2011 Mice BCG Prague rBCGΔureC::hly+ 200-400 CFU of Mtb Yes +
Wang et al., 2012 Mice BCG China rBCG : Ag85A/rBCG :Ag85B/ rBCG:Ag85A-Ag85B 106 CFU of Mtb
Yes
Deng et al., 2010 Mice BCG-China rBCG: Ag85A-ESAT-6/rBCG :: Ag85A/ rBCG :
ESAT-6
No NA
Rahman et al., 2012 Monkey BCG Danish AFRO-1,Ag85A,Ag85B e TB10.4. 500 CFU of Mtb Yes +
Christy et al, 2012 Mice BCG
Pasteur
rBCGs: BCG::Ag85c, BCG::INV, BCG::PPE,
BCG::FBP e BCG::CFP
20 bacilli of Mtb Yes =
Farinacci et al., 2012 Mice BCG Prague rBCGΔureC::hly+ No NA
Kong et al., 2011 Mice BCG
Pasteur
rBCG: pHspX-Ag85B 100 bacilli of Mtb/lung Yes =
Yang et al., 2011 Mice BCG China rBCGs:BCG::GM-
CSF/BCG::ESAT6/BCG::GMCSF-ESAT6
No NA
Tang et al., 2008 Mice BCG Tokyo rBCG-85B-IL15/rBCG-85B 2 ×105 CFU of Mtb Yes =
Jain et al., 2008 Guinea pigs BCG Danish rBCG-85C
500 bacilli of Mtb Yes +
Grode et al., 2013 Human BCG Danish BCG ΔureC::hly HmR No NA
+ Protection superior than BCG; = similar to BCG; – less protection than BCG; NA not aplicable
30
BCG modification - induction of CD8 T immune response
M. tuberculosis and BCG preferentially localize inside antigen presenting cells
(APC) phagosomes, mainly within macrophages and dendritic cells. This localization
dictates antigen traffic via MHC-II, which results in preferential stimulation of CD4 T cells.
CD8 T cytolytic lymphocytes (CTLs) are essential for the clearance of intracellular Mtb
infection since CTLs aim to kill cells and bacteria through secretion of cytolytic and
antimicrobial effector molecules (perforin and granulysin). It is known that Mtb induce
apoptosis in infected cells, resulting in vesicles that transport mycobacteria antigens, which
can be captured by local dendritic cells, culminating with cross presentation of MHC-I and
MHC-II, stimulating CD8 and CD4 T cells, respectively (Schaible et al., 2003). It is also
acknowledged that BCG is a weak inducer of apoptosis and thus activates CD8 T cells to a
lesser extent (Schaible et al., 2003; Farinacci et al., 2012). With this regard, in an attempt to
improve BCG, rBCG vaccines have been developed to express listeriolysin (Hly) from
Listeria monocytogenes (Mandal et al., 2002) in its membrane, in combination with
deletion of ureC gene (rBCGΔureC::hly). One of the mechanisms BCG employs to survive
phagosome is pH neutralization, through Urease C (ureC) activity. To induce apoptosis Hly
needs an acidic pH, which is why an ureC mutant rBCG was developed, so phagolysosome
pH acidification occurs naturally (Mandal et al., 2002). By using this vaccine protocol,
Reece et al (2011) selected antigens based on their expression in response to nutrients
deprivation (Rv2659c), hypoxia (Rv1733c) or disease reactivation (Rv3407) and
transformed rBCGΔureC::hly with plasmid containing those antigens, rBCGΔureC::hly
(pMPIIB01). The improved performance of this vaccine implied in lower bacterial load in
spleen of mice (Reece et al., 2011). In addition, it induced Th-17, CD4+ and CD8+ T
responses promoting more protection than BCG (Desel et al., 2011; Farinacci et al., 2012).
This vaccine is the most promising rBCG vaccine generated and it finished phase I clinical
trial for safety with great success, and is being tested in newborns in a phase II clinical trial
(Grode et al., 2013). Although this vaccine aimed to improve T CD8 responses, it was
observed in vaccinated healthy humans induction of specific CD4 T cells secreting IFN- as
well as polyfunctional T CD4 responses.
31
In a similar approach, with the goal of obtaining a vaccine capable of inducing
increased CD8 T cell response, a recombinant BCG, rBCG AFRO-1 (BCG expressing
Ag85A, Ag85B and TB10.4) was used followed by two boosts with AERAS-402
(adenovirus vaccine 35 (rAd35) expressing Ag85A, Ag85B and TB10.4). AFRO-1 BCG
expresses perfingolysin O, which allows BCG scape to cell cytosol, promoting antigen
processing and presentation via MHC-I. After priming with rBCG AFRO-1, there was
delayed but strong IFN-γ production one week after boost with AERAS-402, as well as
strong proliferation of CD4 and CD8 T cells (Magalhães et al., 2008). This vaccine
promoted longer survival and IFN-γ production, however no differences in lungs and spleen
bacterial load between groups vaccinated with BCG or AFRO-1 (also known as AERAS-
422) were observed (Sun et al., 2009). Although a promising vaccine, AERAS-422 had to
be terminated because of development of shingles in some study participants that occurred
during phase I clinical trial (Kupferschmidt, 2011).
The strategy of BCG modification for induction of CD8 T specific immune response
has shown great impact, as the recombinant vaccine rBCGΔureC::hly is in clinical trial
(www.clinicaltrials.com).
Conclusions and Future Perspectives
BCG is used for almost 100 years, with more than eight million doses used.
Tuberculosis incidence on the other hand showed only a slow decrease during the last
decade, mainly due to the increase of the multi drug resistant strains and the HIV co-
infection (Mangtani et al, 2014). Two main cautions of BCG vaccine are associated to its
variable efficacy and immunity against M. tuberculosis infection resulting in a large pool of
latently/persistently-infected individuals. It’s also been discussed that BCG have better
protection among individuals from regions with lower environmental mycobacterial
contaminations and lower tuberculosis rates. Development of a new vaccine or
improvement of BCG to protect against TB is not an easy task, once the natural infection
per se does not induce protection or long lasting T or B functional memory cells since it
does not avoid re-infection. It appears that the coevolution between mycobacteria and the
human being favors the mycobacteria. Over the past five years, several attempts were
32
conducted to develop recombinant BCGs (Table 2). Improvement of BCG remains among
the best choices for the rational design of a TB vaccine. This review sought to discuss
recent TB studies advancing the BCG recombination strategy. The main purpose for
developing an rBCG is to design a vaccine capable of inducing long lasting functional
memory with protection similar or superior to that of BCG. Also, BCG is a strong inducer
of CD4+ T cells but it is an insufficient stimulator of CD8 T cells. The most effective rBCG
vaccination strategies in animal models and in human clinical trials to date were those that
stimulate both CD4+ T and CD8+ T cells to produce Th1-associated cytokines and cytotoxic
functions (Hanekom, 2005, Soares et al, 2011, www.clinicaltrials.com).
It is recognized that protein combinations, such as fusion proteins, as well as
expression of these proteins by different expression vectors have been used as important
strategies in the development of an rBCG vaccine with better efficacy than BCG.
Nevertheless, the vaccine approach super expressing Mtb proteins in BCG with better
performance was rBCG::30, which express only the protein Ag85B, being able to induce
central memory and more desirable protection than BCG (Hoft et al., 2008). This plasmid
based vaccine passed clinical trial phase I and currently is on hold awaiting the
development of auxotrophic BCG strains to avoid the use of antibiotic resistance gene
(www.clinicaltrials.com).
Intriguing is that the rBCG vaccine currently on phase II of human clinical trial is a
vaccine that did not introduce Mtb antigens or antigens lost by BCG during the attenuation
process. Reasonably, the rBCGΔureC::hly vaccine improved BCG antigen presentation by
dendritic cells (DC) improving its processing with the ultimate goal of activating CD8+ T
cells. Maybe this approach overcame some of the evolutionary mycobacteria
immunological scape and will allow a protective long lasting functional memory. Shortly in
time we will know if this vaccine induced better protection to tuberculosis (WHO, Global
report on Tuberculosis, 2013).
Further, the choice of parental BCG strain appears not to interfere with the
recombinant vaccine outcome, because some vaccines using the same parental BCG strains
have shown different outcome depending on the selected antigen or fusion protein used.
Likewise, the immune response profile of those vaccine candidates that showed better
protection than BCG was based upon CD4 and CD8 T cells with polyfunctional activities.
33
From all studies reviewed here, only six of them successfully evaluated memory in animal
models.
The animal models available to study vaccine for tuberculosis (mice, guinea pig or
no human primates) most of the time cannot predict the outcome among vaccinated
humans. It is well known that mice and guinea pigs are infected by BCG vaccination and
the duration of the vaccination and the time until challenge are crucial to address the
persistence of memory T cells. This premise could be used to justify the lower numbers of
work that addressed this issue over the past five years.
The real impact of these new vaccine using rBCG or other strategies that are
currently in clinical trials only will be observed in five to ten years from now, therefore
studies addressing new strategies to improve BCG needs to be continued.
Material and Methods
Study selection and data collection process. The search for this review was
conducted on April 2013 and was based on articles published in the last five years (2008-
2013). Articles were searched from PubMed Database using the key words: tuberculosis
protection and rBCG vaccine with the intention to address publications showing studies on
rBCG vaccine for tuberculosis, then further selecting manuscripts using the key words:
tuberculosis protection; rBCG vaccine and memory. Manuscripts without information of
BCG wild type strain and those that used the boost strategy without evaluating rBCG
responses alone were not included in this review.
Funding
This research was supported by CNPq.
Declaration of Interest sections:
The authors declare no conflict of interest.
References
34
Abebe, F. (2012). Is interferon-gamma the right marker for bacille Calmette-Guérin-
induced immune protection? The missing link in our understanding of tuberculosis
immunology. Clin Exp Immunol 169, 213-9.
Aronson, N.F., Santosham, M., Comstock, G.W., Haward, R.S., Moulton, L.H., Rhoades,
E.R., Harrison, L.H. (2004). Long-term efficacy of BCG vaccine in American Indians
and Alaska Natives: A 60-year follow-up study. JAMA 5, 2086-2091.
Behr, M.A., Small, P.M. (1997). Has BCG attenuated to impotence? Nature 389,133–134.
Behr, M.A., Wilson, M.A., Gill, W.P., et al (1999). Comparative genomics of BCG
vaccines by whole-genome DNA microarray. Science; 284:1520-3.
Belisle, J.T., Vissa, V.D., Sievert, T., Takayama, K., Brennan, P.J. (1997). Role of the
major antigen of Mycobacterium tuberculosis in cell wall biogenesis. Science 276,
1420–1422.
Brosch, R., Gordon, S.V., Pym, A., Eiglmeier, K., Garnier, T., Cole, S.T. (2000).
Comparative genomics of the mycobacteria.Int. J. Med. Microbiol. 290, 143–152.
Calmette, A., Guerin, C., Ne‘gre, L., Boquet, A. (1926). Premunition des nouveaux-
nescontre la tuberculoseparlevaccin BCG, 1921–1926.Ann. Inst. Pasteur. (Paris) 40,
89–133.
Castillo-Rodal, A.I., Castañón-Arreola, M., Hernándes-Pando, R., Calva, J.J., Sada-Díaz,
E., López-Vidal, Y. (2006). Mycobacterium tuberculosis infection in a BALB/c
modelo f progressive pulmonary tuberculosis. Infect Immun. 74, 1718-1724.
Chang, Z., Primm, T.P., Jakana, J., Lee, I.H., Serysheva, I., Chiu, W., Gilbert, H.F.,
Quiocho, F.A. (1996). Mycobacterium tuberculosis 16-kDa antigen (Hsp16.3)
functions as an oligomeric structure in vitro to suppress thermal aggregation. J. Biol.
Chem. 12, 7218-7223.
Christy, A.J., Dharman, K., Dhandapaani, G., Palaniyandi, K., Gupta, U.D., Gupta, P.,
Ignacimuth, S., Narayanan, S. (2012). Epitope based recombinant BCG vaccine
elicits specific TH1 polarized immune responses in BALB/c mice. Vaccine 30, 1364-
1370.
Colditz, G.A., Brewer, T.F., Berkey, C.S., et al I. (1994). Efficacy of BCG vaccine in the
prevention of tuberculosis: meta-analysis of the published literature. JAMA 271, 698–
702.
35
Cole, S.T., Brosch, R., Parkhill, J., et al (1998). Deciphering the biology of Mycobacterium
tuberculosis from the complete genome sequence. Nature; 393:537-44.
Cooper, A.M., Magram, J., Ferrante, J., Orme, I.M. (1997). Interleukin 12 (IL-12) Is
Crucial to the Development of Protective Immunity in Mice Intravenously Infected
with Mycobacterium tuberculosis. J. Exp. Med. 186, 39-46
DasGupta, S.K., Jain, S., Kaushal, D., Tyagi, A.K. (1998). Expression systems for study of
mycobacterial gene regulation and development of recombinant BCG vaccines.
Biochem. Biophys. Res. Commun. 246, 797–804.
Davids, V., Henakom, W.A., Mansoor, N., Gamieldien, H., Gelderbloem, S.J., Hawkridge,
A., Hussey, G.D., Hughes, E.J., Soler, J., Murray, R.A., Ress, S.R., Kaplan, G.
(2006). The effect of bacilli Calmette-Guérin vaccine strain and rout of administration
on induced immune responses in vaccinated infants. J.Infect Dis. 193, 531-536.
Deng, Y.H., He, H.Y., Zhang, B.S. (2012). Evaluation of protective efficacy conferred by a
recombinant Mycobacterium bovis BCG expressing a fusion protein of Ag85A-
ESAT-6. J. Microbiol. Immunol. Infect.25, S1684-1182.
Deng, Y.H., Sun, Z., Yang, X.L., Bao, L. (2010). Improved Immunogenicity of
Recombinant Mycobacterium bovis Bacillus Calmette-Guérin Strains Expressing
Fusion Protein Ag85A-ESAT-6 of Mycobacterium tuberculosis. Scand. J. Immunol.
72, 332–338.
Desel, C., Dorhoi, A., Bandermann, S., Grode, L., Eisele, B., Kaufmann, S.H. (2011).
Recombinant BCGΔureC::hly Induces Superior Protection over Parental BCG by
Stimulating a Balanced Combination of Type 1 and Type 17 Cytokine Responses. J.
Infect. Dis. 204, 1573–1584.
Dey, B., Jain, R., Gupta, U.D., Katoch, V.M., Ramanathan, V.D., Tyagi, A.K. (2011). A
booster Vaccine Expressing a Latency-Associated Antigen Augments BCG Induced
Immunity and Confers Enhanced Protection against Tuberculosis. Plos One 6(8):
e23360.
Dey, B., Jain, R., Khera, A., Gupta, U.D., Katoch, V.M., Ramanathan, V.D., Tyagi, A.K.
(2011). Latency antigen α-cristallin based vaccination imparts a robust protection
against TB by modulating the dynamics of pulmonary cytokines. Plos One 6(4):
e18773.
36
Dey, B., Jain, R., Khera, A., Rao, V., Dhar, N., Gupta, U.D., Katoch, V.M., Ramanathan,
V.D, Tyagi, A.K. (2009). Boosting with a DNA vaccine expressing ESAT-6
(DNAE6) obliterates the protection imparted by recombinant BCG (rBCGE6) against
aerosol Mycobacterium tuberculosis infection in guinea pigs. Vaccine 28, 63-70.
Farinacci, M., Weber, S., Kaufmann, S.H. (2012). The recombinant tuberculosis vaccine
rBCGΔureC::hly+ induces apoptotic vesicles for improved priming of CD4+ and
CD8+ T cells. Vaccine. 30, 7608–7614.
Flynn, J.L., Chan, J., Triebold, K.J., Dalton, D.K., Stewart, T.A., Bloom, B.R. (1993). An
essential role for interferon gamma in resistence to Mycobacterium tuberculosis
infection. J. Exp. Med. 178, 2249-2254
Goldsack, L., Kirman, J.R. (2007). Half-truths and selective memory: Interferon gamma,
CD4+ T cells and protective memory against tuberculosis. Tuberculosis. 87,465-473.
Grode, L., Ganoza, C.A., Brohm, C., Weiner, J., Eisele, B., Kaufmann, S.H. (2013). Safety
and immunogenicity of the recombinant BCG vaccine VPM1002 in phase 1 open-
label randomized clinical trial. Vaccine 18, 1340-1348.
Hanekom, W.A. (2005). The immune response to BCG vaccination of Newborns. Ann. NY
Acad. Sci. 1062, 69-78.
Harth, G., Lee, B.Y., Wang, J., D. L., Horwitz M. A. (1997). Novel insights into genetics,
biochemistry, and immunocytochemistry of the 30-kilodalton major extracellular
protein of Mycobacterium tuberculosis. Infect. Immun. 64, 3038-47.
Henao-Tamayo, M.I., Ordway, D.J., Irwin, S.M., Shang, S., Shanley, C., Orme, I.M.
(2010). Phenotypic definition of effector and memory T-lymphocyte subsets in mice
chronically infected with Mycobacterium tuberculosis. Clin Vaccine Immunol. 17,
618-625.
Hoft, D.F., Blazevic, A., Abate, G., Hanekom, W.A., Kaplan, G., Soler, J.H., Weichold, F.,
Geiter, L., Sadoff, J.C., Horwitz, M.A. (2008). A new recombinant bacille Calmette-
Guérin vaccine safely induces significantly enhanced tuberculosis-specific immunity
in human volunteers. J. Infect. Dis. 198, 1491-501.
Honda, I., Seki, M., Ikeda, N., et al (2006). Identification of two subpopulations of Bacillus
Calmette-Guerin (BCG) Tokyo172 substrain with different RD16 regions. Vaccine;
24: 4969-74.
37
Horwitz, M.A., Harth, G. (2003). A new vaccine against tuberculosis affords greater
survival after challenge than the current vaccine in the guinea pig model of
pulmonary tuberculosis. Infect. Immun. 71, 1672–9.
Horwitz, M.A., Harth, G., Dillon, B.J., Maslesa-Galic’, S. (2000). Recombinant bacillus
calmette-guerin (BCG) vaccines expressing the Mycobacterium tuberculosis 30-kDa
major secretory protein induce greater protective immunity against tuberculosis than
conventional BCG vaccines in a highly susceptible animal model. Proc. Natl. Acad.
Sci. U S A. 97, 13853–13858.
Jackson, M., Raynaud, C., Lanéelle, M. A., Guilhot, C., Laurent-Winter, C., Ensergueix,
D., Gicquel, B., Daffé, M. (1999). Inactivation of the antigen 85C gene profoundly
affects the mycolate content and alters the permeability of the Mycobacterium
tuberculosis cell envelope. Mol. Microbiol. 31,1573-87.
Jain, R., Dey, B., Dhar, N., Rao, V., Singh, R., Gupta, U.D., Katoch, V.M., Ramanathan,
V.D., Tyagi, A.K. (2008). Enhanced and Enduring Protection against Tuberculosis by
Recombinant BCG-Ag85C and Its Association with Modulation of Cytokine Profile
in Lung. Plos One 3(12): e3869.
Jeong, Y.H., Jeon, B.Y., Gu, S.H., Cho, S.N., Shin, S.J., Chang, J., Ha, S.J (2014).
Differentiation of antigen-specific T cells with limited functional capacity during
Mycobacterium tuberculosis infection. Infect Immun. 82, 132-139.
Joung, S.M., Ryoo, S. (2014). BCG vaccine in Korea.Clin. Exp. Vaccine Res.2,83-91.
Junqueira-Kipnis, A.P., Turner J., Gonzalez-Juarrero, M., Turner, O.C. and Orme, I.M
(2004). Stable T-Cell Population Expressing an Effector Cell Surface Phenotype in
the Lungs of Mice Chronically Infected with Mycobacterium tuberculosis. Infect
Immun. 72(1): 570–575.
Kamath, A.T., Fruth, U., Brennan, M.J., Dobbelaer, R., Hubrechts, P., Ho, M.M., et al. New
live mycobacterial vaccines: the Geneva consensus on essential steps towards clinical
development. Vaccine; 23 (29), 3753–61.
Kipnis, A., Irwin, S., Izzo, A.A., Basaraba, R.J., Orme, I.M. (2005). Memory T
lymphocytes generated by Mycobacterium bovis BCG vaccination reside within a
CD4 CD44lo CD62 ligand (hi) population. Infect Immun, 73,7759-64.
38
Kong, C.U., Ng, L.G., Nambiar, J.K., Spratt, J.M., Weninger, W., Triccas, J.A. (2011).
Targeted induction of antigen expression within dendritic cells modulates antigen-
specific immunity afforded by recombinant BCG. Vaccine 29, 1374–1381.
Kong, D., Kunimoto, D. Y. (1995). Secretion of human interleukin 2 by recombinant
Mycobacterium bovis BCG. Infect. Immun. 63:799-803.
Kupferschmidt, K. (2011). Infectious disease. Taking a new shot at a TB vaccine. Science
334, 1488-1490.
Leung, A.S., Tran, V., Wu, Z., Yu, X., Alexander, D.C., Gao, G.F., Zhu, B., and Liu, J.
(2008). Novel genome polymorphisms in BCG vaccine strains and impact on
efficacy.BMC Genomics ,9:413 doi:10.1186/1471-2164-9-413.
Lin, C.W., Su, I.J., Chang, J.R., Chen, Y.Y., Lu, J.J. and Douh, Y. (2011). Recombinant
BCG coexpressing Ag85B, CFP10, and interleukin-12 induces multifunctional Th1
and memory T cells in mice. APMIS 120, 72–82.
Lozes, E., Huygen, K., Content J., Denis, O., Montgomery, D. L., Yawman, A. M.,
Vandenbussche, P., Van Vooren, J. P., Drowart, A., Ulmer, J. B., Liu., M. A. (1997).
Immunogenicity and efficacy of a tuberculosis DNA vaccine encoding the
components of the secreted antigen 85 complex. Vaccine. 15, 830-3.
Lu, Y., Xu, Y., Yang. E,, Wang, C., Wang, H., Shen, H. (2012). Novel Recombinant BCG
Coexpressing Ag85B, ESAT-6 andRv2608 Elicits Significantly Enhanced Cellular
Immune and Antibody Responses in C57BL ⁄6 Mice. Scand. J. Immunol. 76, 271–
277.
Magalhães, I., Sizemore, D.R., Ahmed, R.K., Mueller, S., Wehlin, L., Scanga, C.,
Weichold, F., Schirru, G., Pau, M.G., Goudsmit, J., Kuhlmann-Berenzon, S.K.,
Spangberg, M.S., Andersson, J., Gaines, H., Thorstensson, R., Skeiky, Y.A.W.,
Sadoff, J., Maeurer, M. (2008). rBCG Induces Strong Antigen-Specific T Cell
Responses in Rhesus Macaques in a Prime-Boost Setting with an Adenovirus 35
Tuberculosis Vaccine Vector. Plos One 3(11): e3790.
Mandal, M., and Lee, K.D. (2002). Listeriolysin O-liposome mediated cytosolic delivery of
macromolecule antigen in vivo: enhancement of antigen-specific cytotoxic T
lymphocyte frequency, activity, and tumor protection.Biochim.Biophys.Acta. 1563,
7–17.
39
Mangtani, P., Abubakar, I., Arti, C., Beynon, R., Pimpin, L., Fine, P.E., Rodrigues, L.C.,
Smith, P.G., Lipman, M., Whiting, P.F., Sterne, J.A., (2014). Protection by BCG
Vaccine Against Tuberculosis: A Systemic Review of Randomized Controlled Trials.
Clin Infect Dis 58, 470-480.
McShane, H., Behboudi, S., Goonetilleke, N., Brookes, R., Hill, A.V. (2002). Protective
immunity against Mycobacterium tuberculosis induced by dendritic cells pulsed with
both CD8 (+)- and CD4(+)-T-cell epitopes from antigen 85A. Infect. Immun. 70,
1623-1626.
Ohara, N., Ohara-Wada, N., Kitaura, H., Nishiyama, T., Matsumoto, S.,Yamada, T. (1997).
Analysis of the genes encoding the antigen 85 complex and MPT51 from
Mycobacterium avium. Infect. Immun. 65, 3680–3685.
Ottenhoff, T.H. (2012). New pathways of protective and pathological host defense to
mycobacteria. Trends Microbiol. 20, 419-428.
Palma, C., Iona, E., Giannoni, F., Pardini, M., Brunori, L., Fattorini, L., Del Giudice, G.,
Cassone, A. (2008). The LTK63 adjuvant improves protection conferred by Ag85B
DNA-protein prime-boosting vaccination against Mycobacterium tuberculosis
infection by dampening IFN-gamma response. Vaccine. 26, 4237-43.
Parkash, O. (2014). Vaccine against tuberculosis: a view. J. Med. Microbiol.
Partnership WST. (2010). The Global Plan to Stop TB 2011–2015: Transforming the Fight-
Towards Elimination of Tuberculosis.
Qie, Y.Q., Wang, J.L., Liu, W., Shen, H., Chen, J.Z., Zhu, B.D., Xu, Y., Zhang, X.L.,
Wang, H.H. (2009). More Vaccine Efficacy Studies on the Recombinant
BacilleCalmette-Guerin Co-expressing Ag85B, Mpt64 190–198 and Mtb8.4. Scand.
J.Immunol.69, 342–350.
Rahman, S., Magalhães, I., Rahman, J., Ahmed, R., Sizemore, D.R., Scanga, C.A.,
Weichold, F., Verreck, F., Kandova, I., Sadoff, J., Thorstensson, R., Spangberg, M.,
Svensson, M., Andersson, J., Maeurer, M.,Brighenti, S. (2012). Prime-Boost
Vaccination with rBCG/rAd35 Enhances CD8+ Cytolytic T-Cell Responses in
Lesions from Mycobacterium tuberculosis – Infected Primates. Mol. Med. 18, 647-
658.
40
Reece, S.T., Nasser-Eddine, A., Dietrich, J., Stein, M., Zedler, U., Schommer-Leitner, S.,
Ottenhoff, T.H., Andersen, P., Kaufmann, S.H. (2011). Improved long-term
protection against Mycobacterium tuberculosis Beijing/W in mice after intra-dermal
inoculation of recombinant BCG expressing latency associated antigens. Vaccine 29,
8740-4.
