View
212
Download
0
Category
Preview:
Citation preview
PONTIFÍCIA UNIVERSIDADE CATÓLICA DO RIO GRANDE DO SUL
FACULDADE DE BIOCIÊNCIAS
PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA CELULAR E MOLECULAR
TAIZ LEONOR LOPES SIMÃO
AVALIAÇÃO DE GENES NUCLEARES COMO MARCADORES
FILOGENÉTICOS EM DUAS LINHAGENS RECENTES DE CARNÍVOROS
NEOTROPICAIS
PORTO ALEGRE – RS – BRASIL
2011
PONTIFÍCIA UNIVERSIDADE CATÓLICA DO RIO GRANDE DO SUL
FACULDADE DE BIOCIÊNCIAS
PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA CELULAR E MOLECULAR
AVALIAÇÃO DE GENES NUCLEARES COMO MARCADORES
FILOGENÉTICOS EM DUAS LINHAGENS RECENTES DE CARNÍVOROS
NEOTROPICAIS
Dissertação apresentada ao
Programa de Pós-Graduação em
Biologia Celular e Molecular como
requisito para a obtenção do grau
de Mestre.
Autora Taiz Leonor Lopes Simão
Orientador
Eduardo Eizirik
Porto Alegre, RS Abril, 2011
I
AGRADECIMENTOS
A minha família e amigos, pelo amor incondicional e apoio em todos os
momentos.
Ao meu orientador e amigo, Professor Eduardo Eizirik, pela confiança,
incentivos e por todo o empenho para a conclusão deste trabalho.
Aos colegas do Laboratório de Biologia Genômica e Molecular, pelo apoio
quando necessário.
À Fernanda Britto, meu alicerce inicial no Laboratório, responsável por minha
formação nas práticas de bancada.
À Cladinara Sarturi, pela dedicação, competência e disponibilidade em me
auxiliar na execução deste trabalho.
Ao Professor Sandro Bonatto, meu primeiro orientador. Obrigada pela
oportunidade.
À Laura Utz, pela amizade e orientação em projetos paralelos.
II
RESUMO
A região Neotropical abriga aproximadamente 30% da diversidade de
espécies das famílias Felidae (subordem Feliformia) e Canidae (subordem
Caniformia) (Eisenberg & Redford 1999), as quais migraram para a América do
Sul após a formação do istmo do Panamá, há cerca de 3 milhões de anos.
Devido ao recente processo de especiação que caracteriza estes grupos,
alguns aspectos de sua estrutura filogenética permanecem controversos,
especialmente no que tange às relações evolutivas entre espécies
pertencentes a duas linhagens, o gênero Leopardus (Feliformia, Felidae) e o
gênero Lycalopex (Caniformia, Canidae). O objetivo do presente estudo é
caracterizar de forma comparativa a história evolutiva dos gêneros Leopardus e
Lycalopex, empregando seqüências de múltiplos segmentos nucleares e
múltiplos indivíduos por espécie, avaliando a eficácia deste tipo abordagem
para a resolução de processos recentes de diversificação através do programa
*BEAST. Para cada um dos genes analisados, observamos a ocorrência de
variação interespecífica e intra-específica em ambas as linhagens.
Discrepâncias genealógicas consideráveis foram constatadas entre os
segmentos, evidenciando a complexidade da tarefa de reconstruir a filogenia
destes grupos com marcadores nucleares. As genealogias estimadas
demonstraram que em muitos casos as espécies não se apresentam
monofiléticas, o que ocorre em paralelo com o compartilhamento de haplótipos
entre espécies. Não obstante, para Leopardus, obtivemos uma species tree
com alta resolução. Para Lycalopex, entretanto, a maior parte dos nós internos
permaneceu com baixo suporte, indicando que um número maior de genes
será provavelmente necessário para que se busque uma resolução consistente
da filogenia deste grupo empregando estratégias multi-locus. De forma geral,
nossos resultados demonstraram de forma empírica a ocorrência de
discordância genealógica em ambas as linhagens, e ilustraram o potencial de
análises multi-locus na resolução de filogenias que envolvam processos
recentes de diversificação.
Palavras-chave: *BEAST, Species tree, Análises Multilocus, Processo recente
de diversificação, Gênero Leopardus, Gênero Lycalopex.
