of 124 /124
INSTITUTO NACIONAL DE PESQUISAS DA AMAZÔNIA PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA, CONSERVAÇÃO E BIOLOGIA EVOLUTIVA – PPGGCBEV TAXONOMIA E FILOGENIA MOLECULAR DO GRUPO Rhinella margaritifer (AMPHIBIA, ANURA, BUFONIDAE) DA AMAZÔNIA BRASILEIRA DANIELA MARIA LEROY E VIEIRA Manaus – Amazonas Abril/2010

TAXONOMIA E FILOGENIA MOLECULAR DO GRUPO Rhinella ...ppbio.inpa.gov.br/sites/default/files/Dissertacao_Vieira_Daniela.pdf · iii Vieira, Daniela Maria Leroy e Taxonomia e filogenia

  • Author
    donga

  • View
    220

  • Download
    0

Embed Size (px)

Text of TAXONOMIA E FILOGENIA MOLECULAR DO GRUPO Rhinella...

INSTITUTO NACIONAL DE PESQUISAS DA AMAZNIA

PROGRAMA DE PS-GRADUAO EM GENTICA, CONSERVAO E BIOLOGIA

EVOLUTIVA PPGGCBEV

TAXONOMIA E FILOGENIA MOLECULAR DO GRUPO Rhinella

margaritifer (AMPHIBIA, ANURA, BUFONIDAE) DA

AMAZNIA BRASILEIRA

DANIELA MARIA LEROY E VIEIRA

Manaus Amazonas Abril/2010

ii

DANIELA MARIA LEROY E VIEIRA

Taxonomia e filogenia molecular do grupo Rhinella margaritifer (Amphibia, Anura, Bufonidae) da Amaznia brasileira

Orientador: Tomas Hrbek, Dr Co-orientadora: Albertina Pimentel Lima, Dra

Dissertao apresentada ao Programa de Ps-Graduao em Gentica, Conservao e Biologia Evolutiva do Instituto Nacional de Pesquisas da Amaznia como parte dos requisitos para obteno do ttulo de mestre em Gentica, Conservao e Biologia Evolutiva.

Manaus Amazonas Abril/ 2010

iii

Vieira, Daniela Maria Leroy e Taxonomia e filogenia molecular de Rhinella margaritifer (Amphibia, Anura, Bufonidae) da Amaznia Brasileira ----Manaus: [s. n.], 2010. xix, 123f.: il. color. Dissertao (mestrado) INPA/UFAM, Manaus, 2010. Orientador: Tomas Hrbek rea de concentrao: Gentica, Conservao e Biologia Evolutiva 1. Filogenia 2. Rhinella margaritifer 3. espcie crptica. 4. filogeografia I. Ttulo. CDD 19. ed. 581.5 Sinopse: Rhinella margaritifer constitui um complexo crptico, entretanto, caractersticas morfolgicas no so capazes de identificar as possveis espcies dentro do grupo. A anlise dos genes 12S, 16S, tirosinase e rodopsina mostrou a existncia de possveis 13 linhagens dentro do complexo, sendo que muitas destas ocorrem em simpatria, tem pequena distribuio e, muitas vezes, so contguas. Este um estudo preliminar que gera subsdios para a descrio de futuras espcies deste complexo e ajuda a estimar a diversidade da anurofauna da Amaznia brasileira. Palavras-chave: 1. Filogenia 2. Rhinella margaritifer 3. espcie crptica. 4. filogeografia

iv

s pessoas que sempre me apoiaram, especialmente, minha querida e amada famlia.

v

No deixe que a saudade sufoque, que a rotina acomode, que o medo impea de tentar. Desconfie do destino e acredite em voc. Gaste mais horas realizando que sonhando, fazendo que planejando, vivendo que esperando porque embora quem quase morreu esteja vivo, quem

quase vive j morreu. Luiz Fernando Verssimo

O sonho o material com que se pavimenta os mais slidos caminhos. Quem sonha j comeou a abrir sua prpria estrada.

Autor desconhecido

Uma coisa, porm, eu fao: esquecendo o que fica para trs, eu me lano para o que est na frente.

Fl 3,13

vi

Agradecimento Institucional

Os meus agradecimentos aos financiadores e apoiadores da pesquisa cientfica, ao CNPq pelo

financiamento do projeto e pela concesso da bolsa de estudos, ao Programa de Ps-

Graduao em Gentica, Conservao e Biologia Evolutiva pela estrutura acadmica, ao

Laboratrio de Evoluo e Gentica Animal (LEGAL) da Universidade Federal do Amazonas

por toda estrutura fsica e suporte tcnico-laboratorial.

Sou muito grata!

vii

Agradecimento Pessoal

Em primeiro lugar, agradeo a Deus, no s nesta etapa, mas em toda minha vida, pois

me presenteou com vida, sade, fora, coragem e sabedoria para entender e superar as

provaes.

Agradeo minha querida e amada famlia, pelo apoio, carinho, incentivo e amor. Aos

meus pais, Diva Pires Leroy e Vieira e Jos Luiz Vieira, meus pilares e exemplos de

honestidade e carter. minha me dedico gratido adicional pelas palavras sempre

oportunas, pelo exemplo de f e por nunca me deixar desistir. Agradeo ainda ao meu querido

irmo, Luiz Guilherme Leroy e Vieira, pela amizade, preocupaes e pela torcida. Obrigada

famlia! Amo vocs!

Agradeo, especialmente, meu orientador, Dr. Tomas Hrbek, pesquisador exemplar,

que acreditou em mim. Obrigada pela oportunidade e confiana, por estar sempre disposto e

paciente para tirar minhas dvidas, pela ajuda significativa que contribuiu para meu

desenvolvimento acadmico e para realizao deste projeto. com muita admirao e

respeito que demonstro meu sincero agradecimento.

Dra. Albertina Lima, minha co-orientadora, agradeo por me dar este presente, o

projeto com os sapinhos que me deixaram to encantada. Com certeza, sua empolgao e

amor herpetologia me contagiaram em todas nossas conversas. Obrigada pela confiana e

oportunidade.

Com carinho especial, agradeo Dra. Izeni Pires Farias, que coordena o laboratrio

LEGAL, sempre presente e disposta a contribuir. Com certeza, um exemplo de profissional a

ser seguido.

Ao Programa Ps-Graduao em Gentica, Conservao e Biologia Evolutiva do

INPA, pela oportunidade de cursar este mestrado. Agradeo aos docentes pelos

conhecimentos adicionados durante o curso, coordenao do programa e, acima de tudo, s

secretrias, sempre to solicitas e atenciosas, em especial, Alessandra.

Agradeo Universidade Federal do Amazonas, por toda infra-estrutura, em especial

pelo espao do Laboratrio de Evoluo e Gentica Animal (LEGAL).

Obrigada a todos os colegas do LEGAL, pelo timo ambiente de trabalho e pelos

ensinamentos que melhoraram decisivamente minha pesquisa, em especial ao Ed e Pedro Ivo,

que me ajudaram nos perodos iniciais de adaptao e aprendizagem. Mesmo sem citar todos

aqui, a colaborao de cada um foi muito importante e sou muito grata.

viii

Agradeo a todos os amigos do GCBEv: Alexandre, Edvaldo, Gabriela, Graciela,

Melina, Liza, Suzana, Arlisson, Fabola, Alessandra, mas em especial aos extraterrestres que

chegaram comigo neste mundo novo e foram super importantes para minha adaptao e

fizeram muito bem o papel de famlia postia, Brbara, Deyla, Edson, Joel, Leila, Mariana e

Mauro. Pessoas especiais e inesquecveis, obrigada pela fora, pelos risos, amizade, cervejas,

papos cabeas, papos furados, pelos aniversrios, pelas piadas, danas, abraos, enfim, por

tudo que vocs foram pra mim e que eu tambm espero ter sido pra vocs. Valeu!!!

A Igor, pela presteza e ajuda nos campos, por sempre me ensinar uma coisa nova e me

dar a oportunidade de conhecer os caboclos, povo maravilhoso que nas nossas coletas sempre

se mostrou solicito e amigo. Obrigada tambm pela leitura da primeira verso desta

dissertao, a qual contou no somente com suas correes, mas com suas idias e incentivos

a cada comentrio.

A Eduardo e Natasha, pela inestimvel ajuda com as anlises desta dissertao. Com

certeza, esta fase difcil teria ficado muito pior se no tivesse podido contar com vocs. E,

alm de tudo, sempre me dando nimo, trocando idias e tornando tudo mais tranqilo.

Agradeo amiga Bianca Ottoni, recm chegada em minha vida, mas que foi de

fundamental importncia pelas palavras e conselhos, por me dar foras nesta ltima etapa de

trabalho. Obrigada por agentar os momentos de afobao e por me entender, at mesmo se

eu precisasse bater umas portas.

A Tiago Nogueira Galinari, pessoa nica e especial, com quem, como um presente de

Deus, tive a oportunidade de conviver. Obrigada pelo apoio quando precisei largar toda minha

vida em Minas e me lanar neste mundo novo e desconhecido. Suas palavras de carinho,

esperana, fora e coragem foram fundamentais para minha adaptao e para que pudesse

investir neste mestrado sem olhar pra trs. Voc ficar para sempre na memria e no corao.

amiga Rubana Palhares, pessoa querida que, num momento difcil neste perodo,

soube me dizer as palavras exatas para me dar calma e me fazer seguir em frente. Minha

amiga chapiscadora de quem sinto muito falta.

Helena Baeta Costa, amiga, confidente, a irm que escolhi para minha vida. Nem

mesmo a distncia e os momentos de ausncia foram capazes de abalar nossa amizade de mais

de duas dcadas (afe....). Agradeo imensamente pelas preocupaes, pelos risos, pelos

exemplos de coragem, garra de mulher e profissionalismo, por sempre me jogar pra cima e

fazer acreditar que tudo de ruim sempre vai passar.

Ao querido amigo Edson, companheiro de todas as horas, agradeo por sempre me

ouvir, por sempre me emprestar um ombro, um colo e seus ouvidos pra desabafar. Pelos

ix

momentos de total pirao, como dos alimentos alucingenos ou da nossa banda imaginria

de msicas de fossa, por ser cmplice dos eventos impactantes que aconteceram na minha

vida, por sempre estar comigo at o fim das festas e at mesmo por me encontrar de

madrugada em pleno Poro. Obrigada ainda pelos conselhos sempre to diretos, envolvendo

bolachas no pacote e poo de estabilidade emocional. Voc o cara!

Por fim, agradeo a todos que cruzaram meu caminho nesta etapa da minha vida. Aos

que me deram esperana, incentivo ou uma simples palavra positiva, meu muito obrigada.