Sali, M., Di Sante, G., Cascioferro, A., Zumbo, A., Nicolo, C., Dona, V., Rocca, S., Procoli,
A., Morandi, M., Ria, F., Palu, G., Fadda, G., Manganelli, R.,Delogu, G. (2010).
Surface Expression of MPT64 as a Fusion with the PE Domain of PE_PGRS33
Enhances Mycobacterium bovis BCG Protective Activity against Mycobacterium
tuberculosis in Mice. Infect. Immun.78, 5202–5213.
Schaible, U.E., Winau, F, Sieling, P.A., Fischer, K., Collins, H.L., Hagens, K., Modlin,
R.L., Brinkmann, V., Kaufmann, S.H. (2003). Apoptosis facilitates antigen
presentation to T lymphocytes through MHC-I and CD1 in tuberculosis. Nat. Med 9,
1039–1046.
Sebina, I., Cliff, J. M., Smith, S. G., Nogaro, S., Webb, E. L., Riley, E. M., Dockrell, H. M.,
Elliot, A. M., Hafalla, J. C., Cose, S. (2012). Long-lived memory B-cell responses
following BCG vaccination. PLoS One. 7(12): e51381.
Shi, C., Chen, L., Chen, Z., Zhang, Y., Zhou, Z., Lu, J., Fu, R., Wang, C., Fang, Z., Fan, X.
(2010). Enhanced protection against tuberculosis by vaccination with recombinant
BCG over-expressing HspX protein.Vaccine 28, 5237-44.
Soares, A.P., Kwong Chung, C.K., Choice, T., Hughes, E.J., Jacobs, G., van Rensburg,
R.J., Khomba, G., de Kock, M., Lerumo, L., Makhethe, L., Maneli, M.H., Pienaar, B.,
Smit, E., Rena-Coki, N.G., van Wyk, L., Boom, W.H., Kaplan, G., Scriba, T.J.,
Hanekom, W.A. (2013). Longiitudinal changes in CD4 (+) T-cell memory responses
induced by BCG vaccination of newborns. J. Infect. Dis. 207(7):1084-1094.
Sugawara, I., Yamada, H., Udagawa, T., Huygen, K. (2003). Vaccination of guinea pigs
with DNA encoding Ag85A by gene gun bombardment. Tuberculosis 83, 331-337.
Sugawara, I., Sun, L., Mizuno, S., Taniyama, T. (2009). Protective efficacy of recombinant
BCG Tokyo (Ag85A) in rhesus monkeys (Macacamulatta) infected intratracheally
with H37Rv Mycobacterium tuberculosis. Tuberculosis 89, 62–67.
41
Sugawara, I., Udagawa, T., Taniyama, T. (2007). Protective efficacy of recombinant BCG
Tokyo (Ag85A) BCG Tokyo with Ag85A peptide boosting against Mycobacterium
tuberculosis-infected guinea pigs in comparison with that of DNA vaccine enconding
Ag85A. Tuberculosis. 87, 94-101.
Sun, R., Skeiky, Y.A., Izzo, A., Dheenadhayalan, V., Imam, Z., Penn, E., Stagliano, K.,
Haddock, S., Mueller, S., Fulkerson J, Scanga, C., Grover, A., Derrick, S. C., Morris,
S., Hone, D. M., Horwitz, M. A., Kaufmann, S.H., Sadoff. J.C. (2009). Novel
recombinant BCG expressing perfringolysin O and the over expression of key
immunodominant antigens; pre-clinical characterization, safety and protection against
challenge with Mycobacterium tuberculosis.Vaccine. 27, 4412-23.
Tang, C., Yamada, H., Shibata, K., Maeda, N., Yoshida, S., Wajjwalku, W., Ohara, N.,
Yamada, T., Kinoshita, T., Yoshikai, Y. (2008). Efficacy of Recombinant Bacille
Calmette-Guérin Vaccine Secreting Interleukin-15/Antigen 85B Fusion Protein in
Providing Protection against Mycobacterium tuberculosis. J. Infect. Dis. 197, 1263–
1274.
Tang, C., Yamada, H., Shibata, K., Yoshida, S., Wajjwalku, W.,Yoshikai, Y. (2009). IL-15
protects antigen-specific CD8 T cell contraction after Mycobacterium bovis bacillus
Calmette-Guérin infection. J. Leukoc. Biol. 86, 187-194.
Trunz, B.B., Fine, P., Dye, C. (2006). Effect of BCG vaccination on childhood tuberculous
meningitis and miliary tuberculosis worldwide: a meta-analysis and assessment of
cost-effectiveness. Lancet 367, 1173–1180.
Tullius, M.V., Harth, G., Maslesa-Galic, S., Dillon, B.J., Horwitz, M.A. (2008). A
replication-limited recombinant Mycobacterium bovis BCG vaccine against
tuberculosis designed for human immunodeficiency virus-positive persons is safer
and more efficacious than BCG. Infect. Immun. 76, 5200-14.
Wang, C., Fu, R., Chen, Z., Tan, K., Chen, L., Teng, X., Lu, J., Shi, C., Fan, X. (2012).
Immunogenicity and protective efficacy of a novel recombinant BCG strain over
expressing antigens Ag85A e Ag85B. Clin. Dev. Immunol.2012, 1- 9.
WHO (1998) Global tuberculosis control. World Health Organization.
WHO. Tuberculosis prevention trials: Madras (1979). Trial of BCG vaccines in South India
for tuberculosis prevention. Bull World Health Organ, 57, 819–27.
42
World Health Organization (WHO) (2012). Global tuberculosis report.
World Health Organization (2009). Global Tuberculosis Control: Surveillance, Planning,
and Financing. Geneva, Switzerland: World Health Organization Press.
World Health Organization (WHO) (2009). Global tuberculosis control—epidemiology,
strategy, financing.
Xu, Y., Liu, W., Shen, H., Yan, J., Qu,D., Wang, H. (2009). Recombinant Mycobacterium
bovis BCG Expressing the Chimeric Protein of Antigen 85B and ESAT-6 Enhances
the Th1 Cell-Mediated Response. Clin.VaccineImmunol. 16, 1121–1126.
Xu, Y., Liu, W., Shen, H., Yan, J., Yang, E., Wang, H. (2010). Recombinant
Mycobacterium bovis BCG expressing chimeric protein of Ag85B and ESAT-6
enhances immunostimulatory activity of human macrophages. Microbes Infect. 12,
683 -689.
Yang, X., Bao, L., Deng, Y. (2011). A novel recombinant Mycobacterium bovis bacillus
Calmette-Guerin strain expressing human granulocyte macrophage colony-
stimulating factor and Mycobacterium tuberculosis early secretory antigenic target 6
complex augments Th1 immunity. Acta Biochim. Biophys.Sin. 43, 511–518.
Zhang, W., Zhang, Y., Zheng, H., Pan, Y., Liu, Du, P., Wan, L., Liu, J., Zhao, G., Chen, C.,
Wan, K. (2013). Genome sequencing and analysis of BCG vaccine strains. PLoS One
8(8): e71243
43
Artigo 2
A New Recombinant BCG Vaccine Induces Specific Th17 and Th1 Effector Cells with
Higher Protective Efficacy against Tuberculosis
Adeliane Castro da Costa1, Abadio de Oliveira Costa-Júnior1, Fábio Muniz de Oliveira2,
Sarah Veloso Nogueira1, Joseane Damaceno Rosa1, Danilo Pires Resende1, André Kipnis2,
Ana Paula Junqueira-Kipnis1*
1 Laboratório de Imunopatologia das Doenças Infecciosas, Instituto de Patologia Tropical e
Saúde Pública, Universidade Federal de Goiás, Goiânia, Goiás, Brazil
2 Laboratoório de Bacteriologia Molecular, Instituto de Patologia Tropical e Saúde Pública,
Universidade Federal de Goiás, Goiânia, Goiás, Brazil
Abstract
Tuberculosis (TB) is an infectious disease caused by Mycobacterium tuberculosis (Mtb)
that is a major public health problem. The vaccine used for TB prevention is
Mycobacterium bovis bacillus Calmette-Guérin (BCG), which provides variable efficacy in
protecting against pulmonary TB among adults. Consequently, several groups have pursued
the development of a new vaccine with a superior protective capacity to that of BCG. Here
we constructed a new recombinant BCG (rBCG) vaccine expressing a fusion protein
(CMX) composed of immune dominant epitopes from Ag85C, MPT51, and HspX and
evaluated its immunogenicity and protection in a murine model of infection. The stability of
the vaccine in vivo was maintained for up to 20 days post-vaccination. rBCG-CMX was
efficiently phagocytized by peritoneal macrophages and induced nitric oxide (NO)
production. Following mouse immunization, this vaccine induced a specific immune
response in cells from lungs and spleen to the fusion protein and to each of the component
recombinant proteins by themselves. Vaccinated mice presented higher amounts of Th1,
Th17, and polyfunctional specific T cells. rBCG-CMX vaccination reduced the extension of
lung lesions caused by challenge with Mtb as well as the lung bacterial load. In addition,
44
when this vaccine was used in a prime-boost strategy together with rCMX, the lung
bacterial load was lower than the result observed by BCG vaccination. This study describes
the creation of a new promising vaccine for TB that we hope will be used in further studies
to address its safety before proceeding to clinical trials.
Citation: Costa ACd, Costa-Júnior AdO, Oliveira FMd, Nogueira SV, Rosa JD, et al.
(2014) A New Recombinant BCG Vaccine Induces Specific Th17 and Th1 Effector Cells
with Higher Protective Efficacy against Tuberculosis. PLoS ONE 9 (11): e112848.
doi:10.1371/journal.pone.0112848
Editor: Delphi Chatterjee, Colorado State University, United States of America.
Received August 20, 2014; Accepted October 15, 2014; Published November 14, 2014
Copyright: 2014 Costa et al. This is an open-access article distributed under the terms of
the Creative Commons Attribution License, which permits unrestricted use, distribution,
and reproduction in any medium, provided the original author and source are credited.
Data Availability: The authors confirm that all data underlying the findings are fully
available without restriction. All relevant data are within the paper and its Supporting
Information files.
Funding: This study was financed by the National Council for Scientific and Technological
Development (CNPq, Project #301976/2011-2, 472906/2011-9, 301198/2009-8,
472909/2011-8) and by Fundaçãode Amparo a Pesquisa do Estado de Goiás (FAPEG-
PRONEX). ACC received a PhD fellowship from CNPq. AOCJ, DPR, and FMO each
received a MSc fellowship from CNPq. SVN received a Post Doc fellowship from CNPq.
JDR received an undergraduate fellowship from PIBIC-CNPq. The funders had no role in
study design, data collection and analysis, decision to publish, or preparation of the
manuscript.
45
Competing Interests: The authors have declared that no competing interests exist.
* Email: [email protected]
Introduction
Tuberculosis (TB) is a public health problem causing 8.6 million new cases and 1.3
million deaths annually [1]. The causative agent of TB is Mycobacterium tuberculosis
(Mtb), an intracellular pathogen that after infecting the host can either cause active disease
or remain latent. In this context, it is estimated that one third of the world population is
latently infected with Mtb, of which approximately 10% will develop active disease [2,1].
Currently, the vaccine used for TB prevention is Bacillus Calmette-Guérin (BCG), an
attenuated Mycobacterium bovis strain used since 1921 [3]. Despite being the only
approved vaccine for human use and conferring protection against tuberculous meningitis
and miliary TB in children, its protective efficacy remains questionable, as it does not
protect young adults against pulmonary TB [4,5,6].
The factors determining the variable protective mechanisms induced by BCG are not
well understood. Some suppositions point towards the BCG sub-strain characteristics. It has
acquired genotypic and phenotypic differences, such as residual virulence and epitope
number variation, after the attenuation process and the several sub-culturing passages made
through the years [7–8]. In addition, BCG has limited capacity to induce long lasting
memory and, in humans, the vaccine induces an immune response with Th1 effector cells
producing IFN-γ [9,10,11]. Although IFN-γ is crucial for the immune response to Mtb,
studies have shown this cytokine is not a surrogate marker of the protection conferred by
BCG [12,11]. To address this matter, several groups have been working on the
development of protein subunit vaccines, new adjuvants, attenuated/auxotrophic Mtb
strains, and recombinant BCG (rBCG) vaccines, among other approaches [13–14].
Different strategies are being used by the groups modifying BCG, such as the expression of
immunodominant Mtb antigens [15], the association of re-introduction and super-
expression of antigens lost during the process of BCG attenuation [16], the development of
rBCG expressing cytokines and Mtb proteins [17], and the heterologous expression of
proteins in rBCG to induce CD8+ T lymphocytes [18].
46
While evaluating the rBCG vaccines produced in the last five years, it was observed
that the selection of Mtb antigens used in the construction of the rBCG was more important
for vaccine efficacy than the BCG subtypes used to make them [19]. However, comparing
the BCG subtypes used to construct recombinant vaccines, sub strains BCG Tokyo and
BCG Moreau presented more immune dominant epitopes than the other sub strains, and all
rBCG produced using the Tokyo strain protected better than the wild type BCG [20].
Sequencing of the complete genome and an evaluation of the proteome profile of BCG
Moreau were performed, but this strain was poorly used to build a TB recombinant vaccine
[21–22]. Some studies have shown that BCG Moreau is a good carrier and efficiently
induces a specific immune response to other diseases, such as pertussis, entero- pathogenic
Escherichia coli, or bladder cancer [23–25]. BCG Moreau has been used for more than 80
years in Brazil, attesting to its safety. This strain is currently being tested again as oral
vaccine and is showing better performance than BCG Danish [26]. This prompted us to
develop a recombinant TB vaccine using the BCG subtype Moreau.
Most of the time, the choice of the antigens used to develop an rBCG is based on the
different phases of Mtb infection. Active and latent TB are distinct phases of the disease
that can be characterized by their antigen expression, and these antigens are effective at
inducing an immune response [27]. Our group and others have demonstrated that patients
with active pulmonary TB and latently infected individuals respond differently to several
Mtb antigens, such as antigen 85 complex proteins, MPT51 and HspX [28–31]. In our
previous work, we developed a fusion protein (CMX) composed of the immunodominant
antigens from Mtb: Ag85C, MPT51 and the entire HspX protein, [32] which are expressed
in different stages of TB (active and latent phases of the disease). This construction retained
the immunogenicity of the original proteins in vaccinated mice and was also specifically
recognized by individuals with active TB [32]. To determine if this fusion protein could be
expressed by a live vector, and consequently be used as a vaccine for TB, a recombinant
Mycobacterium smegmatis (mc2) was designed to express CMX (mc2-CMX). This vaccine
induced a specific immune response to CMX that culminated with protection similar to that
observed following vaccination with BCG Moreau [33]. In this scenario, the fusion protein
CMX was capable of adding important immunogenic properties to mycobacterium vaccine
vectors, inducing an effective response to control Mtb infection in mice.
47
Based on the previous studies, both ours and others, we hypothesize that using BCG
subtype Moreau to develop a new rBCG expressing CMX will add immunological
characteristics that are missing in conventional BCG and therefore induce an specific
immune response better able to control the infection by Mtb. Our data here show that the
expression of CMX protein by the rBCG Moreau vaccine (rBCG-CMX) is a determining
factor for inducing specific Th1 and Th17 responses, in addition to polyfunctional T cells.
These responses may be responsible for the reduction in the inflammatory lung lesions
induced by Mtb challenge in BALB/c mice and the reduction in the bacterial load.
Moreover, prime vaccination with rBCG-CMX followed by boosting with rCMX further
reduced the lung bacterial load as compared to the reduction caused by BCG Moreau.
Materials and Methods
Bacterial strains, growth conditions, and plasmid and vaccine preparations
The M. bovis BCG Moreau strain, kindly provided by the Butantan Institute, was
grown in 7H9 media (Becton and Dickinson, Le pont de Claix-France) supplemented with
10 oleic acid, albumin, dextrose and catalase (OADC-Becton and Dick- inson, Le pont de
Claix- France), 0.5% glycerol and 0.05% Tween 80, at 37 oC in a humid atmosphere and
5% CO2 for approximately three weeks. The recombinant BCG strains were obtained after
electroporation of BCG Moreau with one of the three expression plasmids (pLA71, pLA72,
and pMIP12). These plasmids have mycobacteria and Escherichia coli replication origins
and use the gene for kanamycin resistance as a selection marker, as described by Varaldo et
al. (2004) [34]. The gene coding for the fusion CMX protein (Ag85C, MPT51, and HspX)
[32] was obtained from Mtb (H37Rv) DNA and inserted in the pLA71, pLA73 and pMIP12
mycobacteria expression vectors as described by Junqueira-Kipnis et al. (2013) [33]. The
employed expression plasmids enable the recombinant gene to be expressed with either the
signal peptide of the β-lactamase from M. fortuitum (pLA71) or the entire β-lactamase
protein (pLA73), or, alternatively, the protein can be highly expressed intracellularly
(pMIP12). Transformants with empty plasmids were used as controls. The recombinant
vaccines obtained were cultured under the same conditions as the BCG Moreau described
above, with the addition of 20 mg/mL of kanamycin. The vaccines were grown in a single
48
lot in 7H9 supplemented with OADC, and the concentration of the lots were determined by
plating serial dilutions of each vaccine onto 7H11 agar plates with or without kanamycin
(20 mg/mL).
Animals
BALB/c female mice, 4 to 8 weeks of age, from the Instituto de Patologia Tropical e
Saúde Pública/UFG animal housing were maintained in micro-isolators equipped with
HEPA filters for air intake and exhaustion, and provided with water and a chow diet ad
libitum. The room temperature was kept at 20–24 °C with a relative humidity of 40–70%
and light/dark cycles of 12 hours. Mice were handled according to the Sociedade Brasileira
de Ciência em Animais de Laboratório (SBCAL/COBEA) guidelines. The study was
approved by the Ethical Committee for Animal use (CEUA: Comite de Ética no uso de
animais; #229/11) of the Universidade Federal de Goiás.
PCR and Western blotting
To confirm the presence of the CMX fusion gene (˜860 base pairs), a PCR reaction
using Ag85C forward (5’ggtctgcgggcccaggatg 3’) and HspX reverse (5’
tcagttggtggaccggatctgaatgtg 3’) primers (10 nmol of each) in the same conditions as
described previously [32]. The expression of CMX (˜35 kDa) by the different vectors was
assessed by Western blot, as described previously [33].
Assessment of in vivo plasmid stability
BALB/c mice were immunized with 106 colony forming units (CFU) of rBCG-
pLA71-CMX or rBCG-pLA71 subcutaneously in the dorsal region. Animals were
euthanized at different time points (3 mice/group/time point) and the dorsal tissue at the
injection site was cut out and macerated. The homogenized tissue was plated onto 7H11
agar supplemented with OADC, 0.5% glycerol and 20 mg/mL of kanamycin. After
incubation at 37°C with 5% CO2 for approximately 30 days, the plates were analyzed for
49
bacterial growth and the numbers of CFU were determined. The DNA from a representative
colony was extracted by boiling the entire colony, and the supernatant was submitted to
PCR for detection of the CMX gene. This experiment was repeated three times.
Mouse peritoneal macrophage preparation, culture, and infection
Peritoneal macrophages were obtained after injection of 1 mL of thioglycolate into the
peritoneal cavity of BALB/c mice four days prior to macrophage collection. Mice were
euthanized by cervical dislocation and 5 mL of ice cold phosphate buffered saline (PBS)
was injected into the peritoneal cavity, followed by vigorous massage. The recovered cells
were distributed in a 24 well plate at a concentration of 1x106 cells per mL and incubated
with 5% CO2 for 24 hours to allow for adherence. In some of the cultured wells, circular
glass cover slides were introduced to allow for microscopic evaluation. Macrophages were
infected with BCG or rBCG-CMX at a multiplicity of infection (MOI=10) or incubated
with LPS (5 mg/mL), as a control. Infected macrophages were incubated at 37°C with 5%
CO2. After 3 hours, the supernatant was discarded, the cells were washed, and new media
was added to the wells. After 18 hours, the supernatant was collected and plated on 7H11
agar plates to determine the number of bacteria that were not phagocytosed. Infected
macrophages were washed three times with RPMI medium (HIMEDIA, Mumbai-India) and
then lysed with water and plated on 7H11 agar to determine the level of CFU of the
intracellular bacteria. Some of the infected macrophages were kept for an additional
incubation of 48 hours and used for nitric oxide (NO) quantification of the supernatant by
the Griess method, as described below. The cover slides from macrophages infected for 3
hours were washed three times with PBS at 37°C, fixed with methanol and stained with
Ziehl Neelsen, for acid fast bacilli visualization, or Instant Prov (Newprov, Pinhais- Brazil),
for cell visualization.
Nitric oxide determination
Supernatants (100 mL) from macrophage cultures that had been stimulated or not
(control) with BCG, rBCG, or LPS were stored in a 96 well plate at –20°C until use. Fifty
50
microliters of the supernatant was transferred to another 96 well plate and 50 mL Griess
reagent (1% sulphanilamide, 2% phosphoric acid, and 0.1% naphthylethylene diamine
dihydrochloride) was added, followed by 15 minutes of incubation at room temperature,
protected from the light. A serial dilution of nitrite was included in additional wells to
provide a standard curve for comparison. The absorbance was measured in a
spectrophotometer (Thermo LabSystems Multiskan RC/MS/EX Microplate Reader) at 595
nm.
BCG and rBCG-CMX immunizations
BALB/c mice were separated into three groups: Control, BCG Moreau, and rBCG-
CMX. Five to six animals were used in each group. Prior to use, the vaccines were thawed
and the concentrations adjusted with PBS/0.05% Tween 80, so that each animal would
receive 106 CFU in 100 L by subcutaneous injection in the dorsal region. The vaccine
concentrations were confirmed by plating the remaining inocula on 7H11 agar
supplemented with OADC. An additional group of animals, previously vaccinated with
rBCG-CMX (N = 5) was given a booster, 30 days later with 20 mg/mL of rCMX/CPG
DNA prepared as described at de Souza et al, 2012 [32]. This experiment was repeated two
times in BALB/c mice and one time in C57BL/6 mice.
Cell preparation for immune response evaluation
Thirty days after immunization, six animals from each group of the BALB/c mice
were euthanized and the spleens and left lung lobes were collected. Spleens were prepared
into single cell suspensions using 70 mm cell strainers (BD Biosciences, Lincoln Park, NJ)
and the cells were resuspended with RPMI medium. Erythrocytes were lysed with lysis
solution (0.15 M NH4Cl, 10 mM KHCO3) and the cells were washed and resuspended
with RPMI supplemented with 20% fetal calf serum, 0.15% sodium bicarbonate, 1% L-
glutamine (200 mM; Sigma-Aldrich-Brazil, São Paulo), 1% non-essential amino acids
(Sigma-Aldrich). Cells were counted in a Neubauer chamber and the concentration was
adjusted to 1x106 cells/mL. Prior to collection, the lungs were perfused with ice-cold PBS
51
containing 45 U/mL of heparin (Sigma-Aldrich-Brazil, São Paulo) and processed as
described previously [33]. The lungs were digested with DNAse IV (30 mg/mL; Sigma-
Aldrich) and collagenase III (0.7 mg/mL; Sigma- Aldrich-Brazil, São Paulo) for 30 min
at 37°C. The digested lungs were prepared into single cell suspensions using 70 mm cell
strainers and submitted to erythrocyte lysis. The cells were washed and resuspended with
RPMI, and the concentrations were adjusted to 1x106 cells/mL.
Ag85 (Rv0129c), MPT51 (Rv3803c), HspX (Rv2031c) and CMX specific
cytokine evaluation by lung and spleen lymphocytes
In a 96 well cell culture plate (CellWells TM), 200 mL of spleen or lung cell
suspensions were cultivated without (media alone) or with recombinant CMX or
with only one of the component recombinant proteins, Ag85, MPT51 or HspX
(single proteins were used at a concentration of 10 mg/mL) or ConA (positive
control) in a 5% CO2 incubator at 37°C for 4 hours. Monensin (3 mM;
eBioscience) was then added to the wells and the cultures were further incubated for
4 hours. Cells were treated with 0.1% sodium azide in PBS for 30 min at room
temperature. After centrifuging, the cells were stained with anti-CD4 Percp
(eBioscience, clone RM4-5) or anti-CD4 FITC (BD PharMingen, clone RM4-5) for
30 min. Cells were then, permeabilized with Perm Fix/Perm Wash (BD
PharMingen), washed with 0.1% sodium azide in PBS, and then stained with the
following antibodies to access the expressions of a panel of Th1 cytokines: anti-
TNF-α FITC (BD PharMingen-MP6; clone: XT22), anti-IL-2PE (eBioscience-JES6;
clone: 5H4), and anti-IFN-γ APC (eBioscience; clone: XMG1.2). To access the
expression of a panel of Th17 cytokines, cells were stained with: anti-IL-2 PE
(eBioscience, clone: JES6-5H4), anti-IL-17A Percp (eBioscience, clone: eBio17B7),
and anti-IFN-γ APC (eBioscience, clone: XMG1.2) for 30 min. Cell acquisition of
100,000 events per sample was performed in a BD FACS Verse (Universidade de
Brasília-UNB) flow cytometer and the acquired data were analyzed using FlowJo
8.7 software. Lymphocytes were selected based on their size (Forward scatter, FSC)
and granularity (side scatter, SSC). The specific immune responses were determined
52
by subtracting the result of the media alone stimulation from the responses to each
of the antigens.
Mycobacterium tuberculosis intravenous infection
The Mycobaterium tuberculosis (H37Rv) strain was maintained as described
previously [33]. A vial from a constant lot was thawed and the inoculum was
adjusted to the concentration of 106 CFU/mL by diluting with PBS containing
0.05% Tween 80. Ninety days after immunization with rBCG-CMX or BCG
Moreau, 100 mL of the inoculum was injected into the retro-orbital plexus. The
bacterial load of infection was determined by plating the lung homogenates from
one mouse from each group on the day following infection on 7H11 agar
supplemented with OADC. Forty-five days after infection, mice were euthanized
and the anterior and mediastinal right lung lobes were collected, homogenized, and
plated on 7H11 agar supplemented with OADC. The bacterial load was determined
by counting the CFU after 21 days of incubation at 37°C.