III
ABSTRACT
The Neotropical region holds approximately 30% of the current species
diversity in the carnivoran families Felidae (subordem Feliformia) and Canidae
(subordem Caniformia), which migrated to South America after the closure of
the Panamanian Isthmus, ca. 3 million years ago. Due to the recent speciation
process that characterizes each of these groups, some aspects of their
phylogenetic structure remain controversial, especially those related to the
evolutionary relationships among species belonging to two lineages, the genus
Leopardus (Felidae) and the genus Lycalopex (Canidae). The objective of the
present study was to perform a comparative characterization of the evolutionary
history of these genera, using sequences of multiple independent nuclear gene
loci and multiple individuals per species to investigate the occurrence of
genealogical discordance, as well as to infer a ‘species tree’ for each lineage
using the program *BEAST. We observed both intra-specific and interspecific
variation for all the surveyed segments. Genealogical discordance was
identified among segments, highlighting the complexity of the task of
reconstructing the phylogeny of such groups by employing nuclear markers.
The estimated genealogies demonstrated that species were often not
monophyletic, while there were several cases of inter-specific haplotype
sharing. Nevertheless, the species tree reconstructed for Leopardus was highly
resolved and supported, indicating that our data set contained sufficient
genealogical information to retrieve this phylogeny. However, in the case of
Lycalopex, most of the internal nodes received low support, indicating that a
larger number of genes will likely be necessary to consistently resolve its
phylogenetic structure using this type of approach. Overall, our results have
empirically demonstrated the occurrence of genealogical discordance in both
lineages, and illustrated the potential of multi-locus analyses to resolve
phylogenies underlying recent diversification processes.
Keywords: *BEAST, Species tree, Multilocus analysis, Recent diversification
process, Leopardus, Lycalopex
SUMÁRIO
AGRADECIMENTOS .......................................................................................... I
RESUMO............................................................................................................ II
ABSTRACT ....................................................................................................... III
1. CAPÍTULO 1 – INTRODUÇÃO E OBJETIVOS ............................................01
1.1 INTRODUÇÃO............................................................................01
1.2 OBJETIVOS................................................................................07
1.2.1 OBJETIVOS GERAIS.................................................................07
1.2.2 OBJETIVOS ESPECÍFICOS......................................................07
2. CAPÍTULO 2 – ARTIGO CIENTÍFICO ......................................................... 08
REFERÊNCIAS BIBLIOGRÁFICAS..................................................................21
1
1.1 INTRODUÇÃO
A Ordem Carnivora é atualmente classificada em 16 famílias que
agrupam 286 espécies, com ampla variação morfológica, ecológica, fisiológica
e comportamental (Eizirik & Murphy 2009), distribuídas em praticamente todos
os ambientes (Nowak 2005). Seus representantes são agrupados em duas
subordens monofiléticas, Feliformia e Caniformia, com a divergência estimada
em 53 milhões de anos (Ma) (Eizirik & Murphy 2009) (Figura 1).
Figura 1: Relações filogenéticas da ordem Carnivora, apresentada com a estimativa do
tempo de divergência entre as linhagens (fonte: Eizirik & Murphy 2009).
A região Neotropical abriga aproximadamente 30% da diversidade de
espécies das famílias Felidae (subordem Feliformia) e Canidae (subordem
Caniformia) (Eisenberg & Redford 1999), as quais migraram para a América do
Sul após a formação do istmo do Panamá, há cerca de 3 Ma (Johnson et al.
2006; Eizirik [no prelo]). Evidências moleculares indicam que ambas sofreram
processos de radiação adaptativa endêmica, os quais podem ter sido
2
facilitados ou promovidos por características geológicas e ecológicas desta
região. Por exemplo, pode-se mencionar a hipótese de que flutuações
climáticas ocorridas durante o Pleistoceno promoveram modificações na
cobertura vegetal, conduzindo ao isolamento de populações em áreas de
refúgio e, resultando em altas taxas de especiação na fauna tropical (Haffer
1969). Devido ao recente processo de especiação que caracteriza estes
grupos, alguns aspectos de sua estrutura filogenética permanecem
controversos, especialmente no que tange às relações evolutivas entre
espécies pertencentes a duas linhagens, o gênero Leopardus (Feliformia,
Felidae) (Figura 2) e o gênero Lycalopex (Caniformia, Canidae) (Figura 3).
Figura 2: Relações filogenéticas da Família Felidae. O nó 23 (salientado por um
retângulo roxo) representa as espécies pertencentes ao gênero Leopardus. (fonte:
Johnson et al. 2006). As cores indicam a distribuição geográfica de cada uma das
linhagens, conforme a legenda exibida na porção superior.