Agradeo tambm aqueles que me jogaram pra baixo, pois s assim pude perceber o quo

forte e determinada eu sou e, por isso, VENCI.

Muito obrigada!

x

RESUMO

Os sapos pertencentes ao complexo Rhinella margaritifer so considerados um dos mais

complexos dos anuros neotropicais. Eles possuem ampla distribuio, mas estudos prvios

feitos por Hass et al. (1995) e Fouquet et al. (2007) propem que estes constituam complexos

de espcies crpticas. Aparentemente, fatores histricos favoreceram altos nveis de

diversidade crptica dentro do grupo e os mtodos taxonmicos (morfolgicos) utilizados at

agora no foram os mais apropriados para identificar estas possveis espcies. Isto porque o

complexo no parece mostrar um padro morfolgico diagnstico. Assim sendo, seqncias

de DNA podem ser usadas da mesma maneira que outros dados para gerar hipteses sobre o

status e os limites de espcies. O presente estudo, portanto, teve por objetivo propor uma

hiptese filogentica que tentasse estimar quantas possveis espcies crpticas h dentro do

grupo na regio estudada e se eventos biogeogrficos poderiam explicar estes padres.

Anlises dos genes mitocondriais 12S rRNA e 16S rRNA e dos genes nucleares tirosinase e

rodopsina mostram a existncia de 13 linhagens dentro do complexo, sendo que muitas destas

ocorrem em simpatria, tm pequena distribuio e, muitas vezes, so contguas. Como as

anlises filogeogrficas foram feitas considerando todas as linhagens como uma nica

espcie, os dados obtidos no foram to precisos. Entretanto, foi possvel corroborar estes

resultados com os obtidos nas anlises filogenticas, principalmente para os genes

mitocondriais. Alm disto, foi visto concordncia espacial em alguns eventos inferidos. Tudo

isto refora o status de unidades evolutivas significativas (ESU), j que houve monofilia para

os genes mitocondriais e diferenas significativas para os genes nucleares. Contudo,

sugerimos que novos estudos que promovam outras evidncias (ecolgicas, fisiolgicas etc)

sejam feitos para que o status de espcies destas linhagens seja mais seguramente atribudo.

Palavras-chave: Filogenia, Rhinella margaritifer, espcie crptica, filogeografia. .

xi

ABSTRACT The toads of Rhinella margaritifer complex are one of the most chaotic of the neotropical

anurans. They are widespread, but studies of Hass et al. (1995) and Fouquet et al. (2007)

propose this toads are a species cryptic complex. Clearly, many historical factors act

generating high cryptic diversity level in this group and the taxonomic methods (morphology)

used until now were not the most appropriate to identify this possible species. Therefore DNA

sequences can be used to generate hypotheses about status and boundaries of species. The

goal of present study was to propose a phylogenetics hypothesis to estimate the number of

possible cryptic species and if biogeographic events could explain these patterns. Analyses of

the 12S rRNA and 16S rRNA of mitochondrial genome and the tyrosinase and rhodopsin

nuclear genes showed 13 lineages in the complex. Many of these are sympatric, with small

distribution and mainly contiguous. As the phylogeographic inferences were made

considering all the lineages as only one specie, the obtained data were not so concise.

However these results corroborated with those of phylogenetics analyses, mainly for the

mitochondrial genes. Moreover some spatial inferences were concordant for some events. All

this reinforce the evolutionarily significant units (ESU) status, since it had significant

monophyly for the mitochondrial genes and significant differences for the nuclear genes.

However, we suggest that new studies should be performed to promote other evidences

(ecological, physiological etc) to correctly attribute the status of species for these lineages.

Key-words.Phylogeny, Rhinella margaritifer, cryptic specie, phylogeography.

xii

Sumrio Lista de Figuras ...................................................................................................................... xvi Lista de tabelas ........................................................................................................................ xx 1 Introduo ........................................................................................................................... 1

1.1 Introduo geral .............................................................................................................. 1

1.2 Biologia e incertezas taxonmicas e filogenticas no grupo R. margaritifer .................. 2

1.3 Existncia de diversidade crptica em anuros ..................................................................

8

1.4 Estudos filogeogrficos na Amaznia .............................................................................. 9

1.5 Marcadores moleculares ................................................................................................ 14

2 Justificativa e Hipteses .................................................................................................... 17

3 Objetivos ........................................................................................................................... 18

3.1 - Objetivo Geral ................................................................................................................ 18

3. 2 - Objetivos Especficos .................................................................................................... 18

4 - Material e mtodos ............................................................................................................ 19

4.1 Locais de coleta e amostragem ...................................................................................... 19

4.2 Extrao de DNA ........................................................................................................... 21

xiii

4.3 Amplificao por reao em cadeia da polimerase (PCR) ............................................. 21

4.4 Purificao e seqenciamento ........................................................................................ 25

4.5 Edio e alinhamento das seqncias ............................................................................ 27

4.6 Anlise de dados ........................................................................................................... 27

4.6.1 Anlise filogentica ..................................................................................................... 27

4.6.2 Anlises filogeogrficas .............................................................................................. 28

5 Resultados ......................................................................................................................... 29

5. 1 16S ................................................................................................................................ 29

5.1.1 Filogenia ...................................................................................................................... 29

5.1.2 Rede de hapltipos ...................................................................................................... 29

5.1.3 NCPA .......................................................................................................................... 31

5. 2 12S ................................................................................................................................ 34

5.2.1 Filogenia ...................................................................................................................... 34

5.2.2 Rede de hapltipos ...................................................................................................... 36

5.2.3 NCPA .......................................................................................................................... 38

5. 3 Mitocondriais ................................................................................................................ 38

5.3.1 Filogenia ...................................................................................................................... 38

xiv

5.3.2 Rede de hapltipos ...................................................................................................... 39

5.3.3 NCPA .......................................................................................................................... 39

5. 4 Tirosinase ...................................................................................................................... 43

5.4.1 Filogenia ...................................................................................................................... 43

5.4.2 Rede de hapltipos ...................................................................................................... 43

5.4.3 NCPA .......................................................................................................................... 45

5. 5 Rodopsina ..................................................................................................................... 45

5.5.1 Filogenia ...................................................................................................................... 45

5.5.2 Rede de hapltipos ...................................................................................................... 46

5.5.3 NCPA .......................................................................................................................... 46

6 Discusso .......................................................................................................................... 50

6.1 16S ................................................................................................................................. 50

6.2 12S ................................................................................................................................. 58

6.3 Mitocondriais ................................................................................................................. 64

6.4 Tirosinase ....................................................................................................................... 70

6.5 Rodopsina ....................................................................................................................... 71

6.6 Discusso geral .............................................................................................................. 72

7 Concluses ........................................................................................................................ 77

xv

8 Bibliografia ....................................................................................................................... 79

9 Apndices .......................................................................................................................... 90

9.1 Tabela de amostras ......................................................................................................... 90

9.2 Tabelas de NCPA ........................................................................................................... 90

xvi

Lista de Figuras

Figura 01. Trs diferentes morfotipos de sapos do grupo Rhinella margaritifer. Fotos de: 1-

Albertina P. Lima; 2 e 3: Retirado de Fouquet et al. (2007)...................................................... 4

Figura 02. Casal de Rhinella gr. margaritifer num amplexo para reproduo. Foto: Albertina

P. Lima ...................................................................................................................................... 5

Figura 03. Figura 3: Mapa da distribuio geogrfica de Rhinella gr. margaritifer. Modificado

de http://www.globalamphibians.org,, em 08/11/2008, s 10:30h ........................................... 6

Figura 04. Esquema mostrando as diferentes posies taxonmicas propostas para o grupo de

espcies Rhinella margaritifer. Modificado de Frost et al., 2006 ........................................... 8

Figura 05. Esquema do DNA mitocondrial de um anuro. Os genes utilizados neste trabalho

(12S rRNA e 16S rRNA) esto apontados pela seta e vermelho. Modificado de Zhang et al.,

2009 ......................................................................................................................................... 16

Figura 06. Mapa representando os pontos de coleta. Modificado de

http://www.maps.google.com.br ............................................................................................. 21

Figura 07. rvore filogentica de 16S baseada no mtodo da Mxima Verossimilhana,

reconstruda com robustez de 1000 replicas no paramtricas de bootstrap. O modelo

evolutivo foi o GTR + G + I ................................................................................................... 23

Figura 08. Rede de hapltipos geradas pelo programa TCS, usando critrios de mxima

parcimnia, a partir das seqncias do gene 16S. Foram obtidas seis redes de hapltipos. A

rede A corresponde a oito possveis linhagens existentes dentro do complexo margaritifer. A

hierarquizao completa dos clados foi omitida para melhor entendimento da rede de

hapltipos. Cada cor corresponde a um nvel de hierarquizao (preto = nvel 0; vermelho =

nvel I; verde = nvel II; azul = nvel III). Os nomes originais de coleta foram mantidos e seu

sinnimo na rvore filogentica se encontra no Apndice 1 .................................................. 24

xvii

Figura 09. Redes de hapltipos geradas pelo programa TCS, usando critrios de mxima

parcimnia, a partir das seqncias do gene 16S. Foram obtidas seis redes de hapltipos. A

rede B corresponde a duas possveis linhagens existentes dentro do complexo margaritifer e

as redes C e D a uma linhagem cada. A hierarquizao completa dos clados foi omitida para

melhor entendimento da rede de hapltipos. Cada cor corresponde a um nvel de

hierarquizao (preto = nvel 0; vermelho = nvel I; verde = nvel II; azul = nvel III). Os

nomes originais de coleta foram mantidos e seu sinnimo na rvore filogentica se encontra

no Apndice 1 ...................................... .................................................................................. 25

Figura 10: rvore filogentica de 12S baseada no mtodo da Mxima Verossimilhana,

reconstruda com robustez de 1000 replicas no paramtricas de bootstrap. O modelo

evolutivo foi o TVM + G. ....................................................................................................... 40

Figura 11: Rede de hapltipos geradas pelo programa TCS, usando critrios de mxima

parcimnia, a partir das seqncias do gene 12S. Foram obtidas seis redes de hapltipos. A

rede A corresponde a onze possveis linhagens existentes dentro do complexo margaritifer. A

hierarquizao completa dos clados foi omitida para melhor entendimento da rede de

hapltipos. Cada cor corresponde a um nvel de hierarquizao (preto = nvel 0; vermelho =

nvel I; verde = nvel II; azul = nvel III). Os nomes originais de coleta foram mantidos e seu

sinnimo na rvore filogentica se encontra no Apndice 1 .................................................. 41