Histopathology
The lungs of mice euthanized 45 days after the Mtb challenge were perfused
with 0.05% heparin by injection in the heart right ventricle. The posterior right lobes
were collected, conditioned in histological cassettes, and fixed with 10% buffered
formaldehyde. Samples were sectioned into 5 mm thick slices and stained with
hematoxylin and eosin (HE) for analysis via microscopy (Axio scope.A1- Carl
Zeiss). Scores for the observed lesions were determined based on the area with
lesions relative to the area of the total visual field. The results are presented as the
percentage of area with lesions. Three different fields were evaluated per slide for
each animal of each group.
Statistical analysis
53
The data were analyzed using Microsoft Office Excel 2011 and Prism (version 5.0c,
GraphPad) software. The results represent the mean and standard deviation for each
experimental group. The results from rBCG-CMX and BCG groups were compared using
One-Way Anova followed by Dunnett’s post-hoc test. Values of p<0.05 were considered
statistically significant. All experiments repetition showed similar responses.
Results
1. Recombinant vaccine construction, rCMX expression analysis and in vivo plasmid
stability
The expression of heterologous proteins in mycobacteria can be influenced by several
factors such as administration dose, cellular localization, and expression stability, among
others [34–35]. To obtain the best possible expression, we tested three different plasmid
constructions to express CMX: pLA71/CMX, pLA73/ CMX, and pMIP12/CMX. As shown
in Figure 1A, all three constructions contained the CMX fused gene and were successfully
transformed into BCG Moreau. Western blot analysis of recombinant BCG cultures
revealed that only the plasmid pLA71/ CMX was capable of inducing the expression of
CMX protein (Fig. 1B, Figure S1). Thus we performed the following analysis only with the
recombinant vaccine rBCG-pLA71/CMX, hence- forward referred to as rBCG-CMX.
54
Figure 1. Plasmid construction and CMX expression for three different rBCG-CMX
vaccines. (A) PCR products corresponding to the CMX fusion gene, CMX (˜860 bp), from
all three plasmid constructions and their respective empty controls: pLA71, pLA73 and
pMIP12. M: molecular weight marker; NC: negative control reaction, using water; BCG:
55
DNA from BCG-Moreau; rBCG transformed with pLA71, pLA73 and pMIP12, with
(CMX) or without (empty) the fusion gene; PC: positive control reaction. (B) Analysis of
CMX expression in rBCG-pLA71/CMX. Western blot of BCG transformants containing
pLA71/CMX or empty vector using polyclonal antibody produced against rCMX. M:
molecular mass marker; CMX: purified recombinant CMX; pLA71/CMX: rBCG with
plasmid pLA71/CMX; pLA71: rBCG with plasmid pLA71.
doi:10.1371/journal.pone.0112848.g001
In order to verify the stability of the plasmid within the recombinant vaccine rBCG-
CMX in vivo without antibiotic selective pressure, mice were vaccinated subcutaneously
and the tissue of the site of infection was macerated at different time points and plated on
media with or without the selective antibiotic kanamycin. As shown in Figure 2, the
number of CFU recovered from media with or without antibiotic was similar, indicating
that the recombinant vaccine recovered from mice retained the plasmids up to 15 days after
immunization (Figs. 2A and B). The presence of plasmid was further confirmed by
performing PCR specific to the CMX gene (Fig. 2C).
56
Figure 2. Stability of rBCG-CMX in vivo. (A) Images of plates showing the
mycobacterial growth of rBCG-CMX recovered from the dorsal region of mice 5, 10 and
15 days after subcutaneous immunization, and plated on media with kanamycin (kan) or
without (W/o). (B) CFU counts recovered at different time points from the dorsal region of
57
mice after immunization. (C) CMX gene detection by PCR for three isolated colonies from
plates W/o kanamycin (Lanes 3–5). Lanes 1: M: molecular weight marker; 2: Negative
control: NC: water. doi:10.1371/journal.pone.0112848.g002
2. rBCG-CMX is phagocytosed by peritoneal macrophages at higher levels than BCG
Moreau but induces similar levels of NO
Vaccine phagocytosis and processing to present antigens has been shown to be an
important factor responsible for the capacity to induce a protective immune response [36].
Thus the tendency of peritoneal macrophages to phagocytose rBCG-CMX was analyzed
(Fig. 3). After 18 hours of infection, the recovered CFU from rBCG-CMX infected
macrophages was higher than that from BCG Moreau infected macrophages (Fig. 3A,
p<0.01). Acid fast staining of infected macrophage cultures confirmed that peritoneal
macrophages had higher numbers of rBCG-CMX than of BCG (Fig. 3C). The analysis of
CFU from culture supernatants confirmed that the groups were equally infected by the
different vaccines (Fig. 3A).
Phagocytosis induces respiratory burst activation with its consequent production of
NO. As another way to evaluate phagocytosis rates, the production of nitric oxide (NO) was
evaluated in the culture supernatant of infected peritoneal macrophages. No difference in
NO production was observed between the two vaccines evaluated (Fig. 3B). Despite the
increased number of bacilli inside the peritoneal macrophages infected with rBCG-CMX,
similar levels of NO were induced by both vaccines.
58
Figure 3. Levels of phagocytosis by peritoneal macrophages of BCG and rBCG-CMX
59
after infection (MOI = 10). (A) Macrophages were infected with BCG or rBCG-CMX and
the bacterial load in both the supernatant (sup) and inside the macrophages (MΦ) were
determined. The amount of viable bacteria was determined by plating supernatant or cell
lysates onto 7H11 agar supplemented with OADC and counting the CFU 28 days after
incubation at 37°C. *(p<0.01) significant difference between the compared groups (log10
scale). (B) Nitric oxide (NO) production by macrophages infected with BCG or rBCG-
CMX was determined. Uninfected media (Control) and LPS-stimulated (LPS) macrophages
were included as controls. (C) Microscopic evaluation of peritoneal macrophages, 3 hours
after infection with BCG or rBCG-CMX stained with Instant Prov or Ziehl Neelsen.
Uninfected macrophages (Control) were included as a negative control. The results shown
are representative of three different experiments. doi:10.1371/journal.pone.0112848.g003
3. rBCG-CMX vaccine induces a specific cellular immune response
Since rBCG-CMX was stable in vivo and phagocytosis of it induced macrophage
activation (as measured by NO production), we questioned whether this vaccine would be
able to induce a specific response to CMX and/or to the recombinant antigens alone (Fig.
4A). Immunization with rBCG-CMX vaccine induced higher numbers of CD4+ T
lymphocytes positive for IFN-y specific for CMX in cells from the spleen and lungs of
BALB/c immunized mice 30 days after vaccination than did immunization with BCG
Moreau (Figs. 4B and C, p<0.05; Th1 representative dot plots in Figure S2A). Similarly,
rBCG-CMX induced higher levels of specific Th17 cells, an important group of cells for
protection from Mtb and development of memory, in the cells from the spleen and lungs of
immunized mice (Figs. 4D and E, p<0.05; Th17 representative dot plots in Fig. S2B).
60
Figure 4. Immunogenicity of rBCG-CMX in BALB/c mice. (A) Experimental time line.
BALB/c mice were immunized with rBCG-CMX or BCG Moreau. Thirty days later, 6 mice
per group were euthanized for evaluation of vaccine-induced immunogenicity. Ninety days
after immunization, mice were intravenously (i.v.) challenged with 105 CFU of H37Rv.
Forty-five days after i.v. challenge, the lung bacterial load (CFU) and lesions (H&E) were
assessed. (B–E) Specific cellular immune responses induced with rCMX stimulation ex
61
vivo. Spleen (B and D) and lung (C and E) cell suspensions from vaccinated and
unvaccinated (Control) mice were stimulated with rCMX. Cells positive for both CD4 and
IFN-y (B and C) or CD4 and IL-17 (D and E) were determined by flow cytometry.
Lymphocytes were selected based on size and granularity. Flow cytometry gates were set to
analyze CD4+ T cells, and then the fluorescence of antibodies detecting IFN-y+ or IL-17+
cells was recorded. These data are representative of two independent experiments
(N=6,*p<0.05). doi:10.1371/journal.pone.0112848.g004
We next questioned which protein(s) of the recombinant CMX fusion protein could
contribute to the induction of IFN-y (Fig. 5) and/or IL-17 (Fig. 6) by CD4+ T lymphocytes.
As depicted in Figure 5, ex vivo stimulation of spleen and lung cells from rBCG- CMX
vaccinated mice with Ag85, MPT51, or HspX all specifically induced CD4+IFN-y+ cells
(Figs. 5A and C, p<0.05). A significantly higher number of spleen cells were observed
responding to MPT51 than to Ag85 or HspX. In mice vaccinated with BCG, cells that were
CD4+IFN-y+ were only induced in response to Ag85 and MPT51 stimulation, but not in
response to HspX. Additionally, these CD4+IFN-y+ cells were induced to a lesser extent
than in the spleen or lung cells from mice vaccinated with rBCG-CMX (Figs. 5B and D,
p<0.05).
62
Figure 5. Levels of CD4+IFN-y+ T cells induced by ex vivo stimulation with
recombinant Ag85, MPT51, and HspX. Thirty days after vaccination, lung and spleen
suspensions were stimulated ex vivo with Ag85, MPT51, HspX, or medium alone. The
number of cells positive for CD4 and IFN-y was determined by flow cytometry.
Lymphocytes were selected based on size and granularity. Gates were set to analyze CD4+
T cells, and then the fluorescence of antibodies detecting IFN-y+ cells was recorded. (A–B)
Spleen cells from mice vaccinated with (A) rBCG-CMX or (B) BCG. (C–D) Lung cells
from mice vaccinated with (C) rBCG-CMX or (D) BCG. In A and C, all results were
different from the medium stimulation. These data are representative of two independent
experiments (N=6,*p<0.05). doi:10.1371/journal.pone.0112848.g005
Upon antigen stimulation in cells from rBCG-CMX-immunized mice, high numbers
of Th17 lymphocytes were induced. In spleen cells, the highest response was to MPT51
63
(Fig. 6A), while in the lungs, all antigens stimulated the production of IL-17 to a similar
degree (Fig. 6C). The number of CD4+IL-17+ spleen cells responding to MPT51 was
significantly higher than the amount of cells responding to Ag85 antigen (Fig. 6A, p<0.05).
Th17 expression was not induced in spleen or lung cells from mice vaccinated with BCG
when stimulated with any of the recombi- nant proteins (Ag85, MPT51 and HspX) (Figs.
6B and D).
Figure 6. Levels of CD4+IL-17+ T cells induced by ex vivo stimulation with
recombinant Ag85, MPT51, and HspX. Thirty days after vaccination, lung and spleen
suspensions were stimulated ex vivo with Ag85, MPT51, HspX, or medium alone. The
number of cells positive for CD4 and IL-17 was determined by flow cytometry.
Lymphocytes were selected based on size and granularity. Gates were set to analyze CD4+
T cells, and then the fluorescence of antibodies detecting IL-17+ cells was recorded. (A–B)
Spleen cells from mice vaccinated with (A) rBCG-CMX or (B) BCG. (C–D) Lung cells
64
from mice vaccinated with (C) rBCG-CMX or (D) BCG. In A and C, all results were
different from the medium stimulation. These data are representative of two independent
experiments (N = 6, *p<0.05). doi:10.1371/journal.pone.0112848.g006
Although the above experiments determined that the rBCG-CMX vaccine generates
Th1 (IFN-y) and Th17 specific responses, it remained important to verify the induction of
polyfunctional CD4+ T cells, since several publications have associated these cells with
protection against Mtb [33,37]. Ex vivo stimulation of spleen and lung cells with CMX
increased the numbers of CD4+ T cells positive for both IL-2 and IFN-y (Figs. 7A and C) as
well as for both TNF-α and IFN-y (Figs. 7B and D) in cells from rBCG-CMX vaccinated
mice as compared to the levels in cells from BCG Moreau vaccinated mice.
65
Figure 7. Levels of polyfunctional CD4+ T cells induced by BCG and rBCG-CMX
vaccines. Spleen (A and C) and lung (B and D) cell suspensions from vaccinated and
control mice stimulated with rCMX. (A–B) CD4+IL-2+IFN-y+ cells or (C–D) CD4+TNF-
α+IFN-y+ cells were analyzed by flow cytometry. Lymphocytes were selected based on size
and granularity. Gates were set to analyze CD4+ T cells, and then the fluorescence of
antibodies detecting IL-2+ and IFN-y+ or TNF-α+ and IFN-y+ cells was recorded. These data
are representative of two independent experiments (N = 6, *p<0.05).
doi:10.1371/journal.pone.0112848.g007.
66
4. rBCG-CMX reduces the lung bacterial load
Although we found that immunization with rBCG-CMX was capable of inducing a
specific immune response to CMX in BALB/c mice, this response alone is not sufficient to
predict the protection properties of a vaccine. Thus, immunized mice were challenged with
Mtb and the protective capacity was evaluated by assessing the bacterial load 45 days later.
As observed in Figure 8, mice immunized with rBCG-CMX had a significantly lower
bacterial load in the lungs than the unimmunized mice. To test if the protection could be
improved in a prime-boost strategy, rBCG-CMX immunized mice were boosted 30 days
later with rCMX/CPG DNA vaccine formulation and challenged with Mtb. Surprisingly, a
boost with rCMX subunit vaccine showed the lowest lung bacterial load at 45 days post
Mtb infection (Fig. 8).
67
Figure 8. Bacterial load in the lungs of BALB/c mice 45 days after Mycobacterium
tuberculosis challenge. Ninety days after immunization, three mice from each group
(control, BCG and rBCG-CMX) were challenged with 105 CFU of Mycobacterium
tuberculosis H37Rv intravenously into the orbital sinus plexus. One additional group of
animals received a booster of rCMX/CPG DNA, 30 days after rBCG-CMX vaccination and
challenged with Mtb 30 days post the immunization (rBCG-CMX+CMX). Forty-five days
after challenge, mice were euthanized and the anterior and mediastinal right lung lobes
were collected, homogenized, and plated on Middlebrook 7H11agar supplemented with
OADC to determine the bacterial load by counting the number of CFU. *Significant
differences between infected (control) and vaccinated groups. #Significant differences
between rBCG-CMX and rBCG-CMX+CMX groups. ★Significant differences between
rBCG-CMX+CMX and BCG groups analyzed by t test (p<0.05).
doi:10.1371/journal.pone.0112848.g008
68
5. The immune response induced by the rBCG-CMX vaccine reduces TB
pulmonary lesions
Lung architecture preservation is yet another important aspect of a successful
vaccine against TB. Histological analysis of the lungs of vaccinated mice challenged with
Mtb showed that 45 days after challenge, unimmunized mice had intensive lymphocytic
and neutrophilic infiltrates, significantly compromising the lung tissue architecture,
together with the presence of a few hemorrhagic foci and foamy macrophages (Fig. 9A).
BCG-vaccinated mice, instead, showed significantly fewer lung lesions, with a
preservation of alveolar spaces and very limited lymphocytic infiltrate foci (Fig. 9B).
The recombinant vaccine greatly preserved the lung architecture, showing very few
inflammatory infiltrates (Fig. 9C). Similar results were obtained for animals immunized
with rBCG-CMX and boosted with rCMX (Data not shown). The differences in
inflammatory responses upon Mtb challenge between all three groups are summarized in
the scores of their lung lesions, which are presented in Figure 9D.
69
Figure 9. Representative lung pathology of Balb/c mice after challenge. Vaccinated
mice were challenged i.v. with 105 CFU of virulent M. tuberculosis H37Rv strain. Forty-
five days after infection, lung tissue sections from different vaccine groups were harvested.
Images are representative of two distinct experiments. HE staining is shown with 20X
magnification. (A) Unvaccinated group. Black arrowheads: Foamy macrophages. (B) BCG-
vaccinated group. (C) rBCG-CMX vaccinated group. (D) Histological score of the lesion
area from three representative fields obtained by AxioVision 4.9.1 software, through ratio
of lesioned and total field area. Data are presented as percentages (%).
doi:10.1371/journal.pone.0112848.g009
70
Discussion
In this study, a recombinant vaccine expressing the fusion protein CMX (rBCG-
CMX) was used to immunize BALB/c mice and was shown to be efficient in protecting
mice against Mtb challenge. The recombinant vaccine induced higher levels of CD4+IFN-y+
and CD4+IL-17+ T cells, as well as higher levels of CD4+TNF-α+IFN-y+ and CD4+IL-
2+IFN-y+ polyfunctional T lymphocytes specific for CMX in BALB/c mice.
During the attenuation process of BCG, some antigens important for the induction of
a protective immune response were lost [38]. This is thought to be one reason that BCG
does not provide long lasting protection in humans. In the pursuit of a new TB vaccine,
several groups have tried to insert heterologous genes into BCG and in doing so many
different expression systems have been tested [35]. Our approach was to test three different
plasmid constructions to express the fusion protein CMX. Of the systems we tested, only
the one that expressed the recombinant fusion protein together with the signal peptide b-
lactamase (pLA71) was successful and stable in vivo. Other antigens have been expressed
with the same three plasmids used in this study, but with different results. For example, the
Schistosoma mansoni antigen Sm14 [34] and the pertussis toxin subunit S1 [39] were only
successfully expressed in plasmid pLA73, which expresses the recombinant gene with the
entire b-lactamase protein.
Macrophages infected with wild type BCG or rBCG produced similar amounts of
NO. In the murine model, the production of NO has been shown to be critical for the
control of mycobacterial growth [40]. Although NO production helps to control the
progression of infection, its effects are concentration dependent. In low doses, NO acts as a
signaling molecule to promote vascular integrity, mediate neurotransmission, and help
regulate cellular respiration. In high concentrations, NO inhibits respiration and can cause
protein and DNA damage [41–42]. In M. bovis BCG, NO seems to limit inflammatory
responses, in part by down- regulating the accumulation of activated T cells [43]. We found
that a significant amount of rBCG-CMX was phagocytosed, and that it can reside and
survive within the macrophages (Fig. 3). Our data show that rBCG-CMX was phagocytosed
in higher amounts than BCG Moreau (Figs. 3A and B). However, the induction of NO by
71
the recombinant vaccine was similar to that induced by BCG Moreau. These data suggest
that our recombinant vaccine is viable, since it has not lost its ability to induce an immune
response.
After finding that rBCG-CMX was efficiently phagocytosed, we anticipated that
antigen processing and presentation to naive T lymphocytes in vivo would be favored, and
data from our next experiment support this idea. In cells from the lungs and spleen of
rBCG-CMX vaccinated mice, stimulation with CMX induced high levels of T cells that
were CD4+IFN-y+ (Figs. 4B and C). The importance of IFN-y in protection against TB is
well established, as it induces an increase in phagocytosis and Mtb destruction,
consequently reducing the bacterial load [44]. In spite of this, there is controversy about the
role of IFN-y in vaccine models. In high concentrations, IFN-y induces apoptosis of CD4+
effector T lymphocytes, lowering the potential to generate memory cells [11].
Th17 cells are thought to be responsible for TB protection, as they have an early
memory cell signature [45]. Our recombinant vaccine was shown to induce CMX-specific
CD4+IL-17+ T cells in the spleen and lungs (Figs. 4D and E). The expression of CMX by
Mycobacterium smegmatis (mc2-CMX) was also shown to induce high levels of CD4+IL-
17+ T lymphocytes in the spleen and lungs [33] that directly correlated to protection. The
importance of Th17 in vaccine models and in TB is controversial, but it is known that in
chronic infections, such as TB, constitutive or late IL-17 production is related to the degree
of interstitial inflammatory involvement and tissue lesion [46]. Instead, when produced
early as is the case for vaccination, IL-17 is important for the induction of protective
memory cells for TB [47,45].
Our vaccine, rBCG-CMX, induced Th1 and Th17 immune responses that were
specific to CMX. Furthermore, we demonstrated that this recombinant vaccine induced Th1
and Th17 immune responses to each of the CMX component proteins, rAg85, rMPT51, and
rHspX, alone (Figs. 5A and C; Figs. 6A and C). The induction of immune responses to
these proteins suggests that the construction of the CMX protein retained the
immunodominant characteristics of its components. It is important to note that the use of
recombinant BCG vaccines described in the literature, most of the times did not test the
specific immune response to the heterologous antigens [48–49]. Most studies only
72
evaluated the specific response to PPD (Purified Protein derivative) as a stimulus, and here
we showed that an immune response was generated to the heterologous protein [49].
It has already been shown that rBCG expressing HspX or Ag85 complex proteins
(Ag85A, Ag85B, Ag85C) induce superior protection to wild type BCG [50–52].
Interestingly, we found a pronounced response to stimulation with MPT51. This protein
belongs to new family of non-catalytic alfa/beta hydrolases (Fbpc1) which act in binding
the fibronectin extracellular matrix [53]. As demonstrated by another study, MPT51
effectively induces Th1 immune responses, promoting protection in mice challenged with
Mtb [54]. The characteristics of these proteins were retained in CMX, which contributed to
the ability of rBCG-CMX to promote important immune responses and protection.
In spleen and lung cells from mice immunized with the BCG vaccine, stimulation
with rAg85 and rMPT51 induced a Th1 response, but not stimulation with HspX or CMX
(Figs. 5A and B). This may be related to the poor ability of BCG to induce specific
responses to certain proteins, such as HspX which is expressed in low levels by BCG
[55,50,56]. Interestingly, despite containing the same original proteins as those composing
the CMX protein, immunization with BCG Moreau did not induce a specific response
against CMX. Additionally, BCG was not able to induce a Th17 immune response to any of
the component recombinant proteins (Figs. 6A and B). Although it has previously been
shown that Th17 responses generated by BCG vaccination induce TB infection control in
non-human primates [47], we did not observe similar results with our recombinant proteins.
We found an increased number of CD4+ polyfunctional T cells among mice
immunized with rBCG-CMX relative to the number in those who received the BCG
Moreau vaccine. The recombinant vaccine induced high levels of polyfunctional T cells
expressing both IL-2 and IFN-y (Figs. 7A and B) and high levels of these cells expressing
both TNF-α and IFN-y (Figs. 7C and D). It has been demonstrated that polyfunctional cells
are important for protection against intracellular bacteria, as well as viral, parasitic, and
chronic bacterial infections, such as TB [57,37]. Additionally, it has been shown that
polyfunctional cells are involved in providing protection against TB [37]. Consequently, we
believe that the cellular profile induced by rBCG-CMX is likely the result of our addition of
CMX to BCG [32].
73
The ability of rBCG-CMX to induce protection against Mtb challenge showed a
tendency to improve the protection conferred by BCG Moreau. Vaccination with rBCG-
CMX significantly reduced the lung bacterial load of BALB/c mice (Fig. 8). Because the
only difference between the vaccines were the presence of CMX, we decided to address if
using a booster with rCMX would increase the immune response to CMX, and
consequently the protection to Mtb. The improved protection observed (rBCG-CMX +
rCMX) must be due to the extra presence of the recombinant fusion protein CMX, as only
the recombinant vaccine induced a significant increase in the proliferation and migration of
specific CD4+ T cells in the spleen and lungs (Figs. 4 and 5) of immunized mice. Like in
here, not all recombinant BCG vaccines expressing fusion proteins that have been tested
were able to induce superior protection when compared with BCG [58]. Thus we believe
that the recombinant CMX protein, composed of Mtb immunodominant antigens (Ag85C,
MPT-51, and HspX) that relate to different infection phases, added significant
immunogenic properties to BCG which were crucial to the observed protection. This is the
first study using limited number of animals (3–6) to demonstrate the efficacy of the fusion
protein CMX. We are now setting up collaborations to test the CMX in a more appropriate
guinea pig model. Other studies from our group have characterized those properties by
investigating rCMX in the context of M. smegmatis mc2 155 (mc2-CMX). Additionally, we
observed this phenomenon with the IKE vaccine (IKE-CMX), which also induced a
significant reduction in bacterial load in comparison to vaccination with IKE lacking the
recombinant antigen [33]. Taken together, the data demonstrate that CMX can play an
important role in the enhancement of protective immune responses induced by vaccines
against Mtb [32–33].
Achieving the correct balance between the induction of Th1 and Th17 cells is an
important goal for an effective vaccine against Mtb. While the induced IFN-y will act on
the activation of infected cells, IL-17 will regulate the resulting inflammatory response by
inducing protective cells [49]. As shown in Figure 9, the lungs of mice vaccinated with
rBCG-CMX had a larger preserved area of the lungs compared to the lungs of BCG Moreau
immunized mice. In addition the group receiving the recombinant vaccine showed little
inflammatory infiltration and very few necrotic foci and coalescent alveoli, all of which are
known for being favorable areas for bacilli replication [59–60]. The reduced bacterial load
74
of the lungs found in rBCG-CMX challenged mice corroborates those observations (Fig. 8).
In addition, no foamy macrophages were found in the lungs of mice vaccinated with the
recombinant vaccine (Fig. 9), which is important as those cells are known to be bacilli
reservoirs [61–62].
In conclusion, the addition of the recombinant fusion protein CMX to BCG Moreau
generated a recombinant vaccine with superior immunological properties. This vaccine
induced a balanced IFN-y and IL17 cytokine response from CD4+ T cells and was able to
protect mice from Mtb.