3
Figura 3: Relações filogenéticas entre espécies da família Canidae. O clado em verde
representa as espécies neotropicais incluindo o gênero Lycalopex (salientado por um
retângulo verde). Os nomes populares indicados se referem às seguintes espécies:
Sechuran fox = Lycalopex sechurae; Culpeo fox = L. culpaeus; Pampas fox = L.
gymnocercus; Chilla = L. griseus; Darwin’s fox = L. fulvipes; Hoary fox = L. vetulus
(fonte: Lindblad-Toh et al. 2005).
O gênero Leopardus inclui sete das dez espécies neotropicais da família
Felidae. Seus representantes sofreram diversificação nos últimos 2.9 Ma e
distribuem-se predominantemente na América de Sul. Enquanto algumas
espécies apresentam distribuição restrita (por exemplo, L. guigna e L. jacobita)
outras são observadas por áreas extensas e algumas vezes em simpatria (por
exemplo, L. pardalis é simpátrico com L. wiedii ao longo de quase toda a sua
4
distribuição). As relações filogenéticas entre várias destas espécies já é bem
caracterizada com base em marcadores moleculares (Eizirik et al. 1998;
Johnson et al. 2006; Trigo et al. 2008), permanecendo incerta principalmente a
posição de L. jacobita. Outra característica interessante deste grupo é a
ocorrência documentada de hibridação entre L. tigrinus e duas espécies
distintas, L. geoffroyi e L. colocolo (Johnson et al. 1999; Trigo et al. 2008), o
que provavelmente reflete sua história recente de especiação, e oportuniza
investigações interessantes no contexto de análises filogenéticas, genômicas e
ecológicas.
De maneira similar à família Felidae, também são descritas dez espécies
de canídeos na região neotropical, as quais apresentam ampla variação
ecológica. Alguns autores sugerem que a migração para a América do Sul
tenha ocorrido em múltiplos episódios (p.ex. Wang et al. 2004), enquanto
outros defendem que a radiação neotropical desta família foi
predominantemente endêmica, sendo derivada de apenas dois eventos de
fundação (p.ex. Perini et al. 2010). Tendo em vista os resultados mais recentes
de datação molecular, permanece possível que toda a radiação de canídeos
neotropicais seja endêmica da região, derivando de apenas um episódio de
colonização (Eizirik [no prelo]). Dentro desta linhagem, um caso extremo de
radiação endêmica é aquele do gênero Lycalopex, composto por seis espécies
cuja diversificação ocorreu há aproximadamente um milhão de anos (Wang et
al. 2004; Perini et al. 2010), e cujas relações filogenéticas ainda não foram bem
resolvidas (p.ex. Zrzavy & Ricankova 2004; Lindblad-Toh et al. 2005; Perini et
al. 2010).
5
A análise de seqüências do DNA mitocondrial (mtDNA) tem sido uma
abordagem muito importante em estudos filogenéticos cujo objetivo é
determinar as relações evolutivas entre linhagens. O mtDNA apresenta
características como a herança matrilinear, recombinação baixa ou ausente e
taxas de mutação geralmente mais altas do que aquelas observadas no DNA
nuclear (nDNA) (p.ex. Brown et al. 1979; Ladoukakis & Zouros 2001). A
comparação entre seqüências do nDNA desenvolveu-se ao longo da década
de 90, em conjunto com as análises multilocus, onde regiões diversas do
genoma são amostradas. Isto possibilitou a resolução de diferentes níveis
taxonômicos, pois, o genoma é heterogêneo e os processos de substituição, tal
como, as taxas de mutação, variam entre os genes (Cummings et al. 1995;
Brito & Edwards 2009).
Atualmente, diversos autores apontam os marcadores nucleares como
uma ferramenta inovadora que expressa de forma mais precisa a diversidade
genética, o tamanho populacional, a divergência entre espécies e a datação
destes eventos (Bazin et al. 2006; Degnan & Rosenberg 2009; Yang & Rannala
2010). Frequentemente a análise individual de segmentos nucleares produz
genealogias conflitantes, sendo insuficiente para determinar o padrão de
coalescência ancestral em cada um dos nós de uma filogenia (Figura 4)
(Edwards et al. 2007; Brito & Edwards 2009). Neste contexto, torna-se
relevante a amostragem de múltiplos locos e múltiplos indivíduos por espécie,
pois, em virtude da variação intra-específica e/ou manutenção do haplótipo
ancestral, inferências a partir de um único loco e/ou um único indivíduo podem
6
não expressar de forma confiável a relação entre as linhagens (Degnan &
Rosenberg 2009; Yang & Rannala 2010).