Figura 12: Rede de hapltipos geradas pelo programa TCS, usando critrios de mxima

parcimnia, a partir das seqncias do gene 12S. Foram obtidas seis redes de hapltipos. As

redes de B a G correspondem a seis possveis linhagens existentes dentro do complexo

margaritifer. A hierarquizao completa dos clados foi omitida para melhor entendimento da

rede de hapltipos. Cada cor corresponde a um nvel de hierarquizao (preto = nvel 0;

vermelho = nvel I; verde = nvel II; azul = nvel III). Os nomes originais de coleta foram

mantidos e seu sinnimo na rvore filogentica se encontra no Apndice 1 .......................... 42

Figura 13: rvore filogentica dos genes mitocondriais analisados de forma concatenada,

baseada no mtodo da Mxima Verossimilhana, reconstruda com robustez de 1000 replicas

no paramtricas de bootstrap. O modelo evolutivo foi o GTR + G + I ................................ 43

xviii

Figura 14: Rede de hapltipos geradas pelo programa TCS, usando critrios de mxima

parcimnia, a partir das seqncias dos genes 12S+16S. Foram obtidas seis redes de

hapltipos. A rede A corresponde a seis possveis linhagens existentes dentro do complexo

margaritifer. A hierarquizao completa dos clados foi omitida para melhor entendimento da

rede de hapltipos. Cada cor corresponde a um nvel de hierarquizao (preto = nvel 0;

vermelho = nvel I; verde = nvel II; azul = nvel III; amarelo = nvel IV; rosa = nvel V). Os

nomes originais de coleta foram mantidos e seu sinnimo na rvore filogentica se encontra

no Apndice 1 .......................... .............................................................................................. 44

Figura 15: Rede de hapltipos geradas pelo programa TCS, usando critrios de mxima

parcimnia, a partir das seqncias dos genes 12S+16S. Foram obtidas seis redes de

hapltipos. As redes de B a F correspondem, cada uma, a uma possvel linhagem existente

dentro do complexo margaritifer. A hierarquizao completa dos clados foi omitida para

melhor entendimento da rede de hapltipos. Cada cor corresponde a um nvel de

hierarquizao (preto = nvel 0; vermelho = nvel I; verde = nvel II; azul = nvel III; amarelo

= nvel IV). Os nomes originais de coleta foram mantidos e seu sinnimo na rvore

filogentica se encontra no Apndice 1 .................... ............................................................. 44

Figura 16: rvore filogentica de Tirosinase baseada no mtodo da Mxima Verossimilhana,

reconstruda com robustez de 1000 replicas no paramtricas de bootstrap. O modelo

evolutivo foi o HKY + G ................................ ....................................................................... 45

Figura 17: rvore filogentica de Rodopsina baseada no mtodo da Mxima

Verossimilhana, reconstruda com robustez de 1000 replicas no paramtricas de bootstrap.

O modelo evolutivo foi o J2 + G ................... ........................................................................ 46

Figura 18: Rede de hapltipos geradas pelo programa TCS, usando critrios de mxima

parcimnia, a partir das seqncias do gene Rodopsina. Foram obtidas doze redes de

hapltipos. Esta rede corresponde a trs possveis linhagens existentes dentro do complexo

margaritifer. A hierarquizao completa dos clados foi omitida para melhor entendimento da

rede de hapltipos. Cada cor corresponde a um nvel de hierarquizao (preto = nvel 0;

vermelho = nvel I; verde = nvel II; azul = nvel III). Os nomes originais de coleta foram

mantidos e seu sinnimo na rvore filogentica se encontra no Apndice 1 .......................... 47

xix

Figura 19: Redes de hapltipos geradas pelo programa TCS, usando critrios de mxima

parcimnia, a partir das seqncias do gene Rodopsina. Foram obtidas doze redes de

hapltipos. As redes em A foram geradas por hapltipos de um mesmo indivduo. Os

hapltipos em B no se ligaram a nenhuma rede. Os nomes originais de coleta foram

mantidos e seu sinnimo na rvore filogentica se encontra no Apndice 1 .......... ............... 48

Figura 20: Diferenas morfolgicas entre um espcime de Autazes (AM) e da Guiana

Francesa, pertencentes ao clado 5. Ao contrrio do que foi proposto por Fouquet et al.

(2007a), crestas craniais extremamente expandidas dorsolateralmente no parecem ser um

sinapomorfia para o grupo. Fotos: A - Daniela Leroy; B Fouquet et al.(2007a) .................47

Figura 21: Mapa mostrando a distribuio das possveis linhagens existentes de R.

margaritifer. Cada cor corresponde a uma linhagem encontrada no presente trabalho. Mapa

original de Marilyn J. Weitzman. Modificado por Tibrio Gonzaga de

Figueiredo................................................................................................................................ 48

xx

Lista de Tabelas

Tabela 01. Principais teorias biogeogrficas propostas para a Amaznia

.............................. 13

Tabela 02. Relao entre espcies, nmero de indivduos e locais coletados ......................... 22

Tabela 03. Componentes da reao de PCR dos genes mitocondriais

.................................... 24

Tabela 04. Componentes da primeira reao de PCR dos genes nucleares ............................ 22

Tabela 05. Componentes da segunda reao de PCR dos genes nucleares ............................ 13

Tabela 06. Primers utilizados neste trabalho, suas seqncias e devidas referncias. As

referncias onde se encontram * se referem a primers desenhados para este trabalho ........... 22

Tabela 07. Componentes da reao de PCR seqenciamento ................................................ 13

Tabela 08. Matriz de significncia para os valores de P da anlise de Fst par a par para o gene

tirosinase. Valores significativos de comparaes par a par esto assinalados com +. Valores

no significativos esto marcados com -. ................................................................................ 46

Tabela 09. Matriz de significncia para os valores de P da anlise de Fst par a par para o gene

rodopsina. Valores significativos de comparaes par a par esto assinalados com +. Valores

no significativos esto marcados com -.................................................................................. 50

1

1 - INTRODUO 1.1 - INTRODUO GERAL

Florestas tropicais so famosas por serem os ecossistemas mais ricos em espcies do

planeta. As florestas tropicais esto desaparecendo a taxas alarmantes, sendo que catalogar as

espcies que as constituem deve ser, obviamente, o primeiro passo para seu entendimento e

conservao (Gentry, 1992). Em vista disto, a Amaznia brasileira enfrenta as maiores

ameaas e apresenta as maiores oportunidades dos nossos tempos para a conservao da

biodiversidade tropical. (Peres, 2005).

Os anfbios so um dos grupos mais diversos dentre os vertebrados (Smith et al.,

2008). Entretanto, so muito sensveis s modificaes no habitat, poluentes e a mudanas

climticas globais (Phillips 1990, Alford e Richards 1999) e o grupo um dos que mais vem

sofrendo declnios, sendo muitos fatores responsveis por isto (Storfer, 2003). Perda de

habitat, introduo de espcies, super-explorao, mudanas climticas globais,

contaminantes qumicos e doenas (principalmente as causada pelo fungo Batrachochytrium

dendrobatidis) so os que mais agravam a situao, sendo que estes fatores podem agir

sozinhos ou sinergicamente para eliminar as populaes e espcies (Carey et al., 2001;

Storfer, 2003). Conseqentemente, os efeitos destes problemas nos anfbios devem ser vistos

no contexto do amplo colapso da biodiversidade atual, sendo que, para muitos, o declnio

deste grupo servir como um modelo para entender esta crise (Carey et al., 2001; Storfer,

2003; Stuart et al., 2004).

Os anfbios neotropicais so conhecidos por exibir notvel estrutura filogeogrfica e

divergncias genticas profundas, sendo necessria grande quantidade de tempo para que

diferenas fenotpicas possam evoluir (Lougheed et al., 1999; Zamudio e Savage, 2003;

Lougheed et al., 2006). As florestas da Bacia Amaznica so umas das mais ricas em espcies

de anuros, mas pouco se sabe sobre a diversidade gentica dentro e entre as espcies desta

regio, sugerindo que a histria evolutiva deste grupo muito mais complicada do que a

imaginada quando se analisam apenas dados morfolgicos (Elmer et al., 2007). Por isto, a

no-delimitao correta de espcies pode levar a interpretaes errneas (Sites e Marshall,

2003), dificultando a realizao de estratgias eficientes para a conservao e o manejo da

biodiversidade.

2

A ordem Anura, composta por sapos, rs e pererecas, apresenta vrios problemas e

deficincias em sua classificao taxonmica. A maioria dos anuros classificada na

subordem Neobatrachia, que inclui duas linhagens principais, as superfamlias Ranoidea e

Hyloidea (ou Bufonoidea), sendo que dentro desta ltima est a famlia Bufonidae (Hedges e

Maxson, 1993; Hillis et al., 1993; Hay et al., 1995). Nesta ordem, o encontro entre os sexos se

d por orientao sonora, sendo que o canto varia entre as espcies e, dentro destas, existem

dois ou trs tipos diferentes, utilizados em diferentes situaes. As caractersticas do canto de

anncio servem para identificar a espcie e o sexo do animal que o emite (Pough et al., 1998).

O canto de anncio de uma espcie considerado um carter evolutivo conservativo e txons

aparentados freqentemente apresentam cantos similares (Pough et al., 1998).

A famlia Bufonidae, composta por 62 espcies, conforme Frost et al. (2006), tambm

conhecida como a dos sapos verdadeiros, se caracteriza por uma grande glndula paratide no

lado da cabea e a maioria das espcies apresenta tubrculos na pele do dorso. So terrestres e

insetvoras, sendo as formigas sua dieta principal. Adultos se agregam em brejos ou em

ambientes lnticos para a reproduo. Os ovos so pequenos e pigmentados e a ovoposio

realizada em cordes na gua. Os girinos so pequenos e negros. O disco oral que margeia a

boca direcionado anteroventralmente e tem uma fila de papilas marginais lateralmente,

estando ausentes papilas dorsal e ventralmente. O nmero de dentes geralmente segue a

frmula 2(1)3 (Rodrguez e Duellman,1994).

Com um papel ainda no esclarecido na sua funo como bioindicador, Sousa e

colaboradores (2008) sugerem que, possivelmente, os anuros podem funcionar como

bioindicadores da diversidade de outros grupos da biota, inclusive de invertebrados, ou ento

grupos diferentes da fauna podem responder de forma semelhante aos efeitos da perturbao e

sucesso. Este uso como bioindicadores mais eficaz se os organismos possuem alta

distribuio em uma determinada rea ou bioma. Como a famlia Bufonidae possui a

distribuio mais ampla dentre todos os anfbios e uma das maiores entre os vertebrados, alm

de histrias de vida variadas, os bufondeos so interessantes para trabalhos de biologia

evolutiva e biogeografia (Pramuk et al., 2001).

1.2 - BIOLOGIA E INCERTEZAS TAXONMICAS E FILOGENTICAS NO GRUPO R. margaritifer

Frost e colaboradores (2006) dividiram o gnero Bufo em dois, Rhinella e Chaunus. O

gnero Rhinella tem o nmero de espcies descritas aumentado a cada ano (Duelman e Sweet,

3

1999). Este gnero cosmopolita, no ocorrendo apenas na Antrtida, Austrlia e em

Madagascar (Duellman e Sweet, 1999). Apesar da grande quantidade de trabalhos

envolvendo a filogenia deste gnero, suas relaes sistemticas e a taxonomia das espcies

ainda so discordantes e pouco conclusivas (Pramuk e Kadivar, 2003).

Os sapos do complexo Rhinella margaritifer (Fitzinger, 1826), como proposto por

Frost et al. (2006), incluem os antigos grupos de espcies de Bufo typhonius ou Bufo

margaritifer, com umas das histrias taxonmica e sistemtica mais complexas dos anuros

neotropicais (De La Riva et al., 2000; Caramaschi e Pombal Jr., 2006). Frost et al. (2006)

incluram no complexo margaritifer todas as espcies anteriormente associadas a estes dois

grupos, resultando em 14 txons. So eles: R. acutirostris, R. alata, R. castaneotica, R.

dapsilis, R. hoogmoedi, R. lescurei, R. magnussoni, R. margaritifer, R. martyi, R.

proboscidea, R. roqueana, R. sclerocephala, R.scitula e Rhinella stanlaii. Em 2010, uma nova

espcie do complexo foi descrita por vila et al., sendo sua ocorrncia no Pantanal e

denominada R. paraguayensis.

O nome vulgar para os espcimes deste grupo sapo-folha. As espcies de R. gr.

margaritifer (Laurenti, 1768) so sapos de tamanho mdio (machos medem entre 40-67 mm e

as fmeas entre 46-76 mm), distribudos principalmente na Amaznia, sendo que no Brasil

apenas R. scitula encontrada no Cerrado, e R. paraguayensis, tpica do Pantanal, no esto

neste bioma (vila et al., 2010). A pele do dorso possui tubrculos e o espinho neural da

vrtebra proeminente. O ventre granular. Uma faixa diagonal de tubrculos cnicos se

estende da parte de trs da cabea at o fim do tronco. O tmpano pode estar presente ou

ausente. As caractersticas mais marcantes so as crestas ps-orbitais elevadas em algumas

espcies do grupo, sendo que algumas fmeas so extremamente expandidas

dorsolateralmente, apesar deste no parecer ser o padro mais comumente observado na

Amaznia central. Outra caracterstica diagnstica o nariz pontiagudo em vista dorsal. Em

vista lateral, o nariz afinalado e proeminente anteriormente. As glndulas paratides so

triangulares ou subtriangulares e confluentes com as crestas craniais. O primeiro e segundo

dedos so iguais em tamanho e os dgitos terminais so pequenos e arredondados. Os ps e os

dedos possuem tubrculos na margem externa. O dorso varia de uniformemente marrom

avermelhado a mais escuro, podendo apresentar manchas ou pontos enegrecidos. Ainda existe

uma variedade de polimorfismos na faixa media-dorsal, que pode apresentar colorao mais

clara, bege. O ventre varia de acinzentado a bege, com ou sem manchas. A ris geralmente

cor de bronze com um anel verde envolvendo a pupila (Rodrguez e Duellman, 1994;

4

Caramaschi e Niemeyer, 2003; Pramuk e Kadivar, 2003; Lima et al, 2007;

www.globalamphians.org, A.P.L., comunicao pessoa)

So diurnos e vivem no cho da floresta, onde sua colorao e seus espinhos

irregulares resultam em um grande mimetismo com as folhas cadas no ambiente, por isso o

nome popular de sapo-folha. noite, geralmente, sobem em copas baixas (5 a 100 cm) para

dormir. A reproduo, que ocorre de forma explosiva, tambm realizada a noite. (Heyer,

1976; Rodrguez e Duellman, 1994, A.P.L., comunicao pessoal).

Pode ocorrer poliploidia no grupo (Hoogmoed, 1989), mas ainda no h nenhum

estudo publicado nesta rea.

Figura 1: Trs diferentes morfotipos de sapos do grupo Rhinella margaritifer. Fotos de: 1- Albertina P. Lima; 2 e 3: Retirado de Fouquet et al. (2007).

1 2 3

Figura 2: Casal de Rhinella gr. margaritifer num amplexo para reproduo. Foto: Albertina P. Lima.

5

um grupo de espcies neotropicais, que ocorrem na Bacia Amaznica (Bolvia,

Brasil, Colmbia, Equador, Guiana Francesa, Guiana, Peru, Suriname, Venezuela) e em

partes do Panam, vivendo do nvel do mar a at 2400m de altitude

(www.globalamphians.org).

Anlises moleculares so muito teis em estudos de anfbios porque suas morfologias

muito conservativas oferecem, relativamente, poucos caracteres que podem ser usados para

resolver relaes filogenticas (Hass et al., 1995). Em particular, os estudos moleculares so

teis para discernir espcies morfologicamente crpticas que so diferenciadas geneticamente

(Donnelan e Aplin, 1989; Hedges e Thomas, 1991). Segundo Hass et al., (1995), anlises

moleculares parecem ser ideais para quantificar o nvel de variao gentica dentro do

complexo margaritifer.

Hass et al. (1995) analisaram dados imunolgicos de albumina de 6 espcies j

descritas dentro do grupo margaritifer e espcies ainda no descritas. Eles verificaram a

Figura 3: Mapa da distribuio geogrfica estimada de Rhinella gr. margaritifer. Modificado de http://www.globalamphibians.org,, em 08/11/2008, s 10:30h.

Rhinella gr. margaritifer

6

ocorrncia de duas espcies com respostas imunolgicas diferentes vivendo em simpatria na

Guiana Francesa, assim como espcimes de Tabatinga (AM, Brasil), os quais apresentaram

diferentes padres imunolgicos que puderam ser corroborados por diferentes tamanhos

corporais e cor de ris. Os dados de diversidade molecular encontrados dentro deste complexo

mostraram um enorme nmero de populaes simptricas isoladas reprodutivamente, que j

podem ser designadas como espcies nicas. Alguns destes dados, mas no todos, podem ser

corroborados por observaes morfolgicas, a maioria de populaes com pequena

distribuio, sendo que este complexo inclui espcies que so parcialmente sobrepostas ou

aloptricas. Encontrou-se entre espcies j descritas e ainda no definidas taxonomicamente

divergncias de 20 milhes de anos, sendo que, provavelmente, o ancestral destas espcies

divergiu a 30 milhes de anos atrs no Panam. Esta divergncia do Eoceno comparada com

a do comeo do Cenozico, conforme dados j encontrados para alguns anuros da Amrica do

Sul. O trabalho de Hass et al. (1995) sugere ainda que uma filogenia mais robusta possa ser

obtida com seqncias de DNA, o que foi feito por Fouquet e colaboradores em 2007,

utilizando apenas indivduos da Guiana Francesa. Neste estudo foram encontradas seis

linhagens distintas que correspondem a diferentes espcies. Alm disto, Fouquet et al. (2007)

verificaram que pode ter ocorrido expanso partir de um refgio do norte do pas, o que

diferenciou as linhagens devido a refgios isolados por reas de savana ou pela aumento do

nvel do mar.

Alm das incertezas taxonmica e filogentica dentro do complexo margaritifer, sua

posio sistemtica em relao aos outros bufondeos tambm permanece obscura. Segundo

trabalho de Chaparro et al. (2007), a topologia filogentica que inclui R. gr. margaritifer

difere da proposta por Frost et al. (2006) e concorda com a topologia proposta por Pauly et al.

(2004) e Pramuk (2006), com o grupo consistindo de apenas 10 espcie e sendo B. granulosus

grupo-irmo de R. gr. margaritifer (conforme figura 4).

Frost e colaboradores (2006) propuseram nova posio filogentica e sistemtica para

as espcies do grupo R. margaritifer utilizando caracteres morfolgicas e anlise de

seqncias d e alguns genes, explicitando que as relaes filogenticas propostas por

Duellman e Schulte (1992) foi baseada apenas em similaridades, e no em sinapomorfias, e

que o diagnstico do grupo feito exclusivamente pelas crestas craniais precisa ser redefinido,

j que esta no a regra para o grupo. Alm disto, segundo estes autores, a classificao

reorganizando todas as espcies dentro de um nico grupo pode minimizar o risco de erros

taxonmicos.

7

Figura 4: Esquema mostrando as diferentes posies taxonmicas propostas para o grupo de espcies

Rhinella margaritifer.

Modificado de Frost et al., 2006.

De La Riva et al. (2000) tambm constataram que Rhinella margaritifer um

complexo com diversidade subestimada. Em uma reviso sobre anfbios bolivianos, os

autores verificaram que neste pas algumas populaes do grupo margaritifer ainda devem ser

melhor estudadas, sendo que na rea amostrada h, pelo menos, quatro espcies distintas a

serem descritas.

Ainda h o problema da existncia de colorao crptica dentro do grupo, o que

dificulta a identificao das espcies. Tambm faltam dados na literatura sobre vocalizao e

morfologia de juvenis. Apenas R. proboscidea (Zimmerman e Bogart,1988), R. castaneotica

(Khler e Ltters 1999) e R. paraguayensis (vila et al., 2010) tiveram suas vocalizaes

descritas, enquanto a morfologia de girinos foi descrita somente para R. margaritifer

(Duellman 1978), R. castaneotica (Caldwell 1991), R. scitula (Caramaschi e Niemeyer 2003)

e R. proboscidea (Menin et al., 2006).

Muitas questes ainda aparecem obscuras sobre o parentesco entre os bufondeos do

novo mundo. Por isto to importante buscar alternativas para identificar as espcies deste

grupo. Neste sentido, as ferramentas moleculares podem ser bastante teis.

Frost et al. (2006) 14 espcies do grupo margaritifer

Chaparro et al. (2007), Pauly et al. (2004 ) e Pramuk (2006) 10 espcies do grupo margaritifer

8

1.3 - EXISTNCIA DE DIVERSIDADE CRPTICA EM ANUROS

A inferncia de relacionamento filogentico em anuros tradicionalmente baseada em

dados morfolgicos, enquanto a utilizao de outros sistemas (ex.. comportamento,

cromossmico, molecular) muito pequena (Hillis et al., 1993). Anlises filogenticas

baseadas somente em caractersticas morfolgicas podem resultar em rvores com baixa

resoluo, refletindo a evoluo morfolgica conservativa dos anuros e a pequena quantidade

de caractersticas com sinal filogentico (Austin et al., 2002).

Uma caracterstica dos sapos o seu complexo sistema acstico que permite a

comunicao, defesa de territrio, proteo conta predadores e ainda tem funo de atrao

para reproduo (Gerhardt e Huber, 2002). Este sistema de escolha para acasalamento, na

maioria dos sapos, no baseado em nenhuma caracterstica morfolgica (Bickford et al.,

2006), podendo, muitas vezes, ocorrer um isolamento de populaes com

comportamento/ecologia diferentes, resultando em posterior especiao. De uma forma

simplria, estas duas ou mais espcies erroneamente classificadas como uma nica espcie

dada o nome de espcies crpticas (Bickford et al., 2006).

A diversidade da anurofauna drasticamente subestimada pelos levantamentos

faunsticos baseados somente em caractersticas morfolgicas (Elmer et al., 2007). Muitas

vezes, a existncia de espcies crpticas desconsiderada devido a algumas suposies feitas

erroneamente, como a inexistncia de morfologia conservada. Na grande parte da literatura

sobre o tema, o ponto mais comum posto inequivocadamente que estas espcies resultam de

um processo de especiao to recente que as caractersticas morfolgicas, que seriam usadas

para diagnstico, ainda no divergiram o suficiente (Bickford et al., 2006).

O aumento do nmero de trabalhos utilizando dados moleculares refora que a

evoluo morfolgica em anfbios geralmente crptica (ex. Elmer et al., 2007; Fouquet et

al., 2007; Elmer e Cannatella, 2008; Ltters et al., 2009; Padial e De la Riva, 2009),

necessitando uma revitalizao na taxonomia dos anfbios. Fouquet e colaboradores (2007)

afirmam que muitos grupos de anfbios so morfologicamente conservados e no tm

caractersticas externas capazes de ser facilmente diferenciadas e que isto, somado ao alto

grau de convergncia, leva a inmeras interpretaes incorretas sobre filogenias geradas por

caractersticas morfolgicas. Mas, apesar de todos estes estudos, a sistemtica dos anfbios

continua mal resolvida e subestimada.

9

Tudo isto mostra a importncia de se delimitar precisa e corretamente as espcies, que

so as unidades bsicas para a biogeografia, ecologia, macroevoluo e para a conservao.

Super e subestimar os limites das espcies podem levar a interpretaes errneas (Sites e

Marshall, 2003; Fouquet et al., 2007). Como em Rhinella gr. margaritifer existe diversidade

crptica, muitas vezes preciso recorrer a outras caractersticas para discriminar as diferentes

espcies, como canto e morfologia de girinos. Entretanto, poucas espcies possuem estas

caractersticas estudadas, sendo preciso buscar alternativas para identificar corretamente as

espcies e/ou unidades evolutivas significativas do grupo, sendo, portanto, as ferramentas

moleculares uma tima opo.

1.4 - ESTUDOS FILOGEOGRFICOS NA AMAZNIA

A filogeografia, ou seja, a anlises das relaes entre estrutura gentica populacional e

dados biogeogrficos, uma ferramenta poderosa no estudo de influncias histricas na

distribuio da biodiversidade h mais de 20 anos (Avise et al., 1987) e tem sido aplicada

para estudos em todo mundo, com os mais diferentes taxa (Avise, 2000). As anlises

filogeogrficas so uma das melhores ferramentas para a investigao de aspectos histricos

da biogeografia e da estrutura gentica de uma populao, sendo que os mtodos analticos

mais comumente utilizados so baseados na construo de rvores filogenticas ou em redes

de hapltipos. A estrutura gentica , ento, quando possvel, interpretada cronologicamente e

plotada sobre dados geogrficos, sendo que a relao gentipo X distribuio geogrfica

interpretada para inferir histrias populacionais (Zeisset e Beebee, 2008). Ento, o objetivo

central da filogeografia explicar padres da histria populacional, considerando diferenas

regionais de latitude, topografia, correntes ocenicas, dentre outros aspectos (Hewitt, 2000).

Anfbios, geralmente, tm baixa mobilidade individual, que muitas vezes

acompanhada de filopatria aos stios natais (Beebee, 1996). Com isto, as populaes tendem a

ser altamente estruturadas geneticamente em pequenas distncias geogrficas e retm fortes

sinais de eventos histricos que geram determinada distribuio de uma espcie, diferindo de

outras espcies mveis. Alm disto, os anfbios so relativamente fceis de amostrar, quando

comparados maioria dos mamferos ou dos rpteis que tambm tm baixas taxas de

mobilidade e fortes sinais filogeogrficos (Zeisset e Beebee, 2008). Finalmente, os anuros

possuem distribuio cosmopolita e so muito diversos, ocorrendo em todos continentes,

exceto Antrtida (Duellman, 1986). As anlises filogeogrficas das espcies de anfbios de

10

regies temperadas e tropicais tm amplo potencial de prover entendimentos sobre os

perodos do ltimo Tercirio e Quaternrio e a influncia de processos biogeogrficos,

segundo Zeisset e Beebee (2008), sendo, ento, timos modelos para inferir os eventos

filogeogrficos de uma determinada regio.

Na Amaznia, muitos aspectos biogeogrficos so explicados atravs de modelos, ou

seja, possveis teorias que possam ter levado a esses padres. Segundo Marroig e Cerqueira

(1997), muitas teorias e hipteses tm sido postuladas para explicar a biodiversidade da regio

neotropical, sendo que as mais aceitas so: Centros de origem e disperso, Vicarincia

Geotectnica, Refgios, Gradientes ecolgicos, Rios como barreiras e Dinmica dos rios.

Estes autores acreditam que nenhum destes modelos sozinho capaz de explicar a evoluo

na Amaznia. Por isto, propuseram uma nova teoria chamada de Hiptese do Lago

Amaznico. Uma resumida tabela apresentada abaixo com os principais pontos de cada um

destes modelos.

TEORIA AUTORES PRINCIPAL IDIA E

MODELO DE ESPECIAO

Centro de

Origem e

Disperso

- Hershkovitz, 1977

- Reig, 1984

Ocorre disperso atravs de uma barreira pr-

existente de uma rea geograficamente estvel

(um centro de origem). Ou seja, uma espcie

ancestral cruza uma barreira, promovendo

fragmentao.

O modelo de especiao aloptrico.

Vicarincia

Geotectnica

- Platnick e Nelson,

1978

- Cracraft e Prum,

1988

- Futuyma, 1992

- Amorim e Pires,

1996

Eventos geotectnicos passados foram os

responsveis por separar populaes ancestrais

que eram contnuas.

O modelo de especiao aloptrico.

Refgios

- Haffer, 1969

- Vanzolini e

Williams, 1970

Modelo baseado em fatos paleoclimticos,

paleopalinolgicos, paleogeogrficos,

paleoecolgico e geomorfolgicos que

11

- Cerqueira, 1982

- Prance, 1982

causaram os ciclos climticos do Tercirio e do

Pleistoceno, em que havia alternncia de

perodos seco/frio e quente/mido.O perodo de

seca e frio levou a fragmentao das florestas

em refgios, com subseqente expanso (nos

perodos de calor e umidade), o que levou

origem de uma grande parte da fauna existente.

O modelo de especiao o clssico proposto

para alopatria.

Gradientes

Ecolgicos - Endler, 1977, 1982

Este modelo sugere que os padres de

distribuio das espcies so consistentes com

divergncias geogrficas e adaptao aos

fatores ecogeogrficos atuais, independente dos

fatores histricos. Com isto, o isolamento por

distncia permite forte adaptao gentica a

diferentes reas, resultando em zonas com

uniformidade de freqncias gentica e/ou

fenotpicas, separadas por reas de mudanas

ou por clinas.

O modelo de especiao paraptrica.

Rios como

barreiras

- Wallace, 1849

- Sick, 1968

- Capparella, 1988

- Ayres e Clutton-

Brock, 1992

- Patton et al., 1994

Como o prprio nome j diz, os rios atuam

como barreiras ao fluxo gnico (tanto para a

inexistncia quanto para a reduo deste),

ficando as diferentes populaes sujeitas a ao

da seleo natural e/ou deriva gentica,

causando divergncias entre as populaes ou

especiao.

O modelo de especiao um caso clssico de

alopatria.

Dinmica de

rios - Salo et al., 1986

As mudanas causadas pela constante dinmica

dos rios (processos de eroso lateral, mudanas

nos cursos dgua etc) so capazes de criar ou

manter espcies, j que populaes podem ser

12

transferidas passivamente de uma margem para

outra.

O modelo de especiao o aloptrico.

Lago

Amaznico

- Marroig e

Cerqueira, 1997

Este modelo sugere que houve um aumento no

nvel do mar entre 700 e 750 mil anos atrs

(alta temperatura e umidade), resultando na

submerso de plancies costeiras e uma grande

descarga de gua dos Andes. O efeito do

aumento do nvel do mar foi contrabalanceado

na Amaznia pelo grande fluxo de gua de

origem andina, que, quando se chocaram,

resultou em um grande lago na bacia

amaznica, que foi formado recorrentemente no

ltimo Tercirio e no Quaternrio.

O modelo de especiao aloptrico.

Hiptese do

museu - Fjeldsa, 1994

As espcies se originam em terras altas e se

acumulam em terras baixas. Assim, vreas de

terra firme so muito instveis na escala local,

fazendo com que estas atuem, acumulando

grande nmero de espcies (de potenciais

mltiplas origens).

No possui um modelo propriamente para

especiao, mas um modelo de diferenciao,

que pode levar especiao que comea com

refgios aloptricos. Tabela 1: Principais teorias biogeogrficas propostas para a Amaznia.

Estudos filogeogrficos foram feitos com diversos organismos amaznicos como o

pirarucu, Arapaima gigas (Hrbek et al., 2005), o peixe-boi, Trichechus inunguis (Cantanhede

et al., 2005), o jacar-tinga, Caiman crocodilus (Farias et al., 2004; Vasconcelos et al., 2006),

o jacar-a, Melanosuchus niger (Farias et al., 2004; Vasconcelos et al., 2008), a tartaruga

gigante da Amaznia, Podocnemis expansa (Pearse et al., 2006). Todas estas espcies foram

excessivamente exploradas, sofrendo fortes presses antropognicas. Estes eventos

antropognicos tm causado fortes efeitos demogrficos, diminuindo o tamanho efetivo destas

13

populaes e encobrindo os reais processos que levam a distribuio filogeogrfica destes

animais (Hrbek et al., 2005; Pearse et al., 2006).

Pearse et al. (2006) verificaram uma estrutura populacional da tartaruga gigante da

Amaznia utilizando marcadores mitocondriais e microssatlites. No foi observada uma

estruturao filogeogrfica, mas foram encontradas diferenas haplotpicas entre as

populaes de diferentes bacias. Este padro foi coincidente com a fragmentao

populacional observada nestes rpteis e o homing feito pelas fmeas para a postura dos ovos.

Isto ajuda a propor estratgias de proteo e manejo que devero ser feitas considerando cada

bacia como uma populao demograficamente independente. Alm disto, o estudo tambm

permitiu conferir a eficincia do programa de proteo do IBAMA a estes animais, que

averiguou a eficcia de programas de manejo j feitos em uma populao que sofreu efeitos

de gargalo-de-garrafa.

Vasconcelos et al. (2008) e de Thoisy et al. (2006) estudaram a distribuio espacial

da variabilidade gentica do jacar-au, utilizando a regio do citocromo b do mtDNA. Os

autores verificaram que o isolamento por distncia esteve presente na dinmica populacional,

mostrando uma diferenciao gentica, causada pela hidrogeografia da regio, nas populaes

da Guiana Francesa e do Amap quando comparadas com as outras populaes da bacia

Amaznica. Alm disto, as populaes do Equador se mostraram diferenciadas geneticamente

das do Brasil, Peru e Guiana Francesa. Dentro da bacia Amaznica foi encontrada pequena

diferenciao e as distncias geogrficas e genticas no esto correlacionadas.

O estudo da filogeografia importante, pois fornece dados para a conservao das

espcies, avaliao da biodiversidade e identificao de processos que geram a diversidade

biolgica (Smith et al., 2001; Avise, 2004). Portanto, para se obter um modelo filogeogrfico

adequado preciso um organismo com ampla distribuio na rea de estudo e que no esteja

sujeito a explorao antropognica, como o caso do grupo de sapos Rhinella margaritifer.

As amostras podem ter sua distribuio geogrfica influenciada por processos geolgicos e

biolgicos que atuaram e ainda atuam nesta regio, possibilitando entender seus padres

genticos. Por isto o presente estudo sobre a filogeografia deste grupo to importante.

1.5 - MARCADORES MOLECULARES

14

Marcadores moleculares tm sido amplamente utilizados para estudos de gentica de

populaes, determinao de parentescos e paternidades, identificao de unidades

taxonmicas, dentre outros. Poucos estudos que visaram examinar a variabilidade gentica de

anfbios tropicais de ampla distribuio foram feitos utilizando diferentes tipos de marcadores

moleculares (Fouquet et al. 2007). Neste presente estudo, foram utilizados tanto marcadores

mitocondriais quanto nucleares.

O genoma mitocondrial dos vertebrados (mtDNA) uma molcula circular, composta

por 37 genes codificadores (13 genes que codificam protenas relacionadas ao metabolismo

mitocondrial, 22 RNA de transferncia e 2 rRNA) e uma regio controle no-codificadora

(Avise et al., 1986). As caractersticas que tornam os genes deste genoma bons marcadores

so: a herana uniparental, raramente sofrendo recombinao, o tamanho relativamente

pequeno (aproximadamente 16-20 kb), o arranjo dos genes geralmente conservado, taxas

evolutivas 1-10 vezes mais altas que o genoma nuclear, sendo a maioria das substituies de

bases simples e inseres/delees de um ou pouco nucleotdeos (Avise et al., 1986; 1987).

No presente trabalho sero utilizados dois marcadores mitocondriais: 12S e 16S.

Estudos envolvendo seqncias de genes que transcrevem as subunidades do RNA

ribossomal do mtDNA demonstraram que a evoluo destes genes ocorreu numa taxa

suficiente para gerar variao necessria para resolver problemas de inferncia filogentica

em anuros ( Hedges e Maxson, 1993; Hay et al., 1995; Ruvinsky e Maxson, 1996; Graybeal,

1997; Austin et al., 2002). Portanto, os genes 12S e 16S que codificam as subunidades

ribossomais podem ser bastante teis tanto na resoluo de divergncias genticas profundas

quanto no esclarecimento das relaes filogenticas de taxa mais relacionados (Goebel et al.,

1999), como o caso de Rhinella gr. margaritifer.

J o genoma nuclear, diferentemente do mitocondrial, organizado e regulado de

forma mais complexa, alm de possuir baixas taxas evolutivas em regies de alta presso

seletiva (xons). A vantagem do DNA nuclear que se observa reduzido nvel de homoplasia

entre os txons mais distantes, como conseqncia de baixa taxa evolutiva (Claubaut et al.,

2005) e a combinao dos dois marcadores fornecem informaes mais robustas, pois so

genomas com diferentes taxas evolutivas e formas de herana. Neste trabalho, sero utilizados

dois genes nucleares: rodopsina e tirosinase. A rodopsina uma

15

Figura 5: Esquema do DNA mitocondrial de um anuro. Os genes utilizados neste trabalho (12S rRNA e

16S rRNA) esto apontados pela seta e vermelho.

Modificado de Zhang et al., 2009.

protena que est associada a neurnios modificados e grupos prostticos e so responsveis

pela captao de luz (retirado de http://www.simbiotica.org/fotorreceptores.htm em 18-01-

2010 s 12:31h). J a tirosinase uma enzima que atua como um importante catalisador, que

por meio de uma complexa cadeia de reaes oxidativas converte a L-tirosina presente na pele

em L-dopa e, em seguida, em melanina. (retirado de http://www.portaleducacao.com.br

/formacao-da-melanina em 18-01-2010 s 12:39h)

Pramuk et al. (2001) examinaram as relaes evolutivas e biogeografia do grupo de

sapos Bufo peltocephalus das Antilhas (de Cuba s Ilhas Virgens). Dados de seqncias de

marcadores mitocondriais 12S, 16S e citocromo b evidenciaram a monofilia destes sapos,

sendo sua origem de algum grupo do novo mundo. Apesar destes resultados serem

concordantes com os obtidos com estudos morfolgicos e geogrficos, os autores sugerem

O

16

que mais anlises devem ser feitas para um estabelecimento preciso da filogenia dos sapos

neotropicais.

Chaparro et al. (2007) descreveram uma nova espcie do gnero Rhinella utilizando

caractersticas externas e osteolgicas e seqncias do gene mitocondrial 12S. A nova

espcie, nomeada R. manu, tpica das montanhas midas do sul do Peru. Mas apesar dos

dados morfolgicos e moleculares darem suporte a filogenia desta nova espcie, os autores

tambm sugerem que mais estudos com os sapos mais comuns da Amrica do Sul (i.e., do

gnero Rhinella) devem ser feitos para esclarecer a filogenia deste grupo de espcies.

Fouquet e colaboradores (2007) examinaram a variabilidade gentica de Rhinella gr.

margaritifer utilizando seqncias dos genes 12S, 16S, 18S e tirosinase para inferir a

filogenia e filogeografia das espcies deste grupo. O estudo, feito na Guiana Francesa,

mostrou a existncia de 11 linhagens que podem representar espcies distintas. As anlises

filogeogrficas tambm deram suporte a este novo status especfico das linhagens, sendo que

as de baixa divergncia foram encontradas em simpatria, possivelmente correspondendo a

recentes processos de especiao.

Estes e outros trabalhos envolvendo sapos neotropicais mostram a necessidade de

melhor estabelecer a taxonomia e as relaes filogenticas e, conseqentemente, contribuir

para o esclarecimento taxonmico e das hipteses filogentica e filogeogrfica do grupo

Rhinella margaritifer. Este estudo importante pois fornece dados para a avaliao da

biodiversidade e identificao de processos que geram diversidade biolgica.

Segundo Fouquet et al. (2007), a utilizao de mtodos combinando filogenia e

filogeografia, utilizando tanto marcadores nucleares quanto mitocondriais, ajudam a entender

melhor a histria evolutiva de complexos de espcies. Esses autores ainda afirmam que o

conhecimento sobre a distribuio geogrfica da diversidade gentica nas comunidades de

anfbios tropicais pode levar a concluses que diferem enormemente das anlises prioritrias

baseadas somente na ocorrncia de espcies que no pertenam a grupos. Este estudo tambm

tem potencial para contribuir mais objetivamente na conservao prioritria de anfbios em

reas tropicais.

17

2- JUSTIFICATIVA E HIPTESES

A sistemtica do grupo de sapos Rhinella margaritifer (Anura: Bufonidae) umas das

que gera mais dvidas entre os anuros neotropicais e existe uma grande variedade de

morfotipos conhecidos, alm de grande diversidade morfolgica crptica, sendo todos estes

organismos classificados, muitas vezes, como uma mesma espcie. Por serem anfbios de

ampla ocupao na Amaznia, o estudo filogeogrfico deste grupo pode prover pistas sobre a

histria evolutiva, os padres de diferenciao local e endemismo neste bioma.

As ferramentas moleculares so muito teis para identificar, caracterizar e delimitar

espcies e/ou populaes e verificar como a variabilidade gentica est geograficamente

distribuda. Assim, o objetivo deste projeto foi estudar as relaes filogenticas e

filogeogrficas deste grupo e entender os processos que possa ter dirigido a distribuio e

especiao de R. gr. margaritifer na Amaznia brasileira. Para isto, foram utilizados

marcadores mitocondriais (16S e 12S) e nucleares (rodopsina e tirosinase).

Os resultados obtidos neste estudo ajudam a determinar quantas possveis espcies

e/ou unidades significativamente evolutivas existem no grupo e, ento, comparar com

informaes morfolgicas/ecolgicas obtidas anteriormente, sendo possvel reconhecer a

biodiversidade destes anuros, entender os processos que levaram a distribuio da

variabilidade gentica e inferir o real status para conservao. Baseada nas informaes

expostas anteriormente e na extenso geogrfica da Amaznia, que abriga uma grande

diversidade da anurofauna, possvel levantar diversas hipteses. Neste estudo, toda a

problemtica abordada se resume a uma hiptese que foi testada:

H0: Rhinella gr. margaritifer composta de apenas uma unidade evolutiva significativa

H1: Rhinella gr. margaritifer composta por mais de uma unidade evolutiva significativa,

existindo diversidade crptica

18

3- OBJETIVOS

3.1 - Objetivo geral

O objetivo geral foi estudar as relaes filogenticas e a filogeografia do grupo de

espcies Rhinella margaritifer, utilizando marcadores moleculares, a fim de identificar

unidades evolutivas significativas distintas na Amaznia brasileira.

3.2 - Objetivos especficos

- Identificao de clusters moleculares;

- Anlise de clusters gerados por diferentes marcadores moleculares, sendo capazes de indicar

linhagens evolutivas distintas ou espcies;

- Proposio de uma hiptese filogentica para o grupo e;

- Inferncia de provveis eventos biogeogrficos explicando os padres filogenticos.

19

4 - MATERIAL E MTODOS

4.1 - Locais de coleta e amostragem

Os espcimes do grupo Rhinella margaritifer foram coletados em diversos pontos da

Amaznia brasileira, conforme mapa e tabela abaixo. Tambm foram coletados 2 (duas)

espcies no identificadas deste gnero, para tentarmos identific-las molecularmente, alm

de 1(um) indivduo de Bufo marinus para ser utilizado como grupo externo nas anlises deste

trabalho.

Figura 6: Mapa representando os pontos de coleta. Modificado de http://www.maps.google.com.br

20

ESPCIE LOCAL DE COLETA NMERO DE INDIVDUOS

PONTO NO MAPA

Rhinella gr. margaritifer Vila Gomes - AM 6 1

Rhinella gr. margaritifer So Gabriel da Cachoeira - AM 4 2

Rhinella gr. margaritifer Autazes - AM 8 3 Rhinella gr. margaritifer Borba - AM 4 4

Rhinella gr. margaritifer Reserva Ducke (Manaus) - AM 5 5

Rhinella gr. margaritifer Lago Miriti (Careiro) - AM 19 6

Rhinella gr. margaritifer Manaquiri - AM 14 7 Rhinella gr. margaritifer Barcelos - AM 15 8 Rhinella gr. margaritifer Manacapuru - AM 21 9

Rhinella gr. margaritifer Morrinho Esquerdo - RO 4 10

Rhinella gr. margaritifer Teotnio Esquerdo - RO 1 11

Rhinella gr. margaritifer Mutum Esquerdo - RO 1 12

Rhinella gr. margaritifer Cachoeira do Jirau - RO 9 13

Rhinella gr. margaritifer Serra do Navio - AP 6 14

Bufo magnussoni Treviso - PA 15 15 Bufo castaneoticus Treviso - PA 8 15

Bufo marinus Reserva Ducke (Manaus) - AM 1 5

Rhinella sp. ParNa Viru - RR 1 16

Rhinella sp. Ramal do Puru Puru - AM 1 17

TOTAL 142

As coletas foram realizadas utilizando a licena concedida pelo RAN/ IBAMA, sob

nmero 13777-2. O esforo de coleta visou um mnimo de 10 indivduos por localidade. Os

espcimes foram fotografados e, quando possvel, tiveram seu canto gravado. As localidades

Tabela 2: Relao entre espcies, nmero de indivduos e locais coletados.

21

amostradas foram georeferenciadas (conforme apndice 1) e os animais tiveram uma amostra

de tecido muscular retirada e armazenadas na Coleo de Tecidos de Gentica Animal/CTGA

do Laboratrio de Evoluo e Gentica Animal (LEGAL), Instituto de Cincias Biolgicas da

Universidade Federal do Amazonas. Aps, estes foram fixados em formol 10% e depositados

na coleo de Herpetologia do Instituo Nacional de Pesquisas da Amaznia (INPA).

4.2 - Extrao do DNA

Para cada exemplar, antes da fixao em formol, foi coletada uma pequena poro do

tecido muscular, posteriormente preservada em lcool 96%. O DNA genmico total foi

extrado utilizando-se o mtodo padro de extrao com CTAB e Proteinase K como proposto

por Doyle e Doyle (1987), com algumas modificaes.

Um pequeno pedao do msculo (aproximadamente 100mg) foi cortado e digerido com

Proteinase K, que uma enzima proteoltica no-especfica com atividade em diferentes pH, e

soluo de CTAB 2% (Brometo de Cetiltrimetilamnio), um detergente que rompe as

membranas celulares para a liberao dos cidos nuclicos. O msculo foi cortado em

pedaos menores e acondicionado em um microtubo de 1,5 mL com 500L de tampo CTAB

2% e 15L de Proteinase K e deixado em banho-maria a 60C overnight ou at a total

digesto do tecido.

Aps, foi feita uma desproteinizao pela adio de clorofrmio: lcool-isoamlico

(25:1), seguida por centrifugao a 10000rpm por 10 minutos. O sobrenadante foi retirado e

armazenado em um novo microtubo. Foi adicionado, ento, 500L de isopropanol frio e a

amostra ficou incubada no freezer por duas horas para a precipitao dos cidos nuclicos. O

pellet formado aps centrifugao a 10000rpm por 20 minutos foi lavado com lcool 70%,

centrifugado a 10000rpm por 10 minutos e ficou secando em ar seco. Por ltimo, o DNA foi

ressuspendido em 50L de gua ultra-pura.

O DNA extrado teve sua integridade avaliada e foi quantificado por eletroforese sob

luz UV, por comparao com marcador de peso molecular conhecido. Para isto, 2 l do

corante Bromofenol misturado a 2 l do DNA total foram aplicados em gel de agarose 1% e

levados cuba de eletroforese horizontal com tampo Tris-Borato-EDTA 1X onde a corrida

do material foi feita a 70 V iniciais, passados para 95 V. Posteriormente, o gel de agarose foi

corado com brometo de etdeo (EtBr, 0,5 g/mL) e levado a um transiluminador de luz

ultravioleta Image Master (Pharmacia Biotech) para avaliao do DNA.

22

4.3 - Amplificao por reao em cadeia da polimerase (PCR)

Os genes mitocondriais (12S rRNA e 16S rRNA) e nucleares (Tirosinase e Rodopsina)

foram amplificados via reao em cadeia da polimerase (PCR) (Saiki et al., 1988), tcnica que

permite a obteno de um grande nmero de cpias de um fragmento de interesse a partir do

DNA genmico molde, extrado do tecido.

Para os genes mitocondriais 12S e 16S foram feitas reaes de PCR com volume final

de 15L, conforme tabela abaixo.

Tabela 3: Componentes da reao de PCR dos genes mitocondriais

REAGENTES CONCENTRAO VOLUME (L)

Tampo 10X 1,5

MgCl2 25mM 1,5

dNTP 10mM 1,5

Primer forward 2mM 1,5

Primer reverse 2mM 1,5

BSA 5C 1,0

Taq DNA polimerase 5u/L 0,3

DNA (amostra) -- 1,0

gua ultra-pura -- 5,2

TOTAL 15

Cada amostra de reao foi colocada em tubo de 0,2 l e levada a um termociclador

Veriti (Applied Biosystems) onde se processou a reao de amplificao, conforme os passos

descritos abaixo:

Desnaturao inicial a 92C por 1 minuto;

35 ciclos de:

. Desnaturao a 92 C por 60 segundos;

. Anelamento a 50 C (16S) e 54C (12S) por 40 segundos;

. Extenso a 72 C por 90 segundos;

Extenso final a 72 C por 5 minutos (uma nica vez).

23

J para os genes nucleares da tirosinase e rodopsina foram feitas duas amplificaes,

uma primeira com primers externos e a segunda com primers flanqueadores das regies

gnicas de interesse. As amplificaes foram feitas num volume final de 26L e cada uma

das PCR (para o primeiro e segundo par de primers) teve temperatura de anelamento

diferente.

Tabela 4: Componentes da primeira reao de PCR dos genes nucleares

REAGENTES CONCENTRAO VOLUME (L)

Tampo 10X 2,5

MgCl2 25mM 2,0

dNTP 10mM 2,0

Primer forward 2mM 2,5

Primer reverse 2mM 2,5

BSA 5C 2,5

Betaine 6M 5,4

Taq DNA polimerase 5u/L 0,7

DNA (amostra) -- 2,0

gua ultra-pura -- 3,9

TOTAL 26

Cada amostra de reao foi colocada em tubo de 0,2 l e levada a um termociclador

Veriti (Applied Byosystems) onde se processou a reao de amplificao, conforme os passos

descritos abaixo:

Desnaturao inicial a 68C por 1 minuto;

35 ciclos de:

. Desnaturao a 93 C por 10 segundos;

. Anelamento a 50 C (tirosinase) e 53C (rodopsina) por 35 segundos;

. Extenso a 68 C por 90 segundos;

Extenso final a 68 C por 7 minutos (uma nica vez)

Aps, o produto desta primeira amplificao foi utilizado como molde para a

amplificao com os primers internos, como mostram as tabelas abaixo.

Tabela 5: Componentes da segunda reao de PCR dos genes nucleares

24

REAGENTES CONCENTRAOVOLUME

(L)

Tampo 10X 2,5

MgCl2 25mM 2,0

dNTP 10mM 2,0

Primer forward 2mM 2,5

Primer reverse 2mM 2,5

Taq DNA polimerase 5u/L 0,7

DNA (amostra do amplificado do

primeiro PCR) -- 2,0

gua ultra-pura -- 11,8

TOTAL 26

Cada amostra de reao foi colocada em um novo tubo de 0,2 l e levada a um

termociclador Verit (Applied Byosystems) onde se processou a segunda reao de

amplificao, conforme os passos descritos abaixo:

Desnaturao inicial a 68C por 1 minuto;

35 ciclos de:

. Desnaturao a 93 C por 10 segundos;

. Anelamento a 55 C (tirosinase) e 50C (rodopsina) por 35 segundos;

. Extenso a 68 C por 90 segundos;

Extenso final a 68 C por 7 minutos (uma nica vez)

Os primers utilizados neste trabalho, bem como suas seqncias e referncias esto

listados na tabela a seguir.

Primers Seqncias Referncias

16S A 5' - CGCCTGTTTACCAAAAACATCGCCT 3

16S B 5 - CCGGTCTGAACTCAGATCACGT - 3

Palumbi et

al., 1991

Phef.1 5 - CAAAGCATAGCACGTAAAATGC - 3

12S r.6 5- CGATTATAGRACAGGCTCCTCTAG 3

Salducci et

al., 2005

25

Tyr 1.A 5 AGGTCCTCTTRAGCAAGGAATG 3

Tyr 1.E 5 GAGAAGAAAGAWGCTGGGCTGAG 3

Bossuyt et

al., 2000

Tyr 1r.1 5 AGTCCCAGAAGGGAATGGTGRAG-3

Tyr 1f.1

5-

GTAAAACGACGGCCAGTCCTGTCTAACTCTTCC

ATAGG-3

No

publicado *

Rhod Ex.3r.1 5- AGTGSACGACGAACATGTAGAT -3

Rhod Ex.1f.1 5 - ATGAACGGAACAGAAGGYCC - 3

Rhod Ex.

3r.2 5 AATACGACTCACTATAGGCTTCAGGG -3

Rhod Ex.

1f.2 5 GTAAAACGACGGCCAGTCCCATGTCC - 3

No

publicado *

Tabela 6: Primers utilizados neste trabalho, suas seqncias e devidas referncias. As referncias onde

se encontram * se referem a primers desenhados para este trabalho.

Para verificar se as amostras foram amplificadas, 2 l do produto de PCR foi

adicionado a 2 l de azul de Bromofenol para anlise em eletroforese em gel de agarose 1%

corado com brometo de etdeo (0,5g/mL) e visualizado em transiluminador de luz UV. O

tamanho do amplificado foi verificado por comparao com marcador de tamanho molecular

conhecido.

4.4 - Purificao e seqenciamento

Os produtos de PCR foram purificados utilizando enzimas exonucleases e fosfatase

alcalina de acordo com as recomendaes do fabricante do kit ExoSap (GE Healthcare). Estas

enzimas, em sua temperatura de ao, gerada por termociclador, eliminam resduos de baixo

peso molecular como restos de primers, dNTPs e sais, permitindo a retirada de impurezas da

PCR. Para cada 10 l do produto da PCR foi utilizado 0,27 l de EXO (10 u/l); 0,40 l de

SAP (1 u/l) e 2,33 l de gua ultra-pura.

A reao de seqenciamento foi feita em uma placa especfica (para eletroinjeo no

seqenciador), num volume final, por amostra, de 10 l, contendo: DNA amplificado e

purificado; Big Dye, que um mix contendo DNA polimerase, dNTPs e dideoxinucleotdeos

26

(que possuem a fluorescncia a ser captada no seqenciador automtico); tampo do Big Dye;

primer e gua ultra-pura. As concentraes e volumes se encontram na tabela abaixo.

Para 12S e 16S, foram utilizados os prprios primers forward usados na reao de

PCR. Entretanto, para os genes nucleares da rodopsina e tirosinase, a reao de seqncia foi

feita com a cauda universal M13, complementar s 17 bases do primers forward da segunda

amplificao destes genes.

Tabela 7: Componentes da reao de PCR seqenciamento

REAGENTES CONCENTRAO VOLUME

(L)

Big Dye Terminator -- O,25

Buffer do Big Dye 5x 2,5

Primer 2mM 2,0

Amostra purificada -- 2,0

gua ultra-pura -- 3,25

TOTAL 10,0

Em seguida, as amostras foram submetidas ao termociclador com ciclos programados

para desnaturao das fitas complementares; anelamento dos primers e extenso da regio a

ser seqenciada, conforme os passos descritos abaixo:

35 ciclos de:

. Desnaturao a 96 C por 10 segundos;

. Anelamento a 50 C por 35 segundos;

. Extenso a 60 C por 4 minutos;

Os produtos amplificados para seqenciamento foram precipitados utilizando

etanol/EDTA (2,5l de EDTA a 125 mM e 27,5 l de etanol absoluto) e etanol 70% (30 l),

sempre seguido de centrifugaes a rotaes e temperaturas adequadas. Este procedimento

retira restos de primer e DNA da reao de seqenciamento. Aps, as amostras foram

ressuspendidas em 10L de formamida.

Em seguida, a placa contendo o DNA foi submetida eletroinjeo no seqenciador

automtico ABI 3130XL (Applied Biosystems), de acordo com a metodologia padro proposta

pelo fabricante.

27

4.5 - Edio e alinhamento das seqncias

As seqncias obtidas foram editadas no programa BioEdit Version 7.0.9.0 (Hall,

1999) e alinhadas com o auxlio da ferramenta Clustal W (Thompson et al., 1996), utilizando

as configuraes padro, alm da edio manual. Aos stios que apresentaram indels, foram

acrescidos gaps com a finalidade de manter a homologia entre as seqncias.

Os stios variveis foram checados no programa MEGA 4.0 (Kumar et al., 2004).

Neste programa tambm foi checada a presena de heterozigotos nas seqncias nucleares.

4.6 - Anlise de dados

4.6.1 Anlise filogentica

As relaes filogenticas construdas sob o critrio de mxima verossimilhana foram

estimadas utilizando-se o programa Treefinder (Jobb, 2008), com robustez de 1000 pseudo-

rplicas no paramtricas de bootstrap. O modelo molecular evolutivo mais provvel foi

inferido com o auxlio do programa PAUP 4.0 Beta Version (Swofford, 1998) e do aplicativo

online ModelTest Server (Posada, 2006), utilizando-se o critrio de informao corrigida

AKAIKE (AIC) (Akaike, 1974). Alm das seqncias obtidas neste trabalho tambm foram

utilizadas seqncias de Rhinella gr. margaritifer depositadas no GenBank geradas pelo

estudo de Fouquet e colaboradores (2007) para os genes 12S, 16S e tirosinase. Estas amostras

foram previamente classificadas em linhagens, conforme proposto pelos autores: R.

margaritifer A, R. margaritifer B, R. margaritifer C, R. margaritifer D e R. margaritifer E.

Cada grupo estabelecido na anlise filogentica de mxima verossimilhana foi

definido como uma unidade evolutiva significativa (SEU), como proposto por Moritz (1994),

quando trs critrios foram aceitos: o primeiro a monofilia nos gene de mtDNA, o segundo

valores de bootstrap acima de 70% e o terceiro valores significativos de Fst par a par para os

genes nucleares, que foram calculados no programa Arlequin 3.1 (Excoffier et al., 2005).

4.6.2 Redes haplotpicas

A inferncia do relacionamento entre os hapltipos foi baseada no mtodo de

parcimnia estatstica de Templeton et al. (1992). Esse mtodo gera a estimativa do nmero

28

mximo de diferenas entre os hapltipos como resultado de substituies nicas com

confiabilidade de 95% (Posada e Crandall, 2001). Estas anlises foram feitas atravs do

programa TCS 1.21 (Clement et al., 2000), e a hierarquizao da rede de hapltipos foi feita

segundo algoritmo descrito por Templeton et al. (1987) e Templeton e Sing (1993). As

sequncias nucleares foram transformadas em hapltipos utilizando o programa PHASE 2.1

(Stephens et al., 2004) e o aplicativo online SeqPhase (Flot, 2010). Os dois possveis

hapltipos obtidos foram utilizados na construo da rede de hapltipos. As ambigidades de

conexes resultantes das mutaes homoplsicas na rede de hapltipos foram resolvidas

utilizando as informaes da topologia geradas pela mxima verossimilhana.

4.6.2 Anlises filogeogrficas

Para verificar a significncia da associao entre os hapltipos com a distribuio

geogrfica inferindo eventos histricos e demogrficos, como resultado dos nveis de restrio

de fluxo gnico, foi usada a anlise dos clados hierarquizados (Nested Clade Phylogeography

Analysis NCPA), desenvolvido por Templeton et al. (1995), utilizando-se o programa

GEODIS (Posada et al,. 2000) e a chave de inferncia de Templeton (2004), dentro do

software ANeCA 1.2 (Panchal, 2007). Os nveis de confiana foram estimados por testes de

permutaes (1000 replicaes). A partir da genealogia gnica, freqncia de hapltipos e

distncias geogrficas, o NCA gera inferncias que permitem discriminar eventos histricos

(e.g. fragmentao, expanso, etc.) e processos atuais (e.g. fluxo gnico) que possam estar

influenciando nas distribuies de uma determinada espcie ou linhagem. Todas as

inferncias obtidas foram corroboradas atravs de testes estatsticos adicionais. Para verificar

a diferenciao entre os grupos, foram feitos testes de Varincia Molecular (AMOVA) e de

estruturao populacional (Fst), que, quando confirmados, podem ser explicaes para

eventos de fragmentao ou colonizao a longas distncias ou quaisquer casos em que o

fluxo gnico ficava restrito. J os eventos de expanso foram verificados com os testes Fs de

Fu e D de Tajima. Todas estas anlises foram feitas utilizando o programa Arlequin 3.1

(Excoffier et al., 2005). Por ltimo, foi feita uma anlise de concordncia espacial entre os

resultados de diferentes genes.

29

5 - RESULTADOS

5.1 - 16S

5.1.1 - Filogenia

Para o gene 16S, foi obtido um total de 357 pb para 102 indivduos de Rhinella gr.

margaritifer. Alm disto, foram utilizadas 21 seqncias deste complexo de espcies,

provenientes da Guiana Francesa, que se encontram depositadas no GenBank, 1 seqncia de

Bufo marinus e mais 7 seqncias de outras espcies relacionadas, estas oito ltimas usadas

como grupo externo, num total de 131 seqncias de 16S. A composio das bases apresentou

a proporo anti-guanina (A = 31,89%, C = 19,98%, G = 18%, T = 30,13%), sendo que a base

adenina (A) se apresentou em maior proporo.

A rvore filogentica baseada no mtodo de Mxima Verossimilhana para o gene 16S

(figura 7) foi proposta segundo o modelo molecular evolutivo de substituio nucleotdica

GTR+G (general time reversible + Gamma), que prope que cada nucleotdeo tem uma taxa

de substituio prpria, levando-se em considerao sua freqncia e a discreta distribuio

gamma, que prediz que os stios evoluem diferentemente (Felsenstein, 2004;

www.molecularevolution.org em 16/03/2010 s 12:58h).

Nesta anlise foram obtidos 14 grupos de R. margaritifer e 7 grupos externos (os

grupos B. gargarizans, B. japonicus, B. melanosticus, B. granulosus, B. gutatus, B. marinus e

um clado formado por Atelopus flavescens e A. barbotini). Esta separao em 21 clados foi

baseada tanto na topologia da rvore filogentica quanto nos valores de distncia gentica

entre os possveis grupos. Para os indivduos cuja posio filogentica no permitiu sua

incluso nos 21 agrupamentos por meio de inspeo visual da topologia foram realizadas

comparaes de distncia gentica par a par, sendo as divergncias menores que 1%

agrupadas no mesmo clado.

Os 14 agrupamentos obtidos para R. margaritifer foram: clado 1, composto por

Morrinho e Teotnio Esquerdo; clado 2, composto por B. castaneoticus; clado 3,

correspondente aos indivduos da Reserva Ducke; clado 4, formado pela possvel linhagem R.

30

margaritifer E; clado 5, formado pela possvel linhagem R. margaritifer A; grupo 6, formado

pela possvel linhagem R. margaritifer C; clado 7, composto por Barcelos e Manacapuru;

clado 8, formado pela possvel linhagem R. margaritifer D; clado 9, formado por Mutum e

Autazes; clado 10, composto por Manaquiri e Careiro; clado 11, formado por todos

31

Figura 7: rvore filogentica de 16S baseada no mtodo da Mxima Verossimilhana, reconstruda com robustez de 1000 replicas no paramtricas de bootstrap. O modelo evolutivo foi o GTR + G + I.

32

indivduos do Jirau e um de Morrinho; grupo 12, formado por Borba e So Gabriel da

Cachoeira; clado 13, formado por Vila Gomes; e finalmente clado 14 formado por alguns

indivduos de Manacapuru.

5.1.2 - Rede de hapltipos