75
Supporting Information
Figure S1. CMX expression analysis from rBCG transformed with recombinant
plasmids pLA73/CMX and pMIP12/CMX. Western blot analysis of whole cell lysates
from rBCG transformants using polyclonal antibodies raised against rCMX. (A) rBCG
containing pLA73/CMX or empty vector. M: molecular mass marker; CMX: purified
recombinant CMX; pLA73/CMX: rBCG with plasmid pLA73/CMX; pLA73: rBCG with
plasmid pLA73. (B) rBCG containing pMIP12/CMX or empty vector. M: molecular mass
marker; CMX: purified recombinant CMX; pMIP12/CMX: rBCG with plasmid
pMIP12/CMX; pMIP12: rBCG with plasmid pMIP12.
doi:10.1371/journal.pone.0112848.s001. (TIF)
76
Figure S2. Representative dot plots of TCD4+IFN-γ+ and TCD4+IL-17+ cells. Splenic
cells from non-immunized mice (Control) or mice immunized with BCG or with rBCG-
CMX were stimulated with medium or one of the following recombinant proteins: rAg85,
rMPT51, rHspX or rCMX. Lymphocytes were selected based on their size and granulocity
77
and antigen specific TCD4+IFN-γ+ (A) and TCD4+IL-17+ (B) cells were analyzed based on
their fluorescence. doi:10.1371/journal.pone.0112848.s002. (TIF)
Acknowledgments
We are thankful to Associação de Combate ao Câncer de Goiás and Universidade de
Brasília (UnB) for allowing access to their flow cytometry core facilities, to Dr. Aline
Carvalho Batista, from Faculdade de Odontologia – UFG, for collaborating in the
processing and analysis of histological preparations, and to Drs. Alexander Augusto da
Silveira and Lorena Cristina Santos for technical assistance in constructing the recombinant
vaccines.
Author Contributions
Conceived and designed the experiments: APJK AK. Performed the experiments: APJK
AK ACC AOCJ FMO SVN JDR DPR. Analyzed the data: APJK AK ACC AOCJ FMO
SVN JDR DPR. Contributed reagents/materials/analysis tools: APJK AK. Contributed to
the writing of the manuscript: APJK AK ACC AOCJ FMO SVN JDR DPR. Cytometry
experiments and analysis: ACC.
78
References
1. World Health Organization (WHO) (2013) Global tuberculosis control–epidemiology,
strategy, financing.
2. Kamath AT, Fruth U, Brennan MJ, Dobbelaer R, Hubrechts P, et al. (2005) New live
mycobacterial vaccines: the Geneva consensus on essential steps towards clinical
development. Vaccine 23: 3753–3761.
3. Calmette A (1929) Sur la vaccination preventive des enfants nouveau-nes contre
tuberculose par le BCG. Ann Inst Pasteur 41: 201–232.
4. World Health Organization (WHO) (1998) Global tuberculosis control.
5. Partnership WST (2010) The Global Plan to Stop TB 2011–2015: Transforming the
Fight- Towards Elimination of Tuberculosis.
6. Lienhardt C, Zumla A (2005) BCG: the story continues. Lancet 366: 1414–1416.
7. Behr MA, Small PM (1997) Has BCG attenuated to impotence? Nature 389: 133–134.
8. Zhang W, Zhang Y, Zheng H, Pan Y, Liu H, et al. (2013) Genome sequencing and
analysis of BCG vaccine strains. PLoS One 8: e71243.
9. Soares AP, Scriba TJ, Joseph S, Harbacheuski R, Murray RA, et al. (2008) Bacille
Calmette–Guérin vaccination of human newborns induces T cells with complex cytokine
and phenotype profiles. J Immunol 180: 3569–77.
10. Stenger S, Hansen DA, Teitelbaum R, Dewan P, Niazi KR, et al. (1998) An
antimicrobial activity of cytolytic T cells mediated by granulysin. Science 282: 121–5.
11. Abebe F (2012) Is interferon-gamma the right marker for bacilli Calmette- Guérin-
induced immune protection? The missing link in our understanding of tuberculosis
immunology. Clin Exp Immunol 169: 213–219.
12. Mittrucker HW, Stenhoof U, Kohler A, Krause M, Lazar D, et al. (2007) Poor
correlation between BCG vaccination-induced T cell response and protection against
tuberculosis. Proc Natl Acad A Sci USA 104: 12434–124.
13. Junqueira-Kipnis AP, Marques Neto LM, Kipnis A (2014) Role of Fused
Mycobacterium tuberculosis Immunogens and Adjuvants in Modern Tuberculosis
Vaccines. Front Immunol 5: 188.
79
14. Kaufmann SH, Lange C, Rao M, Balaji KN, Lotze M, et al. (2014) Progress in
tuberculosis vaccine development and host- directed therapies – a state of the art review.
Lancet Respir Med 4: 301–321.
15. Hoft DF, Blazevic A, Abate G, Hanekom WA, Kaplan G, et al. (2008) A new
recombinant bacille Calmette-Guérin vaccine safely induces significantly enhanced
tuberculosis-specific immunity in human volunteers. J Infect Dis 198: 1491–1501.
16. Deng YH, He HY, Zhang BS (2012) Evaluation of protective efficacy conferred by a
recombinant Mycobacterium bovis BCG expressing a fusion protein of Ag85A-ESAT-6. J
Microbiol Immunol Infect 25: S1684–1182.
17. Tang C, Yamada H, Shibata K, Maeda N, Yoshida S, et al. (2008) Efficacy of
Recombinant Bacille Calmette-Guérin Vaccine Secreting Interleukin-15/ Antigen 85B
Fusion Protein in Providing Protection against Mycobacterium tuberculosis. J Infect Dis
197: 1263–1274.
18. Farinacci M, Weber S, Kaufmann SH (2012) The recombinant tuberculosis vaccine
rBCGDureC::hly+ induces apoptotic vesicles for improved priming of CD4+ and CD8+ T
cells. Vaccine 30: 7608–7614.
19. da_Costa AC, Nogueira SV, Kipnis A, Junqueira-Kipnis AP (2014) Recombinant
BCG: innovations on an old vaccine. Scope of BCG strains and strategies to improve
long-lasting memory. Front Immunol 5: 152.
20. Lin CW, Su IJ, Chang JR, Chen YY, Lu JJ, et al. (2011). Recombinant BCG
coexpressing Ag85B, CFP10, and interleukin-12 induces multifunctional Th1 and memory
T cells in mice. APMIS 120: 72–82.
21. Gomes LH, Otto TD, Vasconcellos EA, Ferrão PM, Maia RM, et al. (2011) Genome
sequence of Mycobacterium bovis BCG Moreau, the Brazilian vaccine strain against
tuberculosis. J Bacteriol 193: 5600–1.
22. Berrêdo-Pinho M, Kalume DE, Correa PR, Gomes LH, Pereira MP, et al. (2011)
Proteomic profile of culture filtrate from the Brazilian vaccine strain Mycobacterium
bovis BCG Moreau compared to M. bovis BCG Pasteur. BMC Microbiol 11: 80.
23. Nascimento IP, Dias WO, Quintilio W, Hsu T, Jacobs WR Jr, et al. (2009)
Construction of an unmarked recombinant BCG expressing a pertussis antigen by
80
auxotrophic complementation: protection against Bordetella pertussis challenge in
neonates. Vaccine 27: 7346–51.
24. Andrade PM, Chade DC, Borra RC, Nascimento IP, Villanova Fe, et al. (2010) The
therapeutic potential of recombinant BCG expressing the antigen S1PT in the intravesical
treatment of bladder cancer. Urol Oncol 28: 520–525.
25. Vasconcellos HL, Scaramuzzi K, Nascimento IP, Da Costa Ferreira JM Jr, Abe CM,
et al. (2012) Generation of recombinant bacillus Calmette-Guérin and Mycobacterium
smegmatis expressing BfpA and intimin as vaccine vectors against enteropathogenic
Escherichia coli. Vaccine 30: 5999–6005.
26. Clark SO, Kelly DL, Badell E, Castello-Branco LR, Aldwell F, et al. (2010) Oral
delivery of BCG Moreau Rio de Janeiro gives equivalent protection against tuberculosis
but with reduced pathology compared to parenteral BCG Danish vaccination. Vaccine
28(43): 7109–16.
27. Yuk JM, Jo EK (2014) Host immune responses to mycobacterial antigens and their
implications for the development of a vaccine to control tuberculosis. Clin Exp Vaccine
Res 3: 155–167.
28. Achkar JM, Jenny-Avital E, Yu X, Burger S, Leibert E, et al. (2010) Antibodies
against immunodominant antigens of Mycobacterium tuberculosis in subjects with
suspected tuberculosis in the United States compared by HIV status. Clin Vaccine
Immunol 17: 384–392.
29. Rabahi MF, Junqueira-Kipnis AP, Dos Reis MC, Oelemann W, Conde MB (2007)
Humoral response to HspX and GlcB to previous and recent infection by Mycobacterium
tuberculosis. BMC Infect Dis 7: 148.
30. de Araujo-Filho JA, Vasconcelos AC Jr, Martins de Sousa E, Kipnis A, Ribeiro E, et
al. (2008) Cellular responses to MPT-51, GlcB and ESAT-6 among MDR-TB and active
tuberculosis patients in Brazil. Tuberculosis 88: 474–481. doi:10.1016/j.tube.2008.06.002.
31. Kashyap RS, Shekhawat SD, Nayak AR, Purohit HJ, Taori GM, et al. (2013)
Diagnosis of tuberculosis infection based on synthetic peptides from Mycobacterium
tuberculosis antigen 85 complex. Clin Neurol Neurosurg 115: 678–683.
32. de Sousa EM, da Costa AC, Trentini MM, de Araujo Filho JA, Kipnis A, et al. (2012)
Immunogenicity of a fusion protein containing immunodominant epitopes of Ag85C,
81
MPT51, and HspX from Mycobacterium tuberculosis in mice and active TB infection.
PLoS One 7: e47781.
33. Junqueira-Kipnis AP, de Oliveira FM, Trentini MM, Tiwari S, Chen B, et al. (2013)
Prime-Boost with Mycobacterium smegmatis Recombinant Vaccine Improves Protection
in Mice Infected with Mycobacterium tuberculosis. PLoS One 8: e78639.
34. Varaldo PB, Leite LCC, Dias WO, Miyaji EN, Torres FIG, et al. (2004) Recombinant
Mycobacterium bovis BCG Expressing the Sm14 Antigen of Schistosoma mansoni
Protects Mice from Cercarial Challenge. Infect Immun 72: 3336–3343.
35. Bastos RG, Borsuk S, Seixas FK, Dellagostin OA (2009) Recombinant
Mycobacterium bovis BCG. Vaccine 27: 6495–6503.
36. Jagannath C, Lindsey DR, Dhandayuthapani S, Xu Y, Hunter RL Jr, et al. (2011)
Autophagy enhances the efficacy of BCG vaccine by increasing peptide presentation in
mouse dendritic cells. Nat Med 15: 267–276.
37. Forbes EK, Sander C, Ronan EO, McShane H, Hill AV, et al. (2008) Multifunctional,
High-level cytokine-producing Th1 cells in the lung, but not spleen, correlate with
protection against Mycobacterium tuberculosis aerosol challeng in mice.J Immunol 181:
4955–64.
38. Brosch R, Gordon SV, Pym A, Eiglmeier K, Garnier T, et al. (2000) Comparative
genomics of the mycobacteria. Int J Med Microbiol. 290: 143–152.
39. Nascimento IP, Dias WO, Mazzantini RP, Miyaji EN, Gamberini M, et al. (2000)
Recombinant Mycobacterium bovis BCG expressing pertussis toxin subunit S1 induces
protection against an intracerebral challenge with live Bordetella pertussis in mice. Infect
Immun 68: 4877–4883.
40. Chan J, Xing Y, Magliozzo RS, Bloom BR (1992) Killing of virulent Mycobacterium
tuberculosis by reactive nitrogen intermediates produced by activates murine
macrophages. J Exp Med 175: 1111–1122.
41. Xu W, Charles IG, Moncada S (2005) Nitric Oxide: orchestrating hypoxia regulation
through mitochondrial respiration and the endoplasmic reticulum stress response. Cell Res
15: 63–65.
82
42. Pearl JE, Torrado E, Tighe M, Fountain JJ, Solache A, et al. (2012) Nitric oxide
inhibits the accumulation of CD4+CD44hiTbet+CD69lo T cells in mycobacterial infection.
Eur J Immunol 42: 3267–3279.
43. Cooper AM, Adams LB, Dalton DK, Appelberg R, Ehlers S (2002) IFN-y and NO in
mycobacterial disease: new jobs for hands. Trends Microbiol 10: 221–226.
44. North RJ, Jung YJ (2004) Immunity to tuberculosis. Annu Rev Immunol 22: 599–623.
45. Muranski P, Borman ZA, Kerkar SP, Klebanoff CA, Ji Y, et al. (2011) Th17
Cells Are Long Lived and Retain a Stem Cell-like Molecular Signature. Immunity 35:
972–985.
46. Cruz A, Fraga AG, Fountains JJ, Rangel-Moreno J, Torrado E, et al. (2010)
Pathological role of interleukin 17 in mice subjected to repeated BCG vaccination after
infection with Mycobacterium tuberculosis. J Exp Med 207: 1609–1616.
47. Wareham AS, Tree JA, Marsh PD, Butcher PD, Dennis M, et al. (2014) Evidence for a
role for interleukin-17, Th17 cells and homeostasis in protective immunity against
tuberculosis in cynomolgus macaques. PloS One 9: e88149.
48. Tullius MV, Harth G, Maslesa-Galic S, Dillon BJ, Horwitz MA (2008) A replication-
limited recombinant Mycobacterium bovis BCG vaccine against tuberculosis designed for
human immuno deficiency virus-positive persons is safer and more efficacious than BCG.
Infect Immun 76: 5200–14.
49. Desel C, Dorhoi A, Bandermann S, Grode L, Eisele B, et al. (2011) Recombinant
BCGΔureC::hly Induces Superior Protection over Parental BCG by Stimulating a
Balanced Combination of Type 1 and Type 17 Cytokine Responses. J Infect Dis 204:
1573–1584.
50. Shi C, Chen L, Chen Z, Zhang Y, Zhou Z, et al. (2010) Enhanced protection against
tuberculosis by vaccination with recombinant BCG over-expressing HspX protein.
Vaccine 28: 5237–5244.
51. Wang C, Fu R, Chen Z, Tan K, Chen L, et al. (2012) Immunogenicity and protective
efficacy of a novel recombinant BCG strain over expressing antigens Ag85A e Ag85B.
Clin. Dev. Immunol. 2012: 1–9.
83
52. Jain R, Dey B, Dhar N, Rao V, Singh R, et al. (2008) Enhanced and enduring
protection against tuberculosis by recombinant BCG-Ag85C and its association with
modulation of cytokine profile in lung. PLoS One 3: e3869.
53. Wilson RA, Maughan WN, Kremer L, Besra GS, Futterer K (2004) The structure of
Mycobacterium tuberculosis MPT51 (FbpC1) defines a new family of non-catalytic
alpha/beta hydrolases. J Mol Biol 9: 519–530.
54. Silva BD, da Silva EB, do Nascimento IP, Dos Reis MC, Kipnis A, et al. (2009) MPT-
51/CpG DNA vaccine protects mice against Mycobacterium tuberculosis. Vaccine 27:
4402–4407.
55. Geluk A, Lin MY, van Meijgaarden KE, Leyten EM, Franken KL, et al. (2007) T-cell
recognition of the HspX protein of Mycobacterium tuberculosis correlates with latent M.
tuberculosis infection but not with M. bovis BCG vaccination. Infect Immun 75: 2914–
2921.
56. Spratt JM, Britton WJ, Triccas JA (2010) In vivo persistence and protective efficacy
of the bacille Calmette Guerin vaccine overexpressing the HspX latency antigen. Bioeng
Bugs 1: 61–65.
57. Maroof A, Yorgensen YM, Li Y, Evans JT (2014) Intranasal vaccination promotes
detrimental Th17-mediated immunity against influenza infection. PLoS Pathog 10:
e1003875.
58. Deng YH, He HY, Zang BS (2014) Evaluation of protective efficacy conferred by a
recombinant Mycobacterium bovis BCG expressing a fusion protein Of Ag85A-ESAT-6. J
Microbiol Immunol Infect 47: 48–56.
59. Ulrichs T, Kosmiadi GA, Jorg S, Pradl L, Titukhina M, et al. (2005) Differential
organization of the local immune response in patients with active cavitary tuberculosis
or with nonprogressive tuberculoma. J Infect Dis192: 89–97.
60. Lenaerts AJ, Hoff D, Aly S, Ehlers S, Andries K, et al. (2007) Mycobacteria in a
guinea pig model of tuberculosis revealed by r207910. Antimicrob Agents Chemother
51: 3338–3345.
61. Russell DG, Cardona PJ, Kim MJ, Allain S, Altare F (2009) Foamy macrophages and
the progression of the human tuberculous granuloma. Nature Immunol 10: 943–948.
62. Huynh KK, Joshi SA, Brown EJ (2011) A delicate dance: host response to
mycobacteria. Current Opinion in Immunology 23: 464–472.
84
Manuscrito
Modulation of the immune response induced by the recombinant fusion protein
CMX involves IL-6 and TGF-β production and TLR-4 stimulation
Adeliane Castro da Costa1, Danilo Pires de Resende1, Bruno de Paula Oliveira Santos1,
Karina Furlani Zoccal2, Lúcia Helena Faccioli2, André Kipnis1,3 and Ana Paula
Junqueira-Kipnis1,3*
1. Laboratório de Imunopatologia das Doenças Infecciosas, Instituto de
Patologia Tropical e Saúde Pública, Universidade Federal de Goiás, Goiânia,
Goiás, Brazil.
2. Laboratório de Inflamação e Imunologia das Parasitoses, Departamento de
Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências
Farmacêuticas de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto,
Brazil
3. Laboratório de Bacteriologia Molecular, Instituto de Patologia Tropical e
Saúde Pública, Universidade Federal de Goiás, Goiânia, Goiás, Brazil.
*Corresponding address: Rua 235 esquina com Primeira Avenida, S/N.
Laboratório de Imunopatologia das Doenças Infecciosas, sala 325. Instituto de
Patologia Tropical e Saúde Pública. Universidade Federal de Goiás. Setor
Universitário, Goiânia- Goiás, Brazil. CEP 74605-050. Phone: +55 62
32096174; Fax: +55 62 32096363; E-mail: [email protected].
85
Abstract
Tuberculosis (TB) is an infectious disease that can be prevented by the application of
the Mycobacterium bovis Bacillus Calmette–Guérin (BCG) vaccine. Due to the low
protection offered by this vaccine in adults, new, more effective formulations have been
developed with better potential for Th1 and Th17 response induction. A recombinant
BCG vaccine expressing the CMX fusion protein (rBCG-CMX) induced Th1 and Th17
responses and provided better protection than BCG. The aim of the present study was to
evaluate the innate immune response that promotes the induction of Th17 responses by
rBCG-CMX and that differentiates this formulation from the BCG vaccine. BALB/c
mice were intranasally infected with the BCG and rBCG-CMX vaccines, and after 4
days, flow cytometry of lung macrophages and ex vivo testing to determine IL-6, IL-1α
and TGF- levels were performed. RAW 264 and BMM cells as well as peritoneal and
alveolar macrophages from C57BL/6, BALB/c, TLR-2-/- and TLR-4-/- mice were also
used for in vitro tests. Compared to the BCG vaccine, the rBCG-CMX vaccine induced
more migration of F4/80+CD11bhigh macrophages to the lung. Pulmonary macrophages
from both groups expressed CD86 and CD206 and induced IL-1α and TGF-β. BMM
infected with rBCG-CMX underwent apoptosis and necrosis, whereas those infected
with BCG underwent necrosis. In addition, macrophages infected with rBCG-CMX
expressed more major histocompatibility complex class II (MHC-II) molecules. The
recombinant CMX (rCMX) protein activated the transcription factor NF-κB,
culminating in the production of IL-6, IL-1α and TGF-β in the BMM and peritoneal
and alveolar macrophages of BALB/c and C57BL/6 mice. Upon stimulation of the
BMM of TLR-2-/- and TLR-4-/- mice, we found that this activation is dependent on
TLR-4. We concluded that both the rBCG-CMX vaccine and the rCMX recombinant
fusion protein are capable of modulating and activating the innate immune response in a
TLR-4–dependent manner.
86
Introduction
Mycobacterium tuberculosis (Mtb) is an intracellular pathogen that interacts with
macrophages and dendritic cells via receptors such as toll-like receptors (TLRs),
complement receptors (CR) and mannose receptors (CD206) [1-6]. Macrophages are
important innate immunity components in tuberculosis (TB) because they directly
participate in the response to this microorganism [7]. When recognized by phagocytes
through TLRs, Mtb induces the production of TNF-, IL-6, IL-12, IL-23 and IL-1α,
which contribute to the differentiation of Th1, Th17 and other lymphocytes, as well as
to the self-renewal processes of alveolar macrophages [8-12, 4, 13, 14]. Some Mtb
proteins, such as ESAT-6, PPE57, Ag85c and Rv0652, are recognized by TLR-2, CR3
and TLR-4, modulating macrophage responses [15, 2, 6]. ESAT-6, for example, has
been shown to modulate macrophages and dendritic cells in vitro, producing cytokines
that inhibit Th1 responses and that facilitate Th17 responses [16]. However, vaccine
models have attempted to find antigens capable of inducing a balance between Th1 and
Th17 cells, as it is postulated that a balance must exist between these cell populations to
control Mtb infection during development of the granuloma [17]. For this reason, it is of
the utmost importance to develop new vaccines using proteins that promote this
balanced response.
The BCG (Bacillus Calmette-Guérin) vaccine, which is the current vaccine used
to control TB, is believed to induce a strong Th1 response but a much lower Th17
response [18] . BCG is an attenuated strain of Mycobacterium bovis, which, during the
attenuation process, lost important virulence regions [19]. Despite being the only
vaccine approved for human use and providing protection against TB meningitis and
miliary TB in children, the protective effect of BCG remains questionable, as it does not
protect adults against pulmonary TB [20-22]. This lack of protection in the adult phase
may be due to its poor ability to induce a good vaccine response, with a balance
between Th1 and Th17 responses [23]. It has been demonstrated that the induction of
vaccine responses in mucosa may promote the induction of Th17 because mucosal
macrophages have an anti-inflammatory profile, with the ability to produce both TGF-β
and IL-6 [24]. Another mechanism that may promote the induction of Th17 is the
induction of apoptosis. The induction of cell death by apoptosis in macrophages can
promote the release of apoptotic bodies that induce the cross-presentation of vaccine
peptides by major histocompatibility complex class I (MHC-I) and class II (MHC-II)
87
molecules by dendritic cells, promoting the induction of mixed TCD4+, TCD8+ and
Th17 responses. These responses have been demonstrated by some vaccines that have
shown superior protection to that induced by BCG [23].
The BCG expressing the CMX fusion protein (rBCG-CMX) vaccine and the
mc2-CMX vaccine have been able to induce Th1 responses and potentiate the induction
of Th17, thereby promoting an equilibrium in the induction of these cellular responses.
Regardless of the vehicle used, whether BCG or Mycobacterium smegmatis, vaccines
expressing the recombinant CMX protein (rCMX) have contributed to protection
against Mtb. Moreover, when used in another vector, IKE-CMX, rCMX has been able
to activate more macrophages than the vector alone [25, 26]. Thus, macrophages appear
to be involved in the protection conferred by the vaccine, indicating that rCMX may be
modulating the innate immune response and promoting the vaccine immune response.
The rCMX fusion protein is composed of immunodominant epitopes of the
antigens rAg85c, rMPT51 and full-length rHspX [27]. Ag85c (Rv0129c) and MPT51
(Rv3803c) are part of the same complex and are important virulence factors [28].
Ag85C, for example, participates in the synthesis of mycolic acid, a component of the
Mtb cell wall, which represents more than 40% of the dry weight of Mtb [29-31]. The
HspX antigen (Rv2031c) is a protein that promotes the growth of Mtb within
macrophages [32-34].
Based on this evidence, the aim of the present study is to evaluate whether the
rCMX protein acts on macrophages to promote the vaccine immune response. The
results demonstrate that the rCMX protein, when expressed by BCG (rBCG-CMX),
induces the activation of pulmonary and alveolar macrophages, with an increase in the
expression of activation molecules, as well as the induction of apoptosis and increased
MHC-II expression. The interaction of rCMX activates the transcription factor NF-κB
and induces the production of the cytokines TGF- and IL-6 via TLR-4.
88
Material and Methods
Animals
Specific pathogen-free BALB/c and C57BL/6 mice were obtained from the Tropical
Institute of Pathology and Public Health, Federal University of Goiás (Universidade
Federal de Goiás – UFG). TLR-4 and TLR-2 mice (KO or -/-) from the School of
Pharmacy, Federal University of São Paulo (Universidade Federal de São Paulo – USP),
4-8 weeks old, were donated by S. Akira (Osaka University, Osaka, Japan). The animals
were kept at a constant temperature (24 ± 1°C) and humidity (50% ± 5%) in isolators
with HEPA filters during all experimental procedures. The animals were fed a sterile
diet specific to mice and were provided water ad libitum under controlled light
conditions (12-h light and dark period). Animals were monitored daily, and none of the
mice exhibited any symptoms of clinical disease, as assessed by the attending
veterinarian. Euthanasia was performed by cervical dislocation by a trained researcher.
The animals were handled according to the guidelines of the Brazilian Scientific Society
for the Use of Laboratory Animals (Sociedade Brasileira de Ciência em Animais de
Laboratório - SBCAL/COBEA). The study was approved by the Ethics Committee for
Animal Use (Comitê de Ética no Uso de Animais - CEUA; #229/11) of the UFG.
Antigens and vaccines
The recombinant antigens of Mycobacterium tuberculosis, rAg85c, rMPT51, rHspX and
rCMX, were produced in Escherichia coli in the Immunopathology and Infectious
Diseases Laboratory at the Institute of Tropical Pathology and Public Health (Instituto
de Patologia Tropical e Saúde Pública - IPTSP), UFG. All antigens were prepared as
previously described by de Souza et al. (2012) [27]. After purification of the rAg85c,
rMPT51, rHspX and rCMX proteins, they were subjected to an LPS-removal process
using a ToxinEraserTM Endotoxin Removal Kit. The procedure was performed
according to the manufacturer's instructions (GenScript - 860 Centennial Ave.,
Piscataway, NJ 08854, USA).
The strain of M. bovis BCG-Moreau, kindly donated by the Butantan Institute (Becton
and Dickinson, Le Pont de Claix-France), was grown in 7H9 liquid culture medium
supplemented with 10% oleic acid, dextrose and catalase (OADC), 0.5% glycerol and
0.05% Tween 80 and incubated at 37°C in a humidified atmosphere with 5% CO2 for
89
approximately 21 days. The rBCG strains were obtained via electroporation of the
BCG-Moreau strain with the pLA71 expression plasmid as described previously [25].