Figura 4: Exemplo da heterogeneidade na topologia e tempos de coalescência entre
diferentes regiões genômicas em uma análise filogeográfica multilocus (cada árvore
indica a genealogia estimada por um segmento distinto). As letras a, h e c
representam as espécies Poephila acuticauda, P. hecki e P. cincta, respectivamente. A
árvore filogenética no canto inferior direito representa as relações filogenéticas entre
as espécies inferidas pelo método de ‘species tree’ multilocus de Liu & Pearl (2007).
As genealogias indicadas na porção ‘A’ da figura estão de acordo com a filogenia das
espécies, enquanto ‘B’ e ‘C’ indicam topologias alternativas (fonte: Brito & Edwards
2009).
Análises sofisticadas desenvolvidas recentemente (p.ex. Liu & Pearl
2007 e Heled & Drummond 2010) viabilizam o uso combinado de múltiplos
locos para estimar a filogenia das espécies, o seu tempo de divergência e/ou o
tamanho populacional de ancestrais representados em nós da árvore de
relacionamentos. Este tipo de análise pode considerar características como
recombinação, sendo mais eficiente do que o método de concatenação,
permitindo a delimitação de espécies derivadas de eventos recentes de
diversificação (Edwards et al. 2007).
7
1.2 OJBETIVOS
1.2.1 Objetivo geral:
Caracterizar de forma comparativa a história evolutiva dos gêneros
Leopardus e Lycalopex, empregando seqüências de múltiplos
segmentos nucleares e múltiplos indivíduos por espécie, avaliando a
eficácia deste tipo abordagem para a resolução de processos recentes
de diversificação.
1.2.2 Objetivos específicos:
Identificar marcadores moleculares nucleares que apresentem
variabilidade em grupos de espécies de carnívoros recentemente
divergidas.
Caracterizar a diversidade genética destes segmentos em múltiplos
indivíduos das espécies selecionadas para este estudo.
Estimar a genealogia das espécies e indivíduos amostrados para cada
segmento, comparando os padrões observados entre cada um dos
marcadores
Estimar genealogias de espécies empregando diferentes métodos
analíticos, comparando seus resultados e contribuindo para a resolução
da filogenia interna de cada um dos gêneros investigados.
CAPÍTULO 2
ARTIGO CIENTÍFICO
An empirical test of nuclear genealogical discordance in two parallel radiations of Neotropical carnivores
(Artigo submetido ao periódico Biology Letters)
8
An empirical test of nuclear genealogical discordance in two
parallel radiations of Neotropical carnivores
Taiz L. L. Simão1, Gabriel S. Macedo1,2, Alexandra Schneider1, Larissa R.
Oliveira3, Susana Cárdenas-Alayza4, Fernando Angulo Pratolongo5, Eduardo
Eizirik1,6 *
1Laboratório de Biologia Genômica e Molecular, Faculdade de Biociências, Pontifícia
Universidade Católica do Rio Grande do Sul, Av. Ipiranga, 6681, prédio 12, sala 172. Porto
Alegre, RS 90619-900, Brazil.
2Current address: Centro de Pesquisa Experimental, HCPA, Laboratório de Medicina
Genômica, Rua Ramiro Barcelos, 2350. Porto Alegre, RS 90035-903, Brazil.
3Programa de Pós-Graduação em Biologia, Universidade do Vale do Rio dos Sinos
(UNISINOS),
Avenida Unisinos, 950, São Leopoldo, RS, Brazil, 93022-000
4Centro para la Sostenibilidad Ambiental, Universidad Peruana Cayetano Heredia (UPCH),
Armendáriz 445, Miraflores, Lima 18, Peru.
5Lambayeque, Peru.
6Instituto Pró-Carnívoros. Atibaia, SP, Brazil.
*Author for correspondence (eduardo.eizirik@pucrs.br)
Genealogical discordance describes cases in which different genomic
regions produce discrepant phylogenies of the same group of organisms. Such
occurrences may result from several processes, including incomplete lineage
sorting affecting multiple successive rounds of speciation. Although such
processes may be prevalent in recently diversified lineages and seriously
hamper accurate phylogenetic reconstruction, there are still few empirical
studies documenting and analyzing this problem. Moreover, many recent
phylogenetic studies continue to use a single individual to represent each
species, and to concatenate multiple nuclear segments, without an assessment
of possible biases resulting from this approach in the case of recent radiations.
9
Here we investigate this issue in two recently diversified lineages of Neotropical
carnivores: the genera Leopardus (Felidae) and Lycalopex (Canidae). We
sequenced multiple nuclear segments in multiple individuals of these species
and analyzed their genealogical patterns. We observed cases of intra-specific
variation coupled with lack of species monophyly in all genes for both genera,
indicating the pervasive occurrence of incomplete lineage sorting in these
recent radiations. We estimated a species tree for each lineage using the
program *BEAST, and obtained good resolution for genus Leopardus, but not
for the more recently diversified Lycalopex. Overall, our results demonstrate the
potential problems derived from concatenating nuclear segments and
employing a single individual per species when attempting to reconstruct the
phylogenetic history of recent radiations.
Running Head: Genealogical discordance in carnivores
Keywords: *BEAST, Species tree, multi-locus analysis, gene genealogies,
recent diversification, Leopardus, Lycalopex.
1. INTRODUCTION
The Neotropical region holds approximately 30% of the species diversity
of the carnivoran families Felidae (subordem Feliformia) and Canidae
(subordem Caniformia) [1], which migrated to South America after the closure of
the Panama Isthmus, ca. 3 million years ago [2,3]. Molecular evidence indicates
that both went through processes of endemic adaptive radiation, which may
have been facilitated or promoted by geological and environmental features of
this region. Due to the recent speciation processes that occurred in these
groups, some aspects of their phylogenetic structure remain controversial,
especially those related to evolutionary relationships among species belonging
to two lineages, the genera Leopardus (Felidae) and Lycalopex (Canidae).
The genus Leopardus contains seven species that diverged from a
common ancestor within the last 2.9 million years. The phylogenetic
relationships among these species are well characterized on the basis of
molecular sequence data [2,4,5], except for the placement of L. jacobita, which
remains poorly supported. The canid genus Lycalopex is a more extreme case
of endemic radiation, as it is composed of six extant species that seem to have
undergone a very rapid and recent diversification process, likely within the last 1
Ma [6,7]. As a consequence, their phylogenetic relationships remain largely
unresolved [7,8,9].
Many authors have recently pointed out that nuclear gene loci may be
used as innovative molecular markers that allow more precise estimates of
10
phylogenetic relationships and divergence times among species, as well as
genetic diversity and demographic history [10,11,12]. Still, analyses employing
single gene sequences often lead to discordant genealogies, thus appearing to
be insufficient to consistently determine the pattern of the ancestral
coalescence [13,14]. In this context, it becomes relevant to analyze multiple
gene loci and multiple individuals per species when assessing evolutionary
parameters, as this allows better estimates that take into account intraspecific
variation and/or incomplete lineage sorting. Inferences from a single locus
and/or a single individual may be unable to reliably express the relationship
between lineages [11,12]. Novel analytical methods that reconstruct species
trees from gene genealogies have been recently developed, enabling the
analysis of data sets containing multiple loci and multiple individuals [15,16].
These methods promise to enable much better estimation accuracy for species
tree topology than concatenation, especially in closely related species that have
gone through a rapid radiation, because they accommodate the discrepancy
between species trees and gene trees.
The objective of the present study was to comparatively characterize the
evolutionary history of genera Leopardus and Lycalopex, using sequences of
multiple independent nuclear gene loci and multiple individuals per species to
test the occurrence and prevalence of genealogical discordance in these
recently diversified lineages. In addition, we assessed the performance of a
species tree approach for phylogenetic reconstruction in these lineages, and
observed contrasting achievements that are possibly related to the age and
speed of these recent evolutionary radiations.
2. Material and Methods
We generated sequences for six species of the genus Lycalopex (L. culpaeus, L.
fulvipes, L. griseus, L. gymnocercus, L. vetulus and L. sechurae) and five species of the genus
Leopardus (L. colocolo, L. geoffroyi, L. pardalis, L. tigrinus and L. wiedii). In most cases,
multiple individuals per species were sequenced, so as to test species-level monophyly as well
as to improve the inter-species resolution (See Table S1 [Supplementary Material] for the
number of sequences generated per species for each gene segment). For the species
Leopardus jacobita and Leopardus guigna, we used sequences deposited in GenBank. As
outgroups we utilized Cerdocyon thous for the genus Lycalopex and Felis catus and Puma
concