Click here to load reader

Sequenciamento de DNA u 1977 Max & Gilbert (Harvard – USA)Max & Gilbert (Harvard – USA) Fred Sanger (Cambridge – Inglaterra)Fred Sanger (Cambridge – Inglaterra)

  • View
    231

  • Download
    12

Embed Size (px)

Text of Sequenciamento de DNA u 1977 Max & Gilbert (Harvard – USA)Max & Gilbert (Harvard...

  • Sequenciamento de DNA1977Max & Gilbert (Harvard USA)Fred Sanger (Cambridge Inglaterra)

    Mtodo para determinar a sequncia de nucleotdeos em um fragmento de DNA pela sntese dessa molcula in vitro

  • Mtodo de Sanger(enzimtico ou de terminao de cadeia)DNA em fita simples (molde)

    Primer (iniciador da sntese)

    Desoxinucleotdeos (dNTP A, T, G, C marcados radioativamente) Dideoxinucleotdeo (ddNTP)

    Enzima polimerase

  • Componentes do sequenciamento HHHHH

  • Mtodo enzimtico para sequenciamento de DNA (Sanger e col., 1977)GCATATGTCAGTCCAGCGTATACAGTCAGGTC5533DNAfita dupla

    CGTATACAGTCAGGTC35DNAfita simplesGCAT53Iniciador + DNA polimerase+ excesso de dATP, dTTP, dGTP, dCTPGCATAATGTCAATGTCAGTCCAATGTCAGTATGTATATGTCAGTCCATGTCAGTCATGTCATGTCAGTCCAGGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATATGTCAGATG+ddATP+ddTTP+ddCTP+ddGTP

  • Mtodo de sequenciamento enzimtico (manual)

  • Mtodo enzimtico para sequenciamento de DNA (Sanger e col., 1977)ATCGGACCTGACTGTA35

  • GTGCAC GGCCTCCCTGSequenciamento direto de DNA (gene a2) de portador da Hb Westmead (a122 HisGln)His GlnGACT

  • Sequenciamento automticoPermite a anlise simultnea de diversos segmentos de DNA

    Utilizado para sequenciamento de larga escala

    Nucleotdeos marcados com fluorocromo (quatro corantes diferentes)

    Emitem luz em diferentes comprimentos de ondas quando excitados por um laser

  • Sequenciamentoautomtico de DNADNA de fita simples com o inserto clonado a ser sequenciadoAdio de constituintes das reaes desequenciamentoTerminadores didesoxiPrimer universal do M13 com marcador fluorescenteFitas de DNA sintetizado marcadasMistura das quatro reaesProcessamento dos por um computadorDeteco com fotomultiplicadorExcitao do marcador fluorescente com laser

  • Sequenciamento de DNA automticoGCATATGAGCGTATACTC5353DNAfita dupla

    ddATPddCTPddTTPddGTPTerminadoresdideoxi++++CGTATACTCCGTATACTCCGTATACTCCGTATACTCGCATGCATGCATGCATPrimer com marcadores fluorescentes

  • Sequenciamento de DNA automticoGel de sequenciamentoLaserFotomultiplicadorResultados processados em um computadorMistura das 4 reaesde sequenciamento

  • TiminaAdeninaGuaninaCitosina

  • GA nt 30.864, aa248, Arg GlnCGA CAA

  • 2G (normal)112341

  • G/A (heterozigota)R