Intranasal infection of BALB/c mice with BCG Moreau or rBCG-CMX
The BALB/c mice were divided into three groups: Control, BCG Moreau and rBCG-
CMX. Aliquots of the rBCG-CMX and BCG Moreau vaccines were removed from the -
80°C freezer and diluted in 0.05% PBS Tween 80 at a concentration of 1x108 CFU/mL.
A volume of 100 μL of the vaccine was intranasally administered, with small doses of
20 μL given at a time, allowing the animal to breathe between doses, until 100 μL of
vaccine had been administered. The saline group received 100 μL of PBS/0.05%
Tween-80. The immunizations were performed in a single dose. After preparation of the
vaccines, a sample was plated to confirm the concentration. After immunization, the
animals were observed for 3 h to check for signs of apathy, wheezing or any change in
behavior that showed extreme discomfort. If an animal produced signs and symptoms
that were incompatible with animal welfare, then a trained veterinarian proceeded to
humanely euthanize the animal. No animals presented such symptoms during the
experiment.
Macrophages
Peritoneal and alveolar macrophages were obtained by peritoneal or bronchial alveolar
lavage [25, 35]. The alveolar lavages were centrifuged at 1000 x g and 4°C for 10 min.
The supernatant was discarded, and the cells were resuspended in 1 mL of complete
RPMI medium (cRPMI - HIMEDIA, Mumbai, India) containing 2 mM-glutamine, 100
U/mL penicillin, 1000 U/mL GIBCO, 10 nM pyruvate and 10% FBS. The cells were
counted using Trypan blue (Code 1263C061, Amresco Solon, Ohio USA 44139-
4300) in a hemocytometer. The peritoneal macrophage cultures were adjusted to a
concentration of 106 cells per well (24-well plates), while the alveolar macrophages
were used at a concentration of 2x105 cells per well (96-well plates). The plates were
cultured for 24 h until stimulation with antigens. The recombinant antigens rAg85c,
rMPT51, rHspX and rCMX were used at a concentration of 20 µg/mL and, after
standardization, were added to the macrophage cultures. After 24 h of stimulation, the
culture supernatants were collected for cytokine dosage.
90
Lung homogenates
Four days after intranasal infection, the BALB/c mice were euthanized by cervical
dislocation. The left lung lobes were collected and prepared as described by da Costa et
al. (2014) [25]. Once obtained, the lung was treated with a solution of DNAse IV (30
μg/mL; Sigma-Aldrich) and collagenase III (0.7 mg/ml; Sigma-Aldrich) for 1 h at 37°C.
To obtain a cell suspension, the tissue was passed through a 70-m cell filter (BD
BioSciences, Lincoln Park, NJ). The erythrocytes were lysed with lysis solution (0.15
M NH4Cl, 10 mM KHCO3), and the cells were then washed and resuspended in cRPMI
medium and adjusted to 1x106 cells/mL. The cell suspensions were divided for culture
or flow cytometry. For culture, the cells were maintained for 24 h without stimulus and
incubated at 37ºC in a humidified 5% CO2 atmosphere. After this period, the culture
supernatants were collected and stored at -20°C until the time of cytokine dosage. For
flow cytometry, the cell suspensions were labeled immediately after isolation.
Cytokine dosage
The supernatants of the cell cultures stimulated with the rAg85c rMPT51, rHspX or
rCMX proteins and supernatants of the cells infected with BCG, rBCG-CMX or empty
rBCG-PLA71 vaccines were used for IL-6, IL -1α and TGF-β dosage using ELISA
(Enzyme-Linked Immunosorbent Assay) according to the manufacturer's instructions,
using the kits Mouse IL-6, IL-1α and TGF-β ELISA Ready-SET-Go (eBioscience,
Inc.). Optical density readings were taken at 450 nm on an ELISA reader (THERMO
PLATE- TP-READER). The results were obtained after the determination of the
standard curve calculated from the readings of different concentrations of recombinant
cytokines provided by the commercial kits.
Bone Marrow-Derived Macrophages (BMM)
Two mice from each strain (BALB/c, C57BL/6, TLR-2-/- and TLR-4-/-) were used in this
experiment. The mice were euthanized by cervical dislocation. The bone marrow cells
were washed, processed and resuspended in cRPMI, adjusted to 106 per mL and plated
in a 24-well plate containing 10 g/mL recombinant murine granulocyte-macrophage
colony stimulating factor (GM-CSF) (eBioscience). After differentiation, the
91
macrophages were resuspended and cultured in a 96-well plate at a concentration of
2x105 per well for 24 hours before stimulation with the antigens.
BMM infection with BCG, rBCG-CMX and empty rBCG-PLA71
BMM were infected with 5x106 CFU of the BCG, rBCG-CMX aor empty rBCG-
PLA71 vaccines [MOI 5:1]. The cultures followed the conditions described above.
After 3 h, the supernatants containing non-phagocytosed bacteria were discarded, and
the cells were washed twice with PBS at 37°C. After the addition of 500 L of complete
RPMI medium without antibiotic, the plate was incubated for 24 h under the same
conditions. Subsequently, the culture supernatants were obtained and stored at -20°C for
cytokine dosage, and the cells were used for apoptosis testing and immunoblotting.
Apoptosis test
BMM infected with BCG, rBCG-CMX or empty rBCG-PLA71 were incubated with
PBS for 1 h on ice. After this period, the cells were centrifuged and adjusted to a
concentration of 1x105 cells/mL. A 100-μL aliquot of this suspension was added to 100
μL of annexin-binding buffer and incubated with 5 μL of FITC-Annexin V and 10 μL of
propidium iodide (PI) for 15 min at room temperature. Finally, 400 μL of annexin-
binding buffer was added, and data were acquired using a BD FACS Verse flow
cytometer (UFG). Macrophages stimulated with medium alone were used as negative
controls, and macrophages treated with 3% paraformaldehyde served as positive
controls.
Immunoblotting
For immunoblotting, macrophages from cultures infected with the BCG, rBCG-CMX or
empty rBCG-PLA71 vaccines were lysed with 50 µL of sterile water after 24 h of
culture. A 20-μL aliquot of each lysate was spotted on a nitrocellulose membrane
(Trans-Blot-Bio-Rad Laboratories), and the membrane was then blocked with 25 mL
of PBS/5% milk. After incubation at 4°C for 18 h under agitation, the membrane was
treated with anti-CMX antibody (de Souza et al. 2012). After 2 h of incubation, the
92
membrane was washed with PBS/0.05% Tween 20 and incubated for 1 h at 37°C with
biotinylated anti-IgG1 and anti-IgG2a antibody (1:15,000-Southern Biotechnology
Associates, Inc.). The membrane was then washed again and incubated with Avidin-
peroxidase (1:500) in PBS/2% milk for 1 h at room temperature with agitation. After an
additional washing step, the membrane was treated with developer buffer containing
0.015% diaminobenzidine (DAB) and 0.03% H2O2 in PBS, and it was gently shaken
while protected from light.
Indirect Dosage of NF-B/AP-1 activity
To evaluate NF-B/AP-1 activation, RAW-Blue cells (macrophages) that express the
SEAP (secreted embryonic alkaline phosphatase) gene under the control of NF-B/AP-
1 were used, as described by Zoccal et al. (2014) [36]. The dosage was performed after
24 h of stimulation with rAg85c, rMPT51, rHspX R and CMX (20 g/ml).
Flow Cytometry
Macrophages derived from the bone marrow and lung homogenates of BALB/c mice
were evaluated using flow cytometry. The lung cells and BMM were treated with 10%
mouse serum for 30 min. After treatment, the cells were washed with 200 µL of
PBS/azide. After centrifugation, the lung macrophages were incubated for 30 min with
FITC anti-CD206 (Clone MR5D3 - Santa Cruz Biotechnology), anti-CD86 PE (Clone
GL1-eBioscience Inc. San Diego, CA), anti-CD11b PERCP (Clone M1/70 - BD
Biosciences Pharmingen, San Jose, CA) and anti-F4/80 APC (Clone BM8 -
eBioscience, Inc. San Diego, CA) antibodies. Meanwhile, the BMM were labeled with
anti-CD206 FITC (MR5D3 - Santa Cruz Biotechnology), anti-CD86 PE (Clone GL1 -
eBioscience Inc. San Diego, CA), anti-MHCII PERCP (Clone M5/114.15.2 -
BioLegend ,)and anti-F4/80 APC (Clone BM8 - eBioscience, Inc. San Diego, CA)
antibodies. After the addition of 200 μL of PBS/azide and further centrifugation, the
cells were treated with PERM FIX (BD Cytofix/CytopermTM) for 20 min at 2-8°C. They
were then washed and resuspended in 200 μL of PBS/azide. A total of 50,000 events
were acquired using the BD FACS Verse flow cytometer (UFG). Data were analyzed
using FlowJo software, version 8.7.
93
Statistical analyses
Data were tabulated and analyzed using Microsoft Office Excel 2011 and Prism
software (version 5.0c, GraphPad). The results are presented as the mean and standard
deviation for each experimental group. The results using recombinant proteins as
stimuli were evaluated by multimetric tests using a one-way ANOVA followed by
comparison of each experimental group and the negative control group (medium) using
Dunnett's test. p<0.05 was considered statistically significant. All experiments were
repeated three times.
Results
The rBCG-CMX vaccine modulates innate immunity and induces cytokines
that promote protection
In vaccination models, a balanced Th1 and Th17 response may be responsible
for protection after infection with Mtb. Among the cytokines that are involved in
protecting against TB, TGF- is involved in the induction of Th17 after infection or
vaccination [37], and IL-1α is involved in well-structured granuloma formation [12].
We therefore asked whether the rBCG-CMX vaccine was able to induce the production
of TGF- and IL-1α [25]. To evaluate the induction of TGF-β and IL-1α, an ex vivo
test was performed using lung homogenates from intranasally immunized BALB/c mice
[38, 39], and another in vitro test was performed using BMM from BALB/c mice.
Four days after infection, the rBCG-CMX vaccine was found to induce higher
levels of IL-1α compared with BCG in the homogenates. Paradoxically, when
macrophages were infected in vitro, the rBCG-CMX vaccine induced lower IL-1α
levels than the BCG vaccination did (Fig 1 A and B, p<0.05). Similar results were
observed for TGF-β levels (Fig 1 C and D, p<0.05).
94
Fig 1. The ex vivo and in vitro induction of cytokines involved in Th17
differentiation. Mice were intranasally vaccinated with BCG-Moreau and rBCG-CMX.
Immunization was performed using 107 CFU of vaccine per mouse. The animals were
euthanized 4 days after immunization, and the production of TGF-β and IL-1α was
subsequently carried out ex vivo. For in vitro BMM testing, the mice were infected
with 5 MOI of BCG or rBCG-CMX for 3 h, and after 24 hours A) the in vitro
production of IL-1α, B) the ex vivo production of IL-1α, C) the in vitro production of
TGF-β, and D) the ex vivo production of TGF-β were performed. *p<0.05 differece
between the rBCG-CMX group and the saline group; #p<0.05 difference between the
rBCG-CMX group and the BCG-Moreau group. A total of 5 mice were used per group.
rBCG-CMX vaccine promotes increased pulmonary macrophage population
IL-1α is responsible for the proliferation of CD11blow alveolar macrophages and
the induction of CD11b expression [12, 40]. Because IL-1α induction was achieved by
intranasal inoculation of the vaccine, we asked whether the rBCG-CMX vaccine
participated in the activation of lung macrophages in vaccinated mice. BALB/c mice
were intranasally infected/vaccinated [38, 39], and after 4 days, the lung macrophages
95
were evaluated. The lungs of mice vaccinated with rBCG-CMX had a higher number of
activated F4/80+CD11bhigh macrophages than did mice vaccinated with BCG (Fig 2;
p<0.05).
The F4/80+CD11bhigh macrophages induced by rBCG-CMX or BCG expressed
similar levels of CD86 (Fig 2C; p=0.05). The rBCG-CMX vaccine induced increased
expression of CD86-activating molecules in F4/80+CD11blow macrophages (Fig 2D;
p<0.05) compared with lung macrophages from animals vaccinated with BCG.
However, the rBCG-CMX vaccine induced a greater number of F4/80+CD11bhigh and
F4/80+CD11blow macrophages expressing CD206 compared with either the BCG
vaccine or saline alone (Fig 2E and F: p<0.05).
The rBCG-CMX vaccine thus promoted an increase in macrophages with high
CD86 and CD206 expression in the lungs of infected animals, indicating a difference in
activation from the immune response induced by BCG.
Fig 2. In vivo induction of macrophage profile. Mice were intranasally vaccinated
with BCG-Moreau and rBCG-CMX. Immunization was performed using 107 CFU of
96
vaccine per mouse. The animals were euthanized 4 days after immunization, and lung
flow cytometry was performed to observe macrophage activity. A) Dot plot of
cytometry for F480+CD11bhigh and F480+CD11blow macrophages. B) Percentage of
F480+CD11bhigh macrophages. C) Absolute numbers of F480+CD11bhigh macrophages.
D) F480+CD11bhigh macrophages expressing MIF-CD86. E) F480+CD11blow
macrophages expressing MIF-CD86. F) F480+CD11bhigh macrophages expressing
CD206-MIF. G) F480+CD11blow macrophages expressing CD206-MIF. *p<0.05. A
total of 5 mice were used per group.
The rCMX protein appears to enhance macrophage survival and rBCG-CMX
vaccine processing
Previously, the rBCG-CMX vaccine has been shown to undergo greater
phagocytosis by peritoneal macrophages [25] and induce better CD206 expression,
which has been implicated in macrophage phagocytosis and survival [41]. Therefore,
we asked whether the induction of TGF-β in vivo promotes the apoptosis of the infected
macrophages, as this cytokine is related to the induction of apoptosis [42].
After BMM infection, the BCG-Moreau vaccine was observed to induce more
necrosis than the rBCG-CMX vaccine (Fig 3A: #p<0.05). In contrast, rBCG-CMX-
infected macrophages preferentially died by apoptosis (Fig 3B and C: #p<0.05). The
rBCG-CMX vaccine appears to slow down the process of cell death, even with the
presence of PI and Annexin V double-positive cells, when compared to controls (Fig
3C; *p<0.05). In the present study, the rBCG-CMX vaccine promoted greater
expression of MHC-II in infected macrophages compared with BCG-Moreau, which
may reflect better processing and presentation of the rBCG-CMX vaccine (Fig 3D;
*p<0.05).
The apoptosis test revealed that the vaccine appeared to slow down the process
of cell death and may have caused an increase in the expression of molecules related to
vaccine processing.
97
Fig 3. The rBCG-CMX vaccine induces more macrophage apoptosis and better
vaccine processing than does BCG-Moreau. Bone marrow-derived macrophages were
infected with BCG and rBCG-CMX (MOI 5) for 3 h. After this time, excess non-
phagocytosed bacteria were removed. After 24 h of culture, the macrophages were
subjected to flow cytometry (Fig A, B and F) and apoptosis testing (Fig C, D and E).
Analysis was performed using Student's t test. *p<0.05.
The CMX protein appears to be responsible for modifying the BCG response in
macrophages, promoting the expression of survival markers in macrophages and
improving rBCG-CMX vaccine processing. The expression of the CMX protein within
BMM has been confirmed (S1 Fig).
The rCMX protein induces the production of cytokines that promote
vaccine protection in BMM from BALB/c mice
Some Mtb proteins are, individually, able to activate the immune response in
macrophage models, inducing either a pro- or an anti-inflammatory response [43-45].
The present study proposed that the rCMX protein, or the set of proteins that comprise
98
it, could activate inflammation, thereby promoting the induction of better vaccine
protection.
To this end, the activation of NF-κB and the production of IL-6 were evaluated
in macrophages stimulated with the recombinant fusion protein or the individual
proteins. RAW-Blue cells and BMM from BALB/c mice were stimulated with rAg85c,
rMPT51, rHspX and rCMX for 24 h (Fig 4). All proteins activated NF-κB (Fig 4A;
p<0.05). However, there was differential stimulation of the inflammatory cytokines.
When BMM were treated with these proteins, the induction of IL-6 production was
found to be restricted to rAg85c and rCMX (Fig 4B; p<0.05). Despite inducing NF-κB
activation, rMPT51 and rHspX did not activate IL-6 production in BMM from
BALB/c mice (Fig 4B; p<0.05).
As stated earlier, the rBCG-CMX vaccine induces increased TGF-β and IL-1α
production in the lungs of BALB/c mice. These cytokines are related to the induction of
Th17 responses and to a protective response [46, 12]. We therefore asked whether the
proteins that make-up rCMX were capable of inducing the production of these
cytokines. The results demonstrate that only rAg85c and rCMX induced TFG-β and IL-
1α in the BMM from BALB/c mice (Fig 4C and D; p<0.05).
The only protein present in rCMX that was capable of inducing IL-6, TFG-β and
IL-1α was rAg85c. The lack of induction by the rMPT51 and rHspX proteins did not
prevent rCMX from inducing the production of all cytokines, although this induction
was at lower levels. However, the rCMX protein, when expressed in vivo by BCG, may
modify the vaccine response.
99
Fig 4. Production of cytokines by rAg85c, rMPT51, rHspX and rCMX proteins.
A) RAW-Blue cells were stimulated with 20 µg/mL of recombinant proteins for 24 h.
Supernatants were obtained for indirect dosage of NF-κB activity. Macrophages derived
from the bone marrow of BALB/c mice were cultured with 20 µg/mL of recombinant
proteins for 24 h. After this period, the supernatant collected was subjected to determine
the levels of IL-6 (B), TFG-β (C) and IL-1α (D) cytokines. *p<0.05 difference between
stimuli and the medium.
rCMX induces cytokines in the BMM of C57BL/6 mice that promote vaccine
protection
The mouse strains C57BL/6 and BALB/c are known to have genetic differences
that affect the induction of Mtb-protective responses and that the ability to induce
protection in these two models appears to be associated with different cellular profiles
[47]. Furthermore, following vaccination with BCG, protective immune response
100
induction has been shown to differ between these two models [48, 47]. However, in
regard to vaccine protection, the vaccine in question must be able to produce a response
in any evaluated model. In the results observed earlier, only rAg85c and rCMX were
able to activate the immune response in BALB/c mouse macrophages. However, we
asked whether the rCMX protein could activate the immune response in the C57BL/6
model without being affected by the genetic background of this model.
For this purpose, BMM from C57BL/6 mice were stimulated with the rAg85c,
rMPT51, rHspX and rCMX proteins for 24 h. IL-6 induction was observed for all
analyzed proteins (Fig 5A; p<0.05). rAg85c, rHspX and rCMX induced the production
of IL-1α (Fig 5B; p<0.05). In contrast to what was observed in the BALB/c model, only
the rMPT51 protein was unable to induce the production of this cytokine (Fig 5B;
p=0.05). Surprisingly, all of the proteins were capable of inducing TFG-β production in
the BMM from C57BL/6 mice (Fig 5C, p<0.05).
Fig 5. Production of cytokines by rAg85c, rMPT51, rHspX and rCMX proteins.
A) Macrophages derived from the bone marrow of C57BL/6 mice were cultured with 20
µg/mL of recombinant proteins for 24 hours. After this period, the supernatant collected
was subjected to dosage of IL-6 (A), IL-1α (B) and TFG-β (C) cytokines, respectively.
*p<0.05 difference between stimuli and the medium.
BMM are a good model for eliminating natural activation bias, but they do not
reliably reflect infection or immunization. To better simulate the mucosal environment,
we used alveolar and peritoneal macrophages from both mouse strains, which could
allow us to evaluate the behavior of cells of the primary infection site and the peripheral
response.
The results show that all the proteins induced IL-6 production in the alveolar
macrophages of BALB/c mice (Fig 6A; p<0.05). However, only the rAg85c and rCMX
proteins stimulated these macrophages in C57BL/6 mice (Fig 6B; p<0.05). In the
101
peritoneal macrophages, only the rMPT51 protein was incapable of stimulating IL-6
production in the C57BL/6 model, with the other proteins achieving similar induction in
both models (Fig 6C and D; p<0.05).
Although the induction of IL-6 production by rCMX varied between the models,
IL-6 was always induced in the macrophages from the different genetic profiles.
Fig 6. Production of cytokine IL-6 by rAg85c, rMPT51, rHspX and rCMX
proteins. A) Alveolar and peritoneal macrophages from BALB/c and C57BL/6 mice
were obtained and cultured with 20 µg/mL of recombinant proteins for 24 h. After this
period, the supernatant collected was subjected to determine the level of IL-6. A and B)
Alveolar macrophages from BALB/c and C57BL/6 mice, respectively. C and D)
Peritoneal macrophages from BALB/c and C57BL/6 mice, respectively. *p<0.05
diffeence between stimuli and the medium.
TLR-4 appears to interact with rAg85c, rMPT51, rHspX and rCMX in IL-6
production
102
Given the context in which these proteins stimulate the immune response, we
asked whether they were recognized by innate immune response receptors. In the
context of TB, TLR-2 and TLR-4 are implicated in host cell interactions with Mtb [43,
45]. Due to the increased production of IL-6 inflammatory mediators of NF-κB activity,
we used BMM from TLR-2-/- and TLR-4-/- mice to explore whether TLR-2 and TLR-4
are involved in recognizing the rAg85c, rMPT51, rHspX and rCMX proteins.
At 24 h after stimulating the BMM from TLR-2-/- mice with rAg85c, rMPT51,
rHspX and rCMX proteins, IL-6 production was unchanged (Fig 7A, p<0.05). Rather,
IL-6 production was reduced in the BMM of TLR-4-/- mice, demonstrating that these
proteins depend on this receptor to induce IL-6 production (Fig 7B, p<0.05). These
results demonstrate that the rAg85c, rMPT51 and rCMX proteins appear to interact with
TLR-4 in IL-6 production.
Fig 7. TLR receptors related to the recognition of rAg85c, rMPT51, rHspX and
rCMX in BMM from TLR-2 KO and TLR-4 KO mice. A) Macrophages derived
from the bone marrow of TLR-2 KO and TLR-4 KO mice were cultured with 20 µg/mL
of recombinant proteins for 24 h. After this period, the supernatant was subjected to
dosage of IL-6 in BMM from TLR-2 KO mice (A) or in BMM from TLR-4 KO mice
(B). *p<0.05 difference between the stimuli and the meadium.
103
S1 Fig. rBCG-CMX vaccine expresses the rCMX protein 24 h after infection in
macrophages. Bone marrow-derived macrophages were infected with BCG and rBCG-
CMX (MOI 5) for 3 h. After this period, excess non-phagocytosed bacteria were
removed. After 24 h of culture, the macrophages were lysed, and dot blots were
performed to detect rCMX protein expression.
rCMX BCG-PLA71Φ rBCG-CMX BCG Moreau
104
Discussion
Previous studies have shown that the rBCG-CMX vaccine induces both Th1 and
Th17 responses, both of which are important in controlling Mtb infection. In the present
study, we propose that the rCMX protein, when expressed by the rBCG vaccine (rBCG-
CMX), is able to activate the innate immune response and modulate the response of this
vaccine, promoting the induction of the Th1 and Th17 response. These results
demonstrate that macrophages activated by the rBCG-CMX vaccine are more numerous
and have higher CD86 and CD206 expression, accompanied by the production of TGF-
β and IL-1α. This vaccine induces more apoptosis and greater MHC-II expression in
infected macrophages than does the BCG vaccine. The rCMX protein was able to
induce IL-1α, IL-6 and TGF-β production via TLR-4 signaling, demonstrating that
TLR-4 is probably responsible for inducing the Th1 and Th17 response to the rBCG-
CMX vaccine.
The mucosa contains important cells, such as macrophages, which have been
established as essential in the production of innate immune memory after vaccination
[49]. In Mtb infection, the first induced response begins mainly on the surface of the
respiratory mucosa; therefore, it has been shown that the first line of defense should be
produced at the pathogen infection site to promote a better protective response [50]. An
alternative means of evaluating the ability of the rBCG-CMX vaccine to activate the
innate immune response would therefore be to evaluate pulmonary macrophages
following infection with the vaccine.
Macrophages are known to produce cytokines such as TGF-β and IL-1α, which
are involved in specific protective response induction [51, 52]. TGF- is related to the
formation of fibrous tissue and the differentiation of Th17 cells, important events in the
protection induced by Mtb vaccines [14]. Our results showed that 4 days after infection,
the rBCG-CMX vaccine induced higher levels of TGF-β than the BCG vaccine (Fig
1D). This result corroborates previous studies that have shown that when expressed by
rBCG (rBCG-CMX) or mc2 (mc2-CMX), the CMX protein is a strong inducer of the
Th17 response in immunized mice. Concurrently, it was shown that, after 4 days of
infection, the rBCG-CMX vaccine induced greater IL-1α production than the BCG
vaccine (Fig 1B). Huaux et al. (2015) observed that IL-1α is responsible for the
proliferation of CD11blow alveolar macrophages and the activation of these
105
macrophages in CD11bhigh [12]. This observation suggests that the rBCG-CMX vaccine
may be inducing higher proliferation of the macrophage population produced following
infection with the vaccine.
These activated macrophages migrate to the lung tissue and are active in
granuloma formation [12]. After infection, the rBCG-CMX vaccine was further shown
to induce a greater number of activated F4/80+CD11bhigh macrophages in the lung,
indicating that this vaccine has good potential to promote macrophage recruitment to
the infection site. In our results, F4/80+CD11bhigh macrophages had similar CD86
expression to and greater CD206 expression than that induced by the BCG-Moreau
vaccine (Fig 2B, D and F). These results corroborate the study by Mirza et al. (2011),
who showed that TGF-β is produced concomitant to the induction of CD206 expression.
These cells are important during the activation of the adaptive immune response, as the
co-stimulatory molecules CD86 and CD206 and phagocytosis receptors are strongly
associated with the presentation of antigens to T lymphocytes [53].
Another evaluated macrophage population was F4/80+CD11blow, which are
probably the alveolar macrophages [12]. This population showed greater expression of
both CD86 and CD206 after infection with the rBCG-CMX vaccine (Fig 2E and G).
CD206 is a type C lectin that is responsible for the endocytosis and phagocytosis of
microorganisms that contain manoglycoproteins, including Mtb [54]. This result
supports the phenomenon observed in previous studies of the rBCG-CMX vaccine,
which was shown to undergo higher phagocytosis than BCG-Moreau and may promote
the induction of a better protective response [25].
Another important specific defense mechanism that is promoted by rBCG-CMX
is the induction of apoptosis in the infected macrophages. Previously, macrophages
infected with rBCG::ΔureC::Hly (+) have been shown to induce apoptotic bodies that
are directly associated with the activation of TCD4+ and TCD8+ by increasing antigen
representation by MHC-II and MHC-I [23]. The results presented here showed that the
rBCG-CMX vaccine induced more apoptosis than the BCG vaccine (Fig 3A), and this
fact can be directly associated with the presentation of antigens via MHC-II (Fig. 3D),
which can enhance the TCD4+ lymphocyte response [55]. These results corroborate the
induction of TGF-β in vivo, as this cytokine is related to the induction of apoptosis [42],
and the two events promote a better protective response.
These findings lead us to hypothesize that the rCMX protein may be modulating
the response induced by the BCG vaccine, modifying and improving its ability to
106
activate the immune response. The rCMX protein consists of the immunodominant
epitopes of the rAg85c, rHspX and full-length rMPT51 proteins [27]. When expressed
by the rBCG vaccine (rBCG-CMX), the rCMX protein modifies the immune response
induced by BCG-Moreau. Therefore, we suggest that the rCMX protein may be
modulating the response of the BCG vaccine, as well as the macrophage response.
Several studies have shown that some Mtb proteins are able to activate the innate
immune response in macrophages and dendritic cells to interact with TLRs [42, 56, 43].
We therefore verified the pro-inflammatory ability of each individual protein, as well as
the rCMX protein, which allowed us to infer an immunomodulatory effect on the part of
these proteins. We observed that the rAg85c, rMPT51, rHspX and rCMX proteins
activated NF-κB, highlighting the ability of these proteins to induce a pro-inflammatory
response (Fig 4A) [57]. However, only rAg85c and rCMX were able to induce the
production of IL-6, IL-1α and TGF-β. Given the immunomodulatory ability of Ag85-
complex proteins [2], we believe that Ag85c is the main protein in rCMX capable of
inducing the IL-6, IL-1α and TGF-β cytokines in BMM from BALB/c mice (Fig 4).
This hypothesis is supported by the fact that rAg85c has been shown to exhibit powerful
pro-inflammatory activity. When expressed by a BCG vaccine (rBCG-Ag85c), Ag85c
promoted a better protective response than that promoted by BCG in the induction of
pro- and anti-inflammatory cytokines such as IL-12, TNF-α, IFN-γ and TGF-β in
immunized guinea pig lungs [58]. By contrast, only MPT51 was unable to induce the
production of cytokines in BMM from C57BL/6 mice (Fig 5). The C57BL/6 and
BALB/c strains are known to differ in their adaptive immune response induction
following BCG vaccination or Mtb infection. However, this difference does not affect
the control of infection by the two models [48, 47]. Regardless of the model utilized,
rAg85c in particular played an essential role in the response induced by rCMX,
suggesting that this protein is able to activate the immune response in BMM from both
models.
As the observed activation of inflammation may be related to the BMM
response profile, we evaluated this response in alveolar and peritoneal macrophages,
which best represent a mucosal microenvironment. Although the induction of IL-6
production by rCMX varied between the two models, IL-6 cytokine production was
maintained between the different macrophage profiles. The innate immune response
produced by the rCMX protein, with the induction of pro- and anti-inflammatory
107
cytokines such as IL-6, IL-1α and TGF-β, may have promoted the induction of Th17
responses in vivo and may have contributed to the greater protection induced by BCG
when rCMX was used as a booster [25].
Some studies have shown that Mtb antigens are capable of regulating the
immune response of the host by interacting with TLRs [43, 44]. In the present study, we
demonstrated that the rAg85c, rMPT51 and rCMX proteins all interacted with TLR-4 to
promote IL-6 induction (Fig 7). The Rv0652 protein of Mtb induces a TLR-4-dependent
pro-inflammatory immune response by stimulating BMM and RAW 264.7
macrophages [45]. A study by Yu demonstrated that 24 h after urothelial cancer cells
were infected with the BCG vaccine, cell death was induced and genes important for the
induction of apoptosis were activated via TLR-7 receptor activation [59]. This finding
led to the belief that the rCMX protein was expressed by the BCG vaccine in 24 h, as
demonstrated in S1 Fig. After expression, rCMX induces apoptosis by interacting with
TLR-4, as this receptor is associated with the induction of apoptosis in macrophages
[60]. Although we did not use a TLR-4 blocker to confirm the interaction, our results
support the hypothesis that this interaction occurs, as we detected a reduction in IL-6
production after LPS stimulation in TLR-4 KO mouse macrophages (Fig 7). Moreover,
through the induction of apoptosis and the release of apoptotic bodies, the vaccine may
promote the participation of other cells such as dendritic cells to increase the induction
of the adaptive immune response [23], thus potentially fostering a better protective
response.
Among the difficulties and limitations of the present work, we should mention
the potential contamination of the proteins with LPS; the effect of the plasmid on BCG
recombination; and the different strains of mice used in this study. To solve these
problems, LPS was removed from the recombinant proteins using LPS extraction kits
(Toxin Removal Kit) that are currently being used in Mtb protein testing [61].
Regarding the effects of the plasmid on BCG, some studies in the TB vaccine field have
used a BCG vaccine expressing an empty plasmid as a control group. No changes were
observed regarding the specific response compared with what would be expected from
BCG [15]. The other obstacle we faced was the use of two mouse models, BALB/c and
C57BL/6. Mtb infection in C57BL/6 mice is known to result in better induction of
balanced Th1 and Th17 cells than in the BALB/c model [48]. However, the BALB/c
model has more IL-10 producing Treg cells, which may negatively affect bacterial load
108
reduction, causing greater susceptibility in this model than in the C57BL/6 model [47].
Contrary to what is observed in Mtb infection after vaccination with BCG, BALB/c
mice showed better induction of the Th1 and Th17 response than C57BL/6 mice [62].
Although the response of the two models to Mtb infection or BCG vaccination differs,
protection in the two models does not change [62]. It would be important to discover
more about the innate immune response of these two models, and further study is
required in this area.
These results allow us to suggest that the rCMX protein modulates the innate
immune response by interacting with TLR-4 in macrophages and by inducing IL-6 and
TGF-β, which may explain the production of the Th17 response by the rBCG-CMX
vaccine.
Aknowledgements
This study was financed by the National Council for Scientific and
Technological Development (CNPq, Project#301976/2011-2, 472906/2011-9,
301198/2009-8, 472909/2011-8) and by Fundação de Amparo a Pesquisa do Estado de
Goiás (FAPEG-PRONEX).
We are thankful to Universidade de Brasília (UnB), for allowing access to
cytometry core facilities.
Experimental design and set up: APJK e AK. Experimental development and
data analyses: APJK, AK, ACC, DPR, Bruno, KFZ. Grant PIs that afforded reagents,
materials and analysis tools for all experiments APJK e AK, LHF. Critical discussion
and writing of the manuscript: APJK, AK, ACC, DPR, Bruno, KFZ, LHF. Cytometry
experiments and analysis: ACC.
ACC: Received a PhD fellowship from CNPq; DPR: Received an MSc
fellowship from CNPq; Karina, Bruno - Received an undergraduate fellowship from
CNPq.
109
References:
1. World Health Organization (WHO) 2013. Global tuberculosis control—
epidemiology, strategy, financing.
2. Hetland G & Wiker HG (1994) Antigen 85c on Mycobacterium bovis, BCG and M.
tuberculosis promotes monocyte-CR3-mediated uptake of microbeads coated with
mycobacterial products. Immunology 82: 445- 449.
3. Bafica A, Scanga CA, Feng CG, Leifer C, Cheever A, Sher A (2005) TLR9 regulates
Th1 responses and cooperates with TLR2 in mediating optimal resistance to
Mycobacterium tuberculosis. J. Exp. Med. 202:1715–1724. doi: 10,1084 /
jem.20051782
4. Gerosa F, Baldani-Guerra B, Lyakh L, Batoni G, Esin S, Winkler-Pickett RT et al.
(2008) Differential regulation of interleukin 12 and interleukin 23 production in
human dendritic cells. J Exp Med 205: 1447-1461. doi: 10.1084/jem.20071450
5. Su N, Li Y, Wang J, Fan J, Li X, Peng W et al. (2014) Role of MAPK signal
pathways in differentiation process of M2 macrophages induced by high-ambient
glucose and TGF-β1. J Recept Signal Transduct Res 9:1-6. doi:
10.3109/10799893.2014.960933
6. Xu XL, Zhang P, Shen YH, Li HQ, Wang YH, Lu GH et al. (2015) Mannose
prevents acute lung injury through mannose receptor pathway and contributes to
regulate PPARy and TGF-β1 level. Int J Clin Exp Pathol 1:6214-24.
7. Behar SM, Divangahi M & Remold HG (2010) Evasion of innate immunity by
Mycobacterium tuberculosis: is death an exit strategy? Nature Reviews
Microbiology 8, 668-674. doi: 10.1038/nrmicro2387
8. Lu L, Wang J, Zhang F, Chai Y, Brand D, Wang X et al. (2010) Role of SMAD and
non-SMAD signals in the development of Th17 and regulatory T cells. J Immunol
184:4295-306. doi: 10.4049/jimmunol.0903418
9. Ikeda S, Saijo S, Murayma MA, Shimizu K, Akitsu A and Iwakura Y (2014) Excess
IL-1 signaling enhances the development of Th17 cells by downregulating TGF-β-
induced Foxp3 expression. J Immunol 192: 1449-58
10. Hasan M, Neumann B, Haupeltshofer S, Stalke S, Fantini MC, Angstwurm K et al.
(2015) Activation of TGF-β-inducing non-SMAD signaling pathways during Th17
differentiation. Immunol Cell Biol 93:662-72. doi:10.1038/icb.2015.21
110
11. Chen CJ, Kono H, Golenboch D, Reed G, Akira S & Rock KL (2007) Identification
of a key pathway required for the sterile inflammatory response triggered by dying
cells. Nat Med 13:851-857. doi:10.1038/nm1603
12. Huaux F, Lo ReS, Giordano G, Uwambayinema F, Devosse R, Yakoub Y et al.
(2015) IL-1α induces CD11b (low) alveolar macrophage proliferation and maturation
during granuloma formation. J Pathol 235: 698-709. doi: 10.1002/path.4487
13. Goriely S, Neurath M, Goldman M (2008) How microorganisms tip the balance
between intrleukin-12 family members. Nat Rev Immunol 8:81-86.
doi:10.1038/nri2225
14. Veldhoen M, Hocking R, Atkins C, Locksley R, Stockinger B (2006) TGF-β in the
context of an inflammatory cytokine milieu de novo differentiation of IL-17 –
producing T cells. Immunity 24:179-189. doi:10.1016/j.immuni.2006.01.001
15. Wang C, Fu R, Chen Z, Tan K, Chen L, Teng X et al. (2012) Immunogenicity and
protective efficacy of a novel recombinant BCG strain over expressing antigens
Ag85A e Ag85B. Clinical and Developmental Immunology, 2012, 1- 9.
doi:10.1155/2012/563838
16. Wang X, Barnes PF, Huang F, Alvarez IB, Neuenschwander PF, Sherman DR et al.
(2012) Early secreted antigenic target of 6-kDa protein of Mycobacterium
tuberculosis primes dendritic cells to stimulate Th17 and inhibit Th1 immune
responses. J Immunol. 189:3092-103. doi:10.4049/ jimmunol.1200573.
17. Khader SA, Cooper AM (2008) IL-23 and IL-17 in tuberculosis. Cytokine. 41:79-83.
10.1016/j.cytogfr.2010.10.004
18. Garcia-Pelayo MC, Bachy VS, Kaveh DA, Hogarth PJ (2015) BALB/c mice display
more enhanced BCG vaccine induced Th1 and Th17 response than C57BL/6 mice
but have equivalent protection. Tuberculosis. 95:48-53. doi.org
/10.1016/j.tube.2014.10.012
19. Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D et al (1998).
Deciphering the biology of Mycobacterium tuberculosis from the complete
genome sequence. Nature 393:537-44. doi:10.1038/31159
20. WHO (1998) Global tuberculosis control. World Health Organization.
21. Partnership WST (2010) The Global Plan to Stop TB 2011-2015: Transforming the
Fight- Towards Elimination of Tuberculosis.
22. Lienhardt C, Zumla A (2005) BCG: the story continues. Lancet 366: 1414-1416.
doi:10.1016/S0140-6736(05)
111
23. Farinacci M, Weber S and Kaufmann SH (2012) The recombinant tuberculosis
vaccine rBCG:: ΔureC:: Hly (+) induces apoptotic vesicles for improved priming of
CD4 (+) and CD8 (+) T cells. Vaccine 14:7608-14.
doi.org/10.1016/j.vaccine.2012.10.031
24. Linehan JL, Dileepan T, Kashem SW, Kaplan DH, Cleary P and Jenkins MK (2015).
Generation of Th17 cells in response to intranasal infection requires TGF-β1 from
dendritic cells and IL-6 from CD301b+ dendritic cells. Proc Natl Acad Sci U S A.
13;112 (41):12782-7. doi: 10.1073/pnas.1513532112.
25. Da Costa AC, Costa- Júnior AO, de Oliveira FM, Nogueira SV, Rosa JD, Resende
DP et al. (2014) A new recombinant BCG vaccine induces specific Th17 and Th1
effector cells with higher protective efficacy against tuberculosis. PLoS One.
14:e112848. doi: 10.1371/journal.pone.0112848.
26. Junqueira-Kipnis AP, de Oliveira FM, Trentini MM, Tiwari S, Chen B, Resende DP
et al. (2013) Prime-Boost with Mycobacterium smegmatis Recombinant Vaccine
Improves Protection in Mice Infected with Mycobacterium tuberculosis. PLoS One
8: e78639. doi: 10.1371/journal.pone.0078639.
27. De Sousa EM, da Costa AC, Trentini MM, de Araujo Filho JA, Kipnis A and
Junqueira-Kipnis AP (2012) Immunogenicity of a fusion protein containing
immunodominant epitopes of Ag85C, MPT51, and HspX from Mycobacterium
tuberculosis in mice and active TB infection. PLoS One doi: 10.1371/journal.pone.
0047781
28. Ohara N, Ohara-Wada N, Kitaura H, Nishiyama T, Matsumoto S and Yamada T
(1997) Analysis of the genes encoding the antigen 85 complex and MPT51 from
Mycobacterium avium. Infect. Immun. 65:3680–3685.
29. Harth G, Lee BY, Wang JDL, Horwitz MA (1997) Novel insights into genetics,
biochemistry, and immunocytochemistry of the 30-kilodalton major extracellular
protein of Mycobacterium tuberculosis. Infect. Immun. 64: 3038-47.
30. Sanki AK, Boucau J, Ronning DR, Sucheck SJ (2009) Antigen 85C-mediated acyl-
transfer between synthetic acyl donors and fragments of the arabinan. Glycoconj J.
26: 589-96. doi: 10.1007/s10719-008-9211-z.
31. Kitaura H, Ohara N, Naito M, Kobayashi K and Yamada T (2000) Fibronecti-biding
proteins secreted by Mycobacterium avium. Apmis. 108:558-564.
112
32. Chang Z, Primm TP, Jakana J, Lee IH, Serysheva I, Chiu W et al. (1996)
Mycobacterium tuberculosis 16-kDa antigen (Hsp16.3) functions as an oligomeric
structure in vitro to suppress thermal aggregation. J Biol Chem. 12:7218-23.
33. Yuan Y, Crane DD, Simpson RM, Zhu YQ, Hickey MJ, Sherman DR et al. (1998)
The 16-kDa alpha-crystallin (Acr) protein of Mycobacterium tuberculosis is
required for growth in macrophages. Proc Natl Acad Sci USA. 95: 9578–9583.
34. Qamra R, Mande SC, Coates AR and Henderson B (2005) The unusual chaperonins
of Mycobacterium tuberculosis. Tuberculosis (Edinb) 85: 385-394.
doi:10.1016/j.tube.2005.08.014
35. Correa AF, Bailão AM, Bastos IM, Orme IM, Soares CM (2014) The Endothelin
System Has a Significant Role in the Pathogenesis and Progression of
Mycobacterium tuberculosis Infection. Infection and Immunity 82: 5154-5165. doi:
10.1128/IAI.02304-14.
36. Zoccal KF, Bitencourt CS, Paula-Silva FWG, Sorgi CA, Bordon KCF, Arantes EC
et al. (2014) TLR2, TLR4 and CD14 Recognize Venom-Associated Molecular
Patterns from Tityus serrulatus to Induce Macrophage-Derived Inflammatory
Mediators. PLoS One. 9: e88174. doi:10.1371/journal.pone.0088174
37. Ghoreschi K, Laurence A, Yang X-P, Hirahara K, and John J. O’Shea (2011) T
helper 17 cell heterogeneity and pathogenicity in autoimmune disease Trends
Immunol. 2011 32: 395–401. doi:10.1016/j.it.2011.06.007.
38. Lyadova IV, Vordermeier HM, Eruslanov EB, Khaiduko SV, Apt AS and Hewinson
RG (2001) Intranasal BCG vaccination protects BALB/c mice against virulent
Mycobacterium bovis and accelerates production of IFN-gamma in their lungs.
Clinical and Experimental Immunology 126: 274-279.
39. Allen IC (2014) The Utilization of Oropharyngeal Intratracheal PAMP
Administration and Bronchoalveolar Lavage to Evaluate the Host Immune
Response in Mice. Journal of Visualized Experiments.
<http://www.jove.com/video/51391/the-utilization-oropharyngeal-intratracheal-
pamp-administration>. Acesso em: 29 maio 2014
40. Gonzales-Juarrero M, Shim TS, Kipnis A, Junqueira-Kipnis AP and Orme IM
(2003) Dinamics of macrophages cell populations during murine pulmonary
tuberculosis. J Immunol 171:3128-3135. doi: 10.4049/jimmunol.171.6.3128
41. Gordon S (2003) Alternative activation of macrophages. Nat Rev Immunol 3:23-35.
doi: 10.1038/nri978
113
42. Spender LC, O’Brien DI, Simpson D, Dutt D, Gregory CD, Allday MJ et al. (2009)
TGF-β induces apoptosis in human B cells via transcriptional regulation of BIK and
BCL-XL. Cell Death Differ. 16: 593–602. doi:10.1038/cdd.2008.183.
43. Tiwari B, Soory A, Raghunand TR (2014) An immunomodulatory role for the
Mycobacterium tuberculosis region of difference 1 loccus proteins PE35 (Rv3872)
and PPE68 (Rv3873). FEBS J 281:1556-70. doi:10.1111/febs.12723
44. Kumar A, Lewin A, Rani PS, Qureshi IA, Devi S, Majid M et al. (2013) Dormancy
Associated Transation Inhibitor (DATIN/Rv0079) of Mycobacterium tuberculosis
interacts with TLR-2 and induces proinflamatory cytokine expression. Cytokine 64:
258-264. doi:10.1111/imm.12306
45. Kim K, Sohn H, Kim JS, Choi HG, Byun EH, Lee KI et al. (2012) Mycobacterium
tuberculosis Rv0652 stimulates production of tumor necrosis factor and monocytes
chemoattractant protein-1 in macrophages trough the Toll-like receptor 4 pathway.
Immunlogy 136:231-40. doi:10.1111/j.1365-2567.2012.03575.x
46. Hernandez AS (2009) Helper (Th1, Th2, Th17) and regulatory cells (Treg, Th3,
NKT) in rheumatoid arthritis. Reumatologia Clinica Suplementos 5:1-5.
10.1016/j.reuma.2008.11.012
47. Paula MO, Fonseca DM, Wowk PF, Gembre AF, Fedetto PF, Sérgio CA et al.
(2011) Host genetic backgroung affects regulatory T-cell activity that influences the
magnitude of cellular immune response against Mycobacterium tuberculosis.
Immunol Cell Biol 89:526-34. doi:10.1038/icb.2010.116
48. Sérgio CA, Bertolini TB, Gembre AF, Prado RQ, Bonato VL (2015) CD11c (+)
CD103(+) cells of Mycobacterium tuberculosis – infected C57BL/6 but not of
BALB/c mice induce a high frequency of interferon- γ or interleukin-17-producing
CD4(+) cells. Immunology 144:574-86. doi:10.1111/imm.12411
49. Yoshida K, Maekawa T, Zhu Y, Renard-Guillet C, Chatton B, Inoue K et al. (2015)
The transcription factor ATF7 mediates lipopolysaccharide-induced epigenetic
changes in macrophages involved in innate immunological memory. Nat
Immunol.16:1034-43. doi:10.1038/ni.3257
50. Giri PK & Khuller GK (2008) Is intranasal vaccination a feasible solution for
tuberculosis? Expert Rev Vaccines 7:1341-1356. doi:10,1586 / 14760584.7.9.1341
51. Hagimoto N, Kuwano K, Hara N (2002) The roles of apoptosis in lung injury. Nihon
Kokyuki Gakkai Zasshi 40:343-9. doi: 10.4049/jimmunol.168.12.6470
114
52. England H, Summersgill HR, Edye ME, Rothwell NJ, Brough D (2014) Release of
interleukin-1α or interleukin-1β depends on mechanism of cell death. J Biol Chem
289: 15942-50. doi: 10.1074/jbc.M114.557561
53. Edwards JP, Zhang X, Frauwirth KA & Mosser DM (2006). Biochemical and
functional characterization of three activated macrophage populations. J. Leukoc.
Biol. 80:1298–1307. doi:10.1189/jlb.0406249.
54. Azad AK, Rajaram MV, Schlesinger LS (2014) Exploitation of the Macrophage
Mannose Receptor (CD206) in Infectious Disease Diagnostics and Therapeutics. J
Cytol Mol Biol. 10;1(1). pii: 1000003. doi:10.13188/2325-4653.1000003
55. Ishikawa R, Kajikawa M, Ishido S (2013) Loss of MHC II ubiquitination inhibits the
activation and differentiation of CD4 T cells. Int Immunol. 26:283-9. doi: 10.1093 /
intimm / dxt066
56. Lee SJ, Shin SJ, Lee MH, Lee MG, Kang TH, Park WS et al. (2014) A Potential
Protein Adjuvant Derived from Mycobacterium tuberculosis Rv0652 Enhances
Dendritic Cells-Based Tumor Immunotherapy. PLoS One 9(8): e104351.
doi:10.1371/journal.pone.0104351
57. Pagliari LJ, Perlman H, Liu H, Pope RM (2000) Macrophages require constitutive
NF-Kappa B activation to maintain A1 expression and mitochondrial homeostasis.
Mol Cell Biol 20:8855-65. doi: 10,1128 / MCB.20.23.8855-8865.2000
58. Jain R, Dey B, Dhar N, Rao V, Singh R, Gupta UD, et al. (2008) Enhanced and
Enduring Protection against Tuberculosis by Recombinant BCG-Ag85C and Its
Association with Modulation of Cytokine Profile in Lung. PLoS ONE 12: 1-11.
10.1371/journal.pone.0003869
59. Yu DS, Wu CL, Ping SY, Keng C, Shen KH (2015) Bacille Calmette-Guerin can
induce cellular apoptosis of urothelial cancer directly through toll-like receptor 7
activation. Kaohsiung J Med Sci 31:391-7. doi: 10.1016/j.kjms.2015.05.005.
60. Mohapatra A, Panda SK, Pradhan AK, Prusty BK, Satapathy AK and Ravindran B
(2014) Filarial antigens mediate apoptosis of human monocytes through Toll-like
receptor 4. J Infect Dis. 210:1133-44. doi: 10.1093/infdis/jiu208.
61. Li W, Deng G, Li M, Zeng J, Zhao L and You Z (2014) A recombinant adenovirus
expressing CFP10, ESAT6, Ag85A and Ag85B of Mycobacterium tuberculosis
elicits strong antigen specific immune responses in mice. Mol Immunol. 62:86-95.
doi: 10.1016/j.molimm.2014.06.007
115
62. Garcia-Pelayo MC, Bachy VS, Kaveh DA, Hogarth PJ (2015) BALB/c mice display
more enhanced BCG vaccine induced Th1 and Th17 response than C57BL/6 mice
but have equivalent protection. Tuberculosis. 95:48-53.
doi:10.1016/j.tube.2014.10.012
116
5 DISCUSSÃO
Neste trabalho foi realizado a avaliação da imunogenicidade de uma vacina
rBCG expressando a proteína de fusão CMX, a qual é composta por epítopos
imunodominantes de Ag85c_MPT51_HspX. Neste sentido, abordamos no primeiro
capítulo em um artigo de revisão algumas vacinas BCG recombinantes que foram
construídas nos últimos 5 anos, demonstranos que apesar de algumas induzirem
proteção superior a induzida por BCG a memória foi pouco explorada ou não havia
sua indução (DA COSTA, COSTA-JUNIOR ADE, DE OLIVEIRA et al., 2014). No
segundo capítulo desenvolvemos uma nova vacina rBCG-CMX que induziu boa
proteção provavelmente em virtude da população de células Th17 e Th1 específicas
para CMX (DA COSTA, NOGUEIRA, KIPNIS et al., 2014). No terceiro capítulo
demonstramos que a vacina recombinante e a proteína de fusão CMX que compõe a
BCG, modula a resposta imune favorecendo a indução de citocinas pró e anti-
inflamatórias.
Atualmente, a vacina utilizada para prevenção da TB é a BCG (Bacilo Calmette-
Guérin), uma cepa atenuada derivada de uma cepa virulenta do Mycobacterium bovis,
a qual foi atenuada após mais de 13 anos de cultura in vitro, sendo utilizada desde
1921 (Calmette et al., 1929). É uma das vacinas mais largamente administradas
mundialmente e a única vacina disponível que previne infecções contra M.
tuberculosis (RAPPUOLI & ADEREM, 2011), a qual é produzida em vários
laboratórios no mundo. Apesar de ser a única vacina aprovada para uso humano, e
conferir proteção em crianças contra meningite tuberculosa e TB miliar, seu efeito
protetor continua questionável, uma vez que não protege adultos contra TB pulmonar
(WHO, 1998; PARTNERSHIP PARTNERSHIP WST, 2010; LIENHARDT &
ZUMLA, 2005).
Apesar das cepas utilizadas mundialmente serem originadas do Mycobacterium
bovis atenuado, as mesmas podem não ser bacteriologicamente iguais, devido às
variações biológicas de cepas, que apresentam características genotípicas e fenotípicas
notavelmente diferentes, resultando em variações no que diz respeito à viabilidade,
imunogenicidade, reatogenicidade e virulência residual (BARRETO, PEREIRA,
FERREIRA, et al. 2006).
117
Atualmente estudos genômicos demonstram que a vacina BCG difere em
algumas características genéticas, e diversos estudos realizados para avaliar o nível de
proteção da BCG contra TB pulmonar apontaram, dentre outros aspectos, enorme
variação na proteção conferida, decorrentes do desenho, ou áreas geográficas onde
foram realizados. Isso tem gerado incertezas quanto à capacidade de proteção desta
vacina (BARRETO, PEREIRA, FERREIRA, et al. 2006). Em crianças, a proteção é
estimada em 52 a 100%, para a prevenção de meningite tuberculosa, e de 2 a 80% na
prevenção de tuberculose pulmonar. As causas da falha na eficiência da vacina BCG
podem estar relacionadas com os seguintes fatores: exposição prévia a micobactérias
ambientais (Black et al. 2002), variações genéticas da população ou das cepas
utilizadas como vacinas (GRODE, SEILER, BAUMANN, et al. 2005), dentre outras.
Além disso, a vacina BCG é contra indicada para pacientes HIV positivos, recém-
nascidos com peso inferior a dois quilogramas, pacientes em situação de
imunocomprometimento, mulheres grávidas e pessoas com teste tuberculínico (TST)
positivo, ou que estejam submetidos a algum tratamento prolongado com esteróides ou
drogas imunossupressoras e doenças infecciosas como sarampo e varicela (PAUL &
FINE, 2001).
A profilaxia da TB utilizando a vacina BCG apresenta algumas variações quanto
ao esquema de vacinação, sendo baseada na taxa de incidência da TB. A vacina BCG
é considerada segura, sendo administrada em recém-nascidos, estimulando uma
memória imunológica protetora considerada de longa duração. Entretanto, estudos
demonstram que a proteção da vacina, em diferentes populações, apresenta variações
que pode ser devido à relativa eficácia da BCG em crianças, o que pode ser explicada
pela indução da memória somente na idade precoce (neonatal ou infância) na qual o
sistema imune não está totalmente maduro e aumento da suscetibilidade de jovens e
adultos a co-infecção com helmintos, vírus (como HIV) (ANDERSEN & DOHERT,
2005). No Brasil, estudos realizados concluem que aqui também há uma variabilidade
na proteção, principalmente após os dez anos de imunização. Apesar dos esforços do
Programa de Controle Nacional da Tuberculose, a cobertura vacinal em crianças
menores de um ano é em torno de 90% e a incidência da TB continua alta devido a
falhas na execução e acompanhamento do tratamento dos doentes.
Em humanos, esta vacina induz resposta imune com células efetoras do tipo Th1
produtoras de IFN-γ (SOARES, SCRIBA, JOSEPH, et al. 2008; STENGER, S.;
HANSEN, D.A.; TEITEL BAUM, et al., 1998). Já foi demonstrado que o IFN-γ
118
induzido pela BCG pode contribuir para a redução na formação de células de memória
inicialmente induzida pela vacina (ABEBE, 2012). Além disso, estudos demonstram
que o IFN-γ não está diretamente relacionado com a proteção conferida pela BCG
(MITTRUCKER, STENHOOF, KOHLER, et al., 2007; ABEBE, 2012).
Apesar se acreditar que a inserção de antígenos de Mtb na BCG poderia
melhorar a memória induzida por ela, não foi o que se observou ao utilizar várias
estratégias de recombinação da vacina BCG, como demonstrado na literatura, em uma
revisão de literatura, entre os anos de 2008 a 2013. Das 24 vacinas avaliadas neste
período, apenas 10 apresentaram proteção superior a induzida por BCG. Destas, 4
eram vacinas BCGs super expressando antígenos simples não pertencentes a regiões
de virulência de Mtb, tais como, HspX, Ag85C, Ag85A e Ag85B (HOFT,
BLAZEVIC, ABATE et al., 2008; TANG, YAMADA, SHIBATA et al., 2008;
SUGAWARA, SUN, MIZUNO et al., 2009; SHI, CHEN, CHEN et al., 2010); e 1 de
região de virulência, ESAT-6 (DEY, JAIN, KHERA et al., 2009). Quanto aos demais,
3 vacinas expressando proteínas de fusão combinando região de virulência ou não
(rBCG1::Ag85B-CFP10/BCG2::Ag85B-CFP10-IL-12; rBCG-Ag85B-Mpt64-Mtb8.4;
AFRO-1, Ag85A, Ag85B e TB10.4.) (QIE, WANG, LIU et al., 2009; LIN, SU,
CHANG et al., 2012; RAHMAN, MAGALHAES, RAHMAN et al., 2012). Ademais,
1 vacina utilizou a fusão de proteínas de região de virulência (rBCG:PE-
MPT64/rBCG/HSP60MPT64) e 1 vacina apresentou expressão de listeriolisina
(rBCGΔureC::hly+) (DESEL, DORHOI, BANDERMANN et al., 2011). Dentre as
vacinas BCG que foram recombinadas com proteínas de Mtb, apesar de terem
apresentado proteção superior a induzida por BCG, apenas 4 dessas vacinas avaliaram
a indução de células de memória.
A resposta imune induzida por essas vacinas é do tipo Th1, com produção de
IFN- (HOFT, BLAZEVIC, ABATE et al., 2008; TANG, YAMADA, SHIBATA et
al., 2008; SHI, CHEN, CHEN et al., 2010; LIN, SU, CHANG et al., 2012). Não foi
avaliado exatamente qual mecanismo que as proteínas inseridas nessa vacina
proporcionaram para que houvesse a melhora na resposta imune induzida. Ao
contrário, a vacina rBCGΔureC::hly+ também apresentou indução de células de
memória, a qual induziu o balanço entre a resposta Th1 e Th17. Esta vacina foi capaz
de ativar e modular a resposta de macrófagos, nos quais induziu acentuado processo de
apoptose, como geração de piroptose, capaz de induzir resposta Th1, TCD8+ e Th17
119
(DESEL, DORHOI, BANDERMANN et al., 2011; FARINACCI, WEBER e
KAUFMANN, 2012).
No segundo artigo demonstramos que a proteína de fusão CMX é capaz de
adicionar propriedades imunogênicas importantes em vetores vacinais, induzindo
resposta efetiva no controle da infecção por Mtb em camundongos. A inserção da
proteína CMX na vacina BCG pode ter acrescentado características imunológicas
ausentes na BCG convencional, podendo induzir populações celulares importantes no
controle da infecção por Mtb. Nossos resultados demonstram que a inserção da
proteína CMX na vacina BCG recombinante (rBCG-CMX) foi um fator determinante
para indução de resposta Th1 e Th17, além de células polifuncionais que
possivelmente foram responsáveis pela redução das lesões inflamatórias no pulmão de
camundongos BALB/c , reduzindo significantemente a carga bacilar em comparação
com imunização com BCG Moreau (DA COSTA, COSTA-JUNIOR ADE, DE
OLIVEIRA et al., 2014). Especula-se que uma boa resposta induzida por vacina contra
TB tenha que haver o balanço entre as populações Th17 e Th1 (KHADER, BELL,
PEARL et al., 2007; MATSUYAMA, ISHII, YAGETA et al., 2014; GARCIA-
PELAYO, BACHY, KAVEH et al., 2015). Porém a vacina BCG também induz
resposta Th1 e Th17, porém a indução de IL-17 é muito inferior a indução de IFN-
(ARTS, BLOK, AABY et al., 2015). Tem-se tentado justificar as falhas da vacina
BCG por ser forte indutora de IFN-, esta citocina pode resultar na apoptose das
células T efetoras, reduzindo o pool de células de memória (BEHR e SMALL, 1997).
Por outro lado, as células Th1 poderiam inibir diretamente a manutenção de células
Th17, fenômeno este que pode reduzir as células Th17 e quebrar o balanço entre as
duas respostas, bem como reduzindo as células de memória (TORRADO e COOPER,
2010).
Têm-se demonstrado recentemente que os macrófagos possuem um papel
essencial na geração de resposta imune de memória, e que a indução desta resposta
inicial é preponderante para a geração de uma boa resposta vacinal (YOSHIDA,
MAEKAWA, ZHU et al., 2015). Por muito tempo acreditaram que proteínas não
pudessem interagir com a imunidade inata, porém tem sido demonstrado que muitas
proteínas o fazem, dentre elas muitas de Mtb, as quais são capazes de interagir com
receptores em macrófagos e células dendríticas, tais como TLR-4, TLR-2, CR3, dentre
outros (HETLAND e WIKER, 1994; KIM, SOHN, KIM et al., 2012) (XU, ZHANG,
SHEN et al., 2015). Têm-se tentado associar a dependência entre a geração da resposta
120
imune inata e adaptativa. A interação de proteínas com TLR-2 tem sido associado com
a geração de uma resposta Th2, como a proteína ESAT-6, justificando a indução de
uma resposta Th17 (CHATTERJEE, DWIVEDI, SINGH et al., 2011). Porém, a
interação com o TLR-2 parece estar associado a proteínas de região de virulência, tais
como ESAT-6, PE35, PPE68, CFP (CHATTERJEE, DWIVEDI, SINGH et al., 2011;
TIWARI, SOORY e RAGHUNAND, 2014). Conquanto, as demais proteínas que não
estão contidas em região de virulência perecem interagir com TLR-4, como observado
com a proteína Rv0652 (KIM, SOHN, KIM et al., 2012), bem como as proteínas
analisadas neste trabalho, sendo essas Ag85c, MPT51 e HspX. No modelo vacinal
apresentado neste trabalho, a proteína de fusão CMX (Ag85c_MPT51_HspX) parece
interagir com TLR-4 em macrófagos e induzir a produção de citocinas importantes na
geração de uma resposta imune pró e anti-inflamatória.
No terceiro artigo aqui avaliado, foi observado que estas proteínas são capazes de
induzir produção de citocinas TGF- e IL-6, as quais participam na geração de células
Th17 (MURANSKI, BORMAN, KERKAR et al., 2011). Recentemente foi
demonstrado que o TLR-4, bem como receptor de manose (MR) participam diretamente
na geração de células Th17 e Tc17 em infecção por Paracoccidioides brasiliensis
(LOURES, ARAUJO, FERIOTTI et al., 2015). Portanto, a interação da rCMX com
TLR-4, promovendo a geração de TGF- e IL-6, pode ter proporcionado a geração de
resposta imune Th17 específica.
Com o intuito de demonstrar se existe alguma relação entre a interação de CMX
com TLRs e a capacidade de indução de Th1 e Th17 por rBCG-CMX, realizamos
imunização de camundongos C57BL/6, TLR-2 KO e TLR-4 KO. Nossos resultados
demonstram que ao ser expressa pela vacina rBCG após imunização, a proteina CMX
induz linfócitos TCD4+IFN-+ e TCD4+IL-17 em baço de camundongos C57BL/6,
porém na ausência de TLR-2 e TLR-4, não há indução dessas populacõess celulares.
Anteriormente demonstramos que a proteína CMX interage com o TLR-4 mas não com
o TLR-2 para induzir IL-6, porém não havíamos observado se o TLR-4 e TLR-2 estava
relacionado com a indução de outras citocinas importantes para indução de Th1 e Th17,
como IL-12 e TGF-β (HASAN, M.; NEUMANN, B.; HAUPELTSHOFER et al. 2005).
Esse dado poderia justificar a importância dos receptors TLR-2 e TLR-4 na indução dos
linfócitos Th1 e Th17 após imunização com a vacina rBCG-CMX. Apesar de não
possuirmos esses dados, tem sido demonstrado na literature que Mtb depende do TLR-2
121
e TLR-9 para induzir resposta Th1, sendo que esses receptors podem estar ralacionados
com a resistência de Mtb (BAFICA, SCANGA, FENG et al. 2005). Outra trabalho tem
enfatizado que ESAT-6 favorece a indução de Th17 e inibe a indução de Th1 por meio
da interação com TLR-2 (WANG, BARNES, HUANG et al. 2012). Sendo assim,
podemos inferir que a proteína CMX depende de TLR-2 e TLR-4 para promover a
indução de Th1 e Th17 quando expressa por rBCG-CMX.
Diante dos resultados obtidos neste trabalho, propomos que a proteina rCMX
interage com o TLR-4, podendo induzir a ativação do fator de transcrição NF-κβ,
culminando na produção das citocinas IL-6 e TFG-β. Estas duas citocinas promovem a
diferenciação de Th17, fenômeno este que ocorreu após imunização com a vacina
rBCG-CMX (da Costa et al. 2014). Quando rCMX é expressa por rBCG, ocorre a
interação desta com TLR-4, bem como a ativação de macrófagos, com aumento na
expressão de CD206, apesar de manter a expressão de CD86 (Figura 8). Além disso a
indução de apoptose com corpos apoptóticos pode melhorar a indução da resposta
adaptativa, favorecendo a indução de Th1 e Th17.
122
Figure 8. Modelo de indução de Th17 por rBCG-CMX. Proteína rCMX interage
com TLR-4 em macrófagos e induz a ativação de NF-kB. Esta ativação promove a
indução de IL-1α, TGF-β e IL-6. A vacina rBCG-CMX induz mais expressão de CD206
e semelhante indução da expressão de CD86. A proteína rCMX expressa por BCG
promoveu a esta vacina a capacidade de induzir mais produção dessas citocinas in vivo
que a vacina BCG, promovendo um microambiente para indução de resposta imune
Th17. Apoptotics bodies ; CD206+ Molecules; CD86+ Molecules;
Interleukin 6 (IL-6); TGF-; Interleukin 1 alfa (IL-); rCMX
Protein.
No presente trabalho, tem-se observado uma indução tanto de células Th17 quanto
de células Th1. A proteção induzida pelas duas vacinas é semelhante, porém, quando se
utiliza o booster com a proteína de fusão rCMX, a proteção melhora consideravelmente
(DA COSTA, COSTA-JUNIOR ADE, DE OLIVEIRA et al., 2014). O booster com a
proteína de fusão pode ter induzido a proliferação de células Th1 e Th17,
proporcionando melhor eficácia da vacina, bem como o aumento no pool de células de
memória (LI CAUSI, PARIKH, CHUDLEY et al., 2015). Mais trabalhos seriam
necessários para a avaliação de células de memória induzido pela vacina rBCG-CMX.
Não sabemos como esta vacina se comportaria em humanos, uma vez que a
atuação das células Th17 em humanos e camundongos apresentam aspectos diferentes.
Nos camundongos, sabe-se que essas células apresentam um papel protetor contra
bactérias extracelulares e fungos, por induzirem neutrofilia. No caso da resposta ao
Mtb também parece ser crucial tanto na formação do granuloma quanto na adequação
da inflamação necessária para a eliminação do agente (OUYANG, W.; KOLI, JK.;
ZHENG Y., 2008). Em humanos, as células Th17 apresentam maior plasticidade,
podendo se diferenciar em vários tipos celulares, como Th1, Th2, Th17/2, Th17/1. As
células Th17/2, por exemplo, podem secretar IL-17 e IL-4, apresentando a capacidade
de sobreviver por mais tempo, como uma célula de memória. Neste sentido, enquanto
ensaios clínicos não sejam realizados para verificar se esta ou outras vacinas contra TB
geram células Th17 em humanos, as vantagens da indução destas células ainda deverá
ser melhor estudada (COSMI, MAGGI, SANTARLASCI et al. 2010).
IL-6 TGF-β IL-1a
123
6. CONCLUSÕES
Neste trabalho foi avaliado a resposta imune induzida por uma vacina BCG
recombinante expressando a proteína CMX, a qual representa os epítopos
imunodominantes do Ag85C, MPT51 e HspX de Mycobacterium tuberculosis. Após
fazer um panorama das vacinas construídas mundialmente e avaliar a eficácia da vacina
rBCG-CMX em modelo murino, bem como seu mecanismo imune, concluiu-se que:
Uma nova vacina rBCG-CMX foi desenvolvida e esta foi boa indutora de resposta
imune Th1 e Th17, corroborando com uma proteção superior a induzida por BCG.
A proteína rCMX modula a resposta induzida pela vacina BCG, bem como seu
microambiente, favorecendo a indução de citocinas pró-inflamatórias (IL-6) e anti-
inflamatória (TGF-β), por uma via em que há a participação de TLR-4 .
124
7 REFERÊNCIAS
ABEBE, F. Is interferon-gamma the right marker for bacille Calmette-Guérin-induced
immune protection? The missing link in our understanding of tuberculosis immunology.
Clin Exp Immunol, v. 169, n. 3, p. 213-9. Sept, 2012. Disponível em:
http://www.ncbi.nlm.nih.gov/pubmed/
ANDERSEN, P.; DOHERTY, T.M. The success and failiure of BCG- implications for a
novel tuberculosis vaccine. Nat Rev Microbiol, v.3, n.8, p.656-662. Aug, 2005.
http://www.ncbi.nlm.nih.gov/pubmed/.
ARMSTRONG, J. A.; HART, P. D. Phagosome-lysosome interactions in cultured
macrophages infected with virulent tubercle bacilli. Reversal of the usual nonfusion
pattern and observations on bacterial survival. J Exp Med, v. 142, n. 1, p. 1-16, Jul 1,
1975. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/807671>.
ARTS, R. J.; BLOK, B. A.; AABY, P.; JOOSTEN, L. A. et al. Long-term in vitro and
in vivo effects of gamma-irradiated BCG on innate and adaptive immunity. J Leukoc
Biol, Jun 16, 2015. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/26082519>.
ATHMAN, J. J.; WANG, Y.; MCDONALD, D. J.; BOOM, W. H. et al. Bacterial
Membrane Vesicles Mediate the Release of Mycobacterium tuberculosis Lipoglycans
and Lipoproteins from Infected Macrophages. J Immunol, v. 195, n. 3, p. 1044-53, Aug
1, 2015. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/26109643>.
BAFICA, A.; SCANGA, C.A.; FENG, C.G.; LEIFER, C.; CHEEVER, A.; SHER, A.
TLR9 regulates Th1 responses and cooperates with TLR2 in mediating optimal
resistance to Mycobacterium tuberculosis. J. Exp. Med.; v. 202, p. 1715–1724. Dec,
2005. Disponível em: http://www.ncbi.nlm.nih.gov/pubmed/.
BAI, W.; LIU, H.; JI, Q.; ZHOU, Y. et al. TLR3 regulates mycobacterial RNA-induced
IL-10 production through the PI3K/AKT signaling pathway. Cell Signal, v. 26, n. 5, p.
942-50, May, 2014. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/24462705>.
BARRETO, M. L.; PEREIRA, S. M.; FERREIRA, A. A. BCG vaccine: efficacy and
indications for vaccination and revaccination. J Pediatr (Rio J), v. 82, n. 3 Suppl, p.
S45-54, Jul, 2006. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/16826312>.
BEHR, M. A.; SMALL, P. M. Has BCG attenuated to impotence? Nature, v. 389, n.
6647, p. 133-4, Sep 11, 1997. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/9296487>.
125
BOWDISH, D. M.; SAKAMOTO, K.; KIM, M. J.; KROOS, M. et al. MARCO, TLR2,
and CD14 are required for macrophage cytokine responses to mycobacterial trehalose
dimycolate and Mycobacterium tuberculosis. PLoS Pathog, v. 5, n. 6, p. e1000474,
Jun, 2009. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/19521507>.
CHANG, Z.; PRIMM, T. P.; JAKANA, J.; LEE, I. H. et al. Mycobacterium
tuberculosis 16-kDa antigen (Hsp16.3) functions as an oligomeric structure in vitro to
suppress thermal aggregation. J Biol Chem, v. 271, n. 12, p. 7218-23, Mar 22, 1996.
Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/8636160>.
CHATTERJEE, S.; DWIVEDI, V. P.; SINGH, Y.; SIDDIQUI, I. et al. Early secreted
antigen ESAT-6 of Mycobacterium tuberculosis promotes protective T helper 17 cell
responses in a toll-like receptor-2-dependent manner. PLoS Pathog, v. 7, n. 11, p.
e1002378, Nov, 2011. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/22102818>.
CHOI, HG.; KIM, WS.; BACK, YW.; KIM, H. et al. Mycobacterium tuberculosis RpfE
promotes simultaneous Th1- and Th17-type T-cell immunity via TLR4-dependent
maturation of dendritic cells. Eur J Immunol. v. 45, p. 1957-71, Julho, 2015.
Disponível em:http://www.ncbi.nlm.nih.gov/pubmed/
COSMA, C. L.; SHERMAN, D. R.; RAMAKRISHNAN, L. The secret lives of the
pathogenic mycobacteria. Annu Rev Microbiol, v. 57, p. 641-76, 2003. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/14527294>.
COSMI, L.; MAGGI, L.; SANTARLASCI, V.; CAPONE, M. et al. Identification of a
novel subset of human circulating memory CD4(+) T cells that produce both IL-17A
and IL-4. J Allergy Clin Immunol, v. 125, p. 222-30, Jan, 2010. Disponível em: <
http://www.ncbi.nlm.nih.gov/pubmed>.
CRUZ, A.; FRAGA, A. G.; FOUNTAIN, J. J.; RANGEL-MORENO, J. et al.
Pathological role of interleukin 17 in mice subjected to repeated BCG vaccination after
infection with Mycobacterium tuberculosis. J Exp Med, v. 207, n. 8, p. 1609-16, Aug
2, 2010. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/20624887>.
DA COSTA, A. C.; COSTA-JUNIOR ADE, O.; DE OLIVEIRA, F. M.; NOGUEIRA,
S. V. et al. A new recombinant BCG vaccine induces specific Th17 and Th1 effector
cells with higher protective efficacy against tuberculosis. PLoS One, v. 9, n. 11, p.
e112848, 2014. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/25398087>.
DA COSTA, A. C.; NOGUEIRA, S. V.; KIPNIS, A.; JUNQUEIRA-KIPNIS, A. P.
Recombinant BCG: Innovations on an Old Vaccine. Scope of BCG Strains and
Strategies to Improve Long-Lasting Memory. Front Immunol, v. 5, p. 152, 2014.
Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/24778634>.
DANNENBERG, A. M., JR. Immune mechanisms in the pathogenesis of pulmonary
tuberculosis. Rev Infect Dis, v. 11 Suppl 2, p. S369-78, Mar-Apr, 1989. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/2496453>.
126
______. Delayed-type hypersensitivity and cell-mediated immunity in the pathogenesis
of tuberculosis. Immunol Today, v. 12, n. 7, p. 228-33, Jul, 1991. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/1822092>.
DAVIS, J. M.; RAMAKRISHNAN, L. The role of the granuloma in expansion and
dissemination of early tuberculous infection. Cell, v. 136, n. 1, p. 37-49, Jan 9, 2009.
Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/19135887>.
DESEL, C.; DORHOI, A.; BANDERMANN, S.; GRODE, L. et al. Recombinant BCG
DeltaureC hly+ induces superior protection over parental BCG by stimulating a
balanced combination of type 1 and type 17 cytokine responses. J Infect Dis, v. 204, n.
10, p. 1573-84, Nov 15, 2011. Disponível em:
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3192191/
DEY, B.; JAIN, R.; KHERA, A.; RAO, V. et al. Boosting with a DNA vaccine
expressing ESAT-6 (DNAE6) obliterates the protection imparted by recombinant BCG
(rBCGE6) against aerosol Mycobacterium tuberculosis infection in guinea pigs.
Vaccine, v. 28, n. 1, p. 63-70, Dec 10, 2009. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/19835824>.
ESPARZA, M.; PALOMARES, B.; GARCIA, T.; ESPINOSA, P. et al. PstS-1, the 38-
kDa Mycobacterium tuberculosis glycoprotein, is an adhesin, which binds the
macrophage mannose receptor and promotes phagocytosis. Scand J Immunol, v. 81, n.
1, p. 46-55, Jan, 2015. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/25359607>.
FARINACCI, M.; WEBER, S.; KAUFMANN, S. H. The recombinant tuberculosis
vaccine rBCG DeltaureC::hly(+) induces apoptotic vesicles for improved priming of
CD4(+) and CD8(+) T cells. Vaccine, v. 30, n. 52, p. 7608-14, Dec 14, 2012.
Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/23088886>.
FINK, S. L.; COOKSON, B. T. Apoptosis, pyroptosis, and necrosis: mechanistic
description of dead and dying eukaryotic cells. Infect Immun, v. 73, n. 4, p. 1907-16,
Apr, 2005. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/15784530>.
FISHBEIN, S.; VAN WYK, N.; WARREN, R. M.; SAMPSON, S. L. Phylogeny to
function: PE/PPE protein evolution and impact on Mycobacterium tuberculosis
pathogenicity. Mol Microbiol, v. 96, n. 5, p. 901-16, Jun, 2015. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/25727695>.
FLYNN, J. L.; CHAN, J. Immunology of tuberculosis. Annu Rev Immunol, v. 19, p.
93-129, 2001. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/11244032>.
GARCIA-PELAYO, M. C.; BACHY, V. S.; KAVEH, D. A.; HOGARTH, P. J.
BALB/c mice display more enhanced BCG vaccine induced Th1 and Th17 response
than C57BL/6 mice but have equivalent protection. Tuberculosis (Edinb), v. 95, n. 1,
p. 48-53, Jan, 2015. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/25467292>.
127
GATFIELD, J.; PIETERS, J. Essential role for cholesterol in entry of mycobacteria into
macrophages. Science, v. 288, n. 5471, p. 1647-50, Jun 2, 2000. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/10834844>.
GEISSMANN, F.; MANZ, M. G.; JUNG, S.; SIEWEKE, M. H. et al. Development of
monocytes, macrophages, and dendritic cells. Science, v. 327, n. 5966, p. 656-61, Feb
5, 2010. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/20133564>.
GEROSA, F.; BALDANI-GUERRA, B.; LYAKH, L. A.; BATONI, G. et al.
Differential regulation of interleukin 12 and interleukin 23 production in human
dendritic cells. J Exp Med, v. 205, n. 6, p. 1447-61, Jun 9, 2008. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/18490488>.
GONZALEZ-JUARRERO, M.; HATTLE, J. M.; IZZO, A.; JUNQUEIRA-KIPNIS, A.
P. et al. Disruption of granulocyte macrophage-colony stimulating factor production in
the lungs severely affects the ability of mice to control Mycobacterium tuberculosis
infection. J Leukoc Biol, v. 77, n. 6, p. 914-22, Jun, 2005. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/15767289>.
GORIELY, S.; NEURATH, M. F.; GOLDMAN, M. How microorganisms tip the
balance between interleukin-12 family members. Nat Rev Immunol, v. 8, n. 1, p. 81-6,
Jan, 2008. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/18084185>.
GRODE, L.; SEILER, P.; BAUMANN, S.; HESS, J. et al. Increased vaccine efficacy
against tuberculosis of recombinant Mycobacterium bovis bacille Calmette-Guerin
mutants that secrete listeriolysin. J Clin Invest, v. 115, n. 9, p. 2472-9, Sep, 2005.
Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/16110326>.
HASAN, M.; NEUMANN, B.; HAUPELTSHOFER, S.; STALKE, S.; FANTINI, M.C.;
ANGSTWURM, K. et al. Activation of TGF-β-inducing non-SMAD signaling
pathways during Th17 differentiation. Immunol Cell Biol, v. 93, n. 7, p. 662-72. Aug,
2015. Disponível em: http://www.ncbi.nlm.nih.gov/pubmed/.
HARTH, G.; HORWITZ, M. A.; TABATADZE, D.; ZAMECNIK, P. C. Targeting the
Mycobacterium tuberculosis 30/32-kDa mycolyl transferase complex as a therapeutic
strategy against tuberculosis: Proof of principle by using antisense technology. Proc
Natl Acad Sci U S A, v. 99, n. 24, p. 15614-9, Nov 26, 2002. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/12427974>.
HARTL, F. U.; BRACHER, A.; HAYER-HARTL, M. Molecular chaperones in protein
folding and proteostasis. Nature, v. 475, n. 7356, p. 324-32, Jul 21, 2011. Disponível
em: <http://www.ncbi.nlm.nih.gov/pubmed/21776078>.
HETLAND, G.; WIKER, H. G. Antigen 85C on Mycobacterium bovis, BCG and M.
tuberculosis promotes monocyte-CR3-mediated uptake of microbeads coated with
mycobacterial products. Immunology, v. 82, n. 3, p. 445-9, Jul, 1994. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/7959881>.
HOFT, D. F.; BLAZEVIC, A.; ABATE, G.; HANEKOM, W. A. et al. A new
recombinant bacille Calmette-Guerin vaccine safely induces significantly enhanced
128
tuberculosis-specific immunity in human volunteers. J Infect Dis, v. 198, n. 10, p.
1491-501, Nov 15, 2008. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/18808333>.
IGIETSEME, J. U.; EKO, F. O.; HE, Q.; BLACK, C. M. Antibody regulation of Tcell
immunity: implications for vaccine strategies against intracellular pathogens. Expert
Rev Vaccines, v. 3, n. 1, p. 23-34, Feb, 2004. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/14761241>.
JUNQUEIRA-KIPNIS, A. P.; KIPNIS, A.; JAMIESON, A.; JUARRERO, M. G. et al.
NK cells respond to pulmonary infection with Mycobacterium tuberculosis, but play a
minimal role in protection. J Immunol, v. 171, n. 11, p. 6039-45, Dec 1, 2003.
http://www.ncbi.nlm.nih.gov/pubmed/
KAUFMANN, S. H.; HUSSEY, G.; LAMBERT, P. H. New vaccines for tuberculosis.
Lancet, v. 375, n. 9731, p. 2110-9, Jun 12, 2010. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/20488515>.
KHADER, S. A.; BELL, G. K.; PEARL, J. E.; FOUNTAIN, J. J. et al. IL-23 and IL-17
in the establishment of protective pulmonary CD4+ T cell responses after vaccination
and during Mycobacterium tuberculosis challenge. Nat Immunol, v. 8, n. 4, p. 369-77,
Apr, 2007. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/17351619>.
KIM, K.; SOHN, H.; KIM, J. S.; CHOI, H. G. et al. Mycobacterium tuberculosis
Rv0652 stimulates production of tumour necrosis factor and monocytes chemoattractant
protein-1 in macrophages through the Toll-like receptor 4 pathway. Immunology, v.
136, n. 2, p. 231-40, Jun, 2012. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/22385341>.
KIM, M. J.; WAINWRIGHT, H. C.; LOCKETZ, M.; BEKKER, L. G. et al. Caseation
of human tuberculosis granulomas correlates with elevated host lipid metabolism.
EMBO Mol Med, v. 2, n. 7, p. 258-74, Jul, 2010. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/20597103>.
KITAURA, H.; OHARA, N.; NAITO, M.; KOBAYASHI, K. et al. Fibronectin-binding
proteins secreted by Mycobacterium avium. APMIS, v. 108, n. 9, p. 558-64, Sep, 2000.
Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/11110042>.
KUMAR, A.; LEWIN, A.; RANI, P. S.; QURESHI, I. A. et al. Dormancy Associated
Translation Inhibitor (DATIN/Rv0079) of Mycobacterium tuberculosis interacts with
TLR2 and induces proinflammatory cytokine expression. Cytokine, v. 64, n. 1, p. 258-
64, Oct, 2013. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/23819907>.
LEE, S. J.; SHIN, S. J.; LEE, M. H.; LEE, M. G. et al. A potential protein adjuvant
derived from Mycobacterium tuberculosis Rv0652 enhances dendritic cells-based tumor
immunotherapy. PLoS One, v. 9, n. 8, p. e104351, 2014. Disponível em:
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0104351
LI CAUSI, E.; PARIKH, S. C.; CHUDLEY, L.; LAYFIELD, D. M. et al. Vaccination
Expands Antigen-Specific CD4+ Memory T Cells and Mobilizes Bystander Central
129
Memory T Cells. PLoS One, v. 10, n. 9, p. e0136717, 2015. Disponível em:
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0136717
LIM, Y. J.; CHOI, J. A.; LEE, J. H.; CHOI, C. H. et al. Mycobacterium tuberculosis
38-kDa antigen induces endoplasmic reticulum stress-mediated apoptosis via toll-like
receptor 2/4. Apoptosis, v. 20, n. 3, p. 358-70, Mar, 2015. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/25544271>.
LIN, C. W.; SU, I. J.; CHANG, J. R.; CHEN, Y. Y. et al. Recombinant BCG
coexpressing Ag85B, CFP10, and interleukin-12 induces multifunctional Th1 and
memory T cells in mice. APMIS, v. 120, n. 1, p. 72-82, Jan, 2012. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/22151310>.
LOCKHART, E.; GREEN, A. M.; FLYNN, J. L. IL-17 production is dominated by
gammadelta T cells rather than CD4 T cells during Mycobacterium tuberculosis
infection. J Immunol, v. 177, n. 7, p. 4662-9, Oct 1, 2006. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/16982905>.
LOPES, R. L.; BORGES, T. J.; ARAUJO, J. F.; PINHO, N. G. et al. Extracellular
mycobacterial DnaK polarizes macrophages to the M2-like phenotype. PLoS One, v. 9,
n. 11, p. e113441, 2014. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/25419575>.
LOURES, F. V.; ARAUJO, E. F.; FERIOTTI, C.; BAZAN, S. B. et al. TLR-4
cooperates with Dectin-1 and mannose receptor to expand Th17 and Tc17 cells induced
by Paracoccidioides brasiliensis stimulated dendritic cells. Front Microbiol, v. 6, p.
261, 2015. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/25873917>.
MA, C.; LI, Y.; LI, M.; DENG, G. et al. microRNA-124 negatively regulates TLR
signaling in alveolar macrophages in response to mycobacterial infection. Mol
Immunol, v. 62, n. 1, p. 150-8, Nov, 2014. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/24995397>.
MAGLIONE, P. J.; CHAN, J. How B cells shape the immune response against
Mycobacterium tuberculosis. Eur J Immunol, v. 39, n. 3, p. 676-86, Mar, 2009.
Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/19283721>.
MALEN, H.; SOFTELAND, T.; WIKER, H. G. Antigen analysis of Mycobacterium
tuberculosis H37Rv culture filtrate proteins. Scand J Immunol, v. 67, n. 3, p. 245-52,
Mar, 2008. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/18208443>.
Mavrici D, Prigozhin DM, and Alber T 2014. Mycobacterium tuberculosis RpfE crystal
structure reveals a positively charged catalytic cleft. Protein Sci. 23: 481–487.
Disponível em: http://www.ncbi.nlm.nih.gov/pubmed/24452911
MATSUYAMA, M.; ISHII, Y.; YAGETA, Y.; OHTSUKA, S. et al. Role of Th1/Th17
balance regulated by T-bet in a mouse model of Mycobacterium avium complex disease.
J Immunol, v. 192, n. 4, p. 1707-17, Feb 15, 2014. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/24446514>.
130
BRASIL, Ministério da Saúde. Banco de dados do Sistema Único de Saúde-
DATASUS. 2015. [acesso em 2015 set 22]. Disponível em http://www.datasus.gov.br.
MITTRUCKER, H.W.; STENHOOF, U.; KOHLER, A.; KRAUSE, M.; LAZAR, D. et
al. Poor correlation between BCG vaccination-induced T cell response and protection
against tuberculosis. Proc Natl Acad A Sci USA, v. 104, p.12434–124. Jul, 2007.
Disponível em: http://www.ncbi.nlm.nih.gov/pubmed/.
MURANSKI, P.; BORMAN, Z. A.; KERKAR, S. P.; KLEBANOFF, C. A. et al. Th17
cells are long lived and retain a stem cell-like molecular signature. Immunity, v. 35, n.
6, p. 972-85, Dec 23, 2011. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/22177921>.
NORTH, R. J.; JUNG, Y. J. Immunity to tuberculosis. Annu Rev Immunol, v. 22, p.
599-623, 2004. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/15032590>.
OHARA, N.; OHARA-WADA, N.; KITAURA, H.; NISHIYAMA, T. et al. Analysis of
the genes encoding the antigen 85 complex and MPT51 from Mycobacterium avium.
Infect Immun, v. 65, n. 9, p. 3680-5, Sep, 1997. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/9284137>.
OTTENHOFF, T. H. Overcoming the global crisis: "yes, we can", but also for TB ... ?
Eur J Immunol, v. 39, n. 8, p. 2014-20, Aug, 2009. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/19672895>.
OUYANG, W.; KOLI, JK.; ZHENG Y. The biological functions of T helper 17 cell
effector cytokines in inflammation. Immunity, v. 28, p. 454-67, Apr 2008. Disponível
em: http://www.ncbi.nlm.nih.gov/pubmed/18400188
______. New pathways of protective and pathological host defense to mycobacteria.
Trends Microbiol, v. 20, n. 9, p. 419-28, Sep, 2012. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/22784857>.
PARVEEN, N.; VARMAN, R.; NAIR, S.; DAS, G. et al. Endocytosis of
Mycobacterium tuberculosis heat shock protein 60 is required to induce interleukin-10
production in macrophages. J Biol Chem, v. 288, n. 34, p. 24956-71, Aug 23, 2013.
Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/23846686>.
PATHAK, S. K.; BASU, S.; BASU, K. K.; BANERJEE, A. et al. Direct extracellular
interaction between the early secreted antigen ESAT-6 of Mycobacterium tuberculosis
and TLR2 inhibits TLR signaling in macrophages. Nat Immunol, v. 8, n. 6, p. 610-8,
Jun, 2007. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/17486091>.
PEDROZA-GONZALEZ, A.; GARCIA-ROMO, G. S.; AGUILAR-LEON, D.;
CALDERON-AMADOR, J. et al. In situ analysis of lung antigen-presenting cells
during murine pulmonary infection with virulent Mycobacterium tuberculosis. Int J
Exp Pathol, v. 85, n. 3, p. 135-45, Jun, 2004. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/15255967>.
131
PETERSON, P. K.; GEKKER, G.; HU, S.; SHENG, W. S. et al. CD14 receptor-
mediated uptake of nonopsonized Mycobacterium tuberculosis by human microglia.
Infect Immun, v. 63, n. 4, p. 1598-602, Apr, 1995. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/7534279>.
PEYRON, P.; VAUBOURGEIX, J.; POQUET, Y.; LEVILLAIN, F. et al. Foamy
macrophages from tuberculous patients' granulomas constitute a nutrient-rich reservoir
for M. tuberculosis persistence. PLoS Pathog, v. 4, n. 11, p. e1000204, Nov, 2008.
Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/19002241>.
PRADOS-ROSALES, R.; BAENA, A.; MARTINEZ, L. R.; LUQUE-GARCIA, J. et
al. Mycobacteria release active membrane vesicles that modulate immune responses in a
TLR2-dependent manner in mice. J Clin Invest, v. 121, n. 4, p. 1471-83, Apr, 2011.
Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/21364279>.
QAMRA, R.; MANDE, S. C.; COATES, A. R.; HENDERSON, B. The unusual
chaperonins of Mycobacterium tuberculosis. Tuberculosis (Edinb), v. 85, n. 5-6, p.
385-94, Sep-Nov, 2005. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/16253564>.
QIE, Y. Q.; WANG, J. L.; LIU, W.; SHEN, H. et al. More vaccine efficacy studies on
the recombinant Bacille Calmette-Guerin co-expressing Ag85B, Mpt64 and Mtb8.4.
Scand J Immunol, v. 69, n. 4, p. 342-50, Apr, 2009. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/19284499>.
RAHMAN, S.; MAGALHAES, I.; RAHMAN, J.; AHMED, R. K. et al. Prime-boost
vaccination with rBCG/rAd35 enhances CD8 (+) cytolytic T-cell responses in lesions
from Mycobacterium tuberculosis-infected primates. Mol Med, v. 18, p. 647-58, 2012.
Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/22396020>.
RANDHAWA, A. K.; ZILTENER, H. J.; MERZABAN, J. S.; STOKES, R. W. CD43 is
required for optimal growth inhibition of Mycobacterium tuberculosis in macrophages
and in mice. J Immunol, v. 175, n. 3, p. 1805-12, Aug 1, 2005. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/16034122>.
RAPPUOLI, R.; ADEREM, A. A 2020 vision for vaccines against HIV, tuberculosis
and malaria. Nature, v. 473, n. 7348, p. 463-9, May 26, 2011. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/21614073>.
RELJIC, R.; IVANYI, J. A case for passive immunoprophylaxis against tuberculosis.
Lancet Infect Dis, v. 6, n. 12, p. 813-8, Dec, 2006. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/17123901>.
RUSSELL, D. G.; MWANDUMBA, H. C.; RHOADES, E. E. Mycobacterium and the
coat of many lipids. J Cell Biol, v. 158, n. 3, p. 421-6, Aug 5, 2002. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/12147678>.
SANKI, A. K.; BOUCAU, J.; RONNING, D. R.; SUCHECK, S. J. Antigen 85C-
mediated acyl-transfer between synthetic acyl donors and fragments of the arabinan.
132
Glycoconj J, v. 26, n. 5, p. 589-96, Jul, 2009. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/19052863>.
SCHAIBLE, U. E.; WINAU, F.; SIELING, P. A.; FISCHER, K. et al. Apoptosis
facilitates antigen presentation to T lymphocytes through MHC-I and CD1 in
tuberculosis. Nat Med, v. 9, n. 8, p. 1039-46, Aug, 2003. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/12872166>.
SCHUURHUIS, D. H.; VAN MONTFOORT, N.; IOAN-FACSINAY, A.; JIAWAN, R.
et al. Immune complex-loaded dendritic cells are superior to soluble immune complexes
as antitumor vaccine. J Immunol, v. 176, n. 8, p. 4573-80, Apr 15, 2006. Disponível
em: <http://www.ncbi.nlm.nih.gov/pubmed/16585547>.
SEIMON, T. A.; KIM, M. J.; BLUMENTHAL, A.; KOO, J. et al. Induction of ER
stress in macrophages of tuberculosis granulomas. PLoS One, v. 5, n. 9, p. e12772,
2010. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/20856677>.
SHI, C.; CHEN, L.; CHEN, Z.; ZHANG, Y. et al. Enhanced protection against
tuberculosis by vaccination with recombinant BCG over-expressing HspX protein.
Vaccine, v. 28, n. 32, p. 5237-44, Jul 19, 2010. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/20538090>.
SOARES, A.P.; SCRIBA, T.J.; JOSEPH, S.; HARBACHEUSKI, R.; MURRAY, R.A.
et al. Bacille Calmette–Guérin vaccination of human newborns induces T cells with
complex cytokine and phenotype profiles. J Immunol, v. 180, n. 8, p. 3569–77, Mar,
2008. Disponível em: http://www.ncbi.nlm.nih.gov/pubmed/
SORENSEN, A. L.; NAGAI, S.; HOUEN, G.; ANDERSEN, P. et al. Purification and
characterization of a low-molecular-mass T-cell antigen secreted by Mycobacterium
tuberculosis. Infect Immun, v. 63, n. 5, p. 1710-7, May, 1995. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/7729876>.
STENGER, S.; HANSEN, D.A.; TEITEL BAUM, R.; DEWAN, P.; NIAZI, K.R. et al.
An antimicrobial activity of cytolytic T cells mediated by granulysin. Science, v. 282, n.
2, p. 121–5, Oct, 1988. Disponível em: http://www.ncbi.nlm.nih.gov/pubmed/9756476
STURGILL-KOSZYCKI, S.; SCHLESINGER, P. H.; CHAKRABORTY, P.;
HADDIX, P. L. et al. Lack of acidification in Mycobacterium phagosomes produced by
exclusion of the vesicular proton-ATPase. Science, v. 263, n. 5147, p. 678-81, Feb 4,
1994. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/8303277>.
SU, H.; KONG, C.; ZHU, L.; HUANG, Q. et al. PPE26 induces TLR2-dependent
activation of macrophages and drives Th1-type T-cell immunity by triggering the cross-
talk of multiple pathways involved in the host response. Oncotarget, Oct 2, 2015.
Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/26439698>.
SUGAWARA, I.; SUN, L.; MIZUNO, S.; TANIYAMA, T. Protective efficacy of
recombinant BCG Tokyo (Ag85A) in rhesus monkeys (Macaca mulatta) infected
intratracheally with H37Rv Mycobacterium tuberculosis. Tuberculosis (Edinb), v. 89,
133
n. 1, p. 62-7, Jan, 2009. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/19028143>.
TANG, C.; YAMADA, H.; SHIBATA, K.; MAEDA, N. et al. Efficacy of recombinant
bacille Calmette-Guerin vaccine secreting interleukin-15/antigen 85B fusion protein in
providing protection against Mycobacterium tuberculosis. J Infect Dis, v. 197, n. 9, p.
1263-74, May 1, 2008. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/18422438>.
TIWARI, B.; SOORY, A.; RAGHUNAND, T. R. An immunomodulatory role for the
Mycobacterium tuberculosis region of difference 1 locus proteins PE35 (Rv3872) and
PPE68 (Rv3873). FEBS J, v. 281, n. 6, p. 1556-70, Mar, 2014. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/24467650>.
TOBIAN, A. A.; CANADAY, D. H.; HARDING, C. V. Bacterial heat shock proteins
enhance class II MHC antigen processing and presentation of chaperoned peptides to
CD4+ T cells. J Immunol, v. 173, n. 8, p. 5130-7, Oct 15, 2004. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/15470057>.
TORRADO, E.; COOPER, A. M. IL-17 and Th17 cells in tuberculosis. Cytokine
Growth Factor Rev, v. 21, n. 6, p. 455-62, Dec, 2010. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/21075039>.
ULRICHS, T.; KAUFMANN, S. H. New insights into the function of granulomas in
human tuberculosis. J Pathol, v. 208, n. 2, p. 261-9, Jan, 2006. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/16362982>.
VELDHOEN, M.; HOCKING, R. J.; ATKINS, C. J.; LOCKSLEY, R. M. et al.
TGFbeta in the context of an inflammatory cytokine milieu supports de novo
differentiation of IL-17-producing T cells. Immunity, v. 24, n. 2, p. 179-89, Feb, 2006.
Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/16473830>.
VOLKMAN, H. E.; CLAY, H.; BEERY, D.; CHANG, J. C. et al. Tuberculous
granuloma formation is enhanced by a mycobacterium virulence determinant. PLoS
Biol, v. 2, n. 11, p. e367, Nov, 2004. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/15510227>.
VOSKUIL, M. I.; VISCONTI, K. C.; SCHOOLNIK, G. K. Mycobacterium tuberculosis
gene expression during adaptation to stationary phase and low-oxygen dormancy.
Tuberculosis (Edinb), v. 84, n. 3-4, p. 218-27, 2004. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/15207491>.
WANG, J.; QIE, Y.; LIU, W.; WANG H et al. Protective efficacy of a recombinant
BCG secreting antigen 85B/Rv3425 fusion protein against Mycobacterium tuberculosis
infection in mice. Hum Vaccin Immunother, v. 8, p. 1869-74, 2012. Disponível em:
http://www.ncbi.nlm.nih.gov/pubmed/
WANG, X.; BARNES, P.F.; HUANG, F.; ALVAREZ, I.B.; NEUENSCHWANDER,
P.F.; SHERMAN, D.R. et al. Early secreted antigenic target of 6-kDa protein of
Mycobacterium tuberculosis primes dendritic cells to stimulate Th17 and inhibit Th1
134
immune responses. J Immunol, v. 189, p. 3092-103. Sept, 2012. Disponível em:
http://www.ncbi.nlm.nih.gov/pubmed/.
World Health Organization (2015). Global Tuberculosis Control: Surveillance,
Planning, and Financing. Geneva, Switzerland: World Health Organization Press.
http://apps.who.int/iris/bitstream/10665/191102/1/9789241565059.
WYLLIE, A. H.; KERR, J. F.; CURRIE, A. R. Cell death: the significance of apoptosis.
Int Rev Cytol, v. 68, p. 251-306, 1980. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/7014501>.
XU, X. L.; ZHANG, P.; SHEN, Y. H.; LI, H. Q. et al. Mannose prevents acute lung
injury through mannose receptor pathway and contributes to regulate PPARgamma and
TGF-beta1 level. Int J Clin Exp Pathol, v. 8, n. 6, p. 6214-24, 2015. Disponível em:
<http://www.ncbi.nlm.nih.gov/pubmed/26261498>.
YOSHIDA, K.; MAEKAWA, T.; ZHU, Y.; RENARD-GUILLET, C. et al. The
transcription factor ATF7 mediates lipopolysaccharide-induced epigenetic changes in
macrophages involved in innate immunological memory. Nat Immunol, v. 16, n. 10, p.
1034-43, Oct, 2015. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/26322480>.
YANG E, GU J, WANG F, WANG H, et al. Recombinant BCG prime and PPE protein
boost provides potent protection against acute Mycobacterium tuberculosis infection in
mice. Microb Pathog. v. 93, p. 1-7, 12, Janeiro de 2016. Disponível em:
http://www.ncbi.nlm.nih.gov/pubmed/26792673
YUAN, Y.; CRANE, D. D.; SIMPSON, R. M.; ZHU, Y. Q. et al. The 16-kDa alpha-
crystallin (Acr) protein of Mycobacterium tuberculosis is required for growth in
macrophages. Proc Natl Acad Sci U S A, v. 95, n. 16, p. 9578-83, Aug 4, 1998.
Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/9689123>.
ZHANG, H.; WANG, J.; LEI, J.; ZHANG, M. et al. PPE protein (Rv3425) from DNA
segment RD11 of Mycobacterium tuberculosis: a potential B-cell antigen used for
serological diagnosis to distinguish vaccinated controls from tuberculosis patients. Clin
Microbiol Infect. v.13, p. 139-45, Fev, 2007. Disponível em :
<http://www.ncbi.nlm.nih.gov/pubmed/>
ZHANG, H.; OUYANG, H.; WANG, D.; SHI, J. et al. Mycobacterium tuberculosis
Rv2185c contributes to nuclear factor-kappaB activation. Mol Immunol, v. 66, n. 2, p.
147-53, Aug, 2015. Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/25771181>.
ZIMMERLI, S.; EDWARDS, S.; ERNST, J. D. Selective receptor blockade during
phagocytosis does not alter the survival and growth of Mycobacterium tuberculosis in
human macrophages. Am J Respir Cell Mol Biol, v. 15, n. 6, p. 760-70, Dec, 1996.
Disponível em: <http://www.ncbi.nlm.nih.gov/pubmed/8969271>.
135
8. ANEXOS
Anexo 1 – Parecer do Comitê de Ética, TCLE
Anexo 2 – Comprovantes de submissão dos artigos/ aceite para publicação para
artigos ainda não publicados/ dói dos artigos publicados
Anexo 3 – Outros anexos
136
Anexo 1 – Parecer do Comitê de Ética, TCLE
137
138
139
140
141
Anexo 2 – Artigo 1: Recombinant BCG: Innovations on an old vaccine. Scope in
BCG strains and strategies to improve long lasting memory
Adeliane Castro da Costa1, Sarah Veloso Nogueira1, André Kipnis1 and Ana Paula
Junqueira-Kipnis1*
frontiers in IMMUNOLOGY(Publicado)
142
143
Anexo 3 – Artigo 2: Protection conferred by the recombinant vaccine BCG-CMX
is related to the induction of Th17 and polyfunctional cells in BALB/c mice.
Autores: Adeliane Castro da Costa1, Abadio de Oliveira da Costa Júnior1, Fábio Muniz
de Oliveira2, Sarah Veloso Nogueira1, Joseane Damaceno Rosa1, Danilo Pires Resende1,
André Kipnis2 e Ana Paula Junqueira-Kipnis1*.
PLOS one (Publicado)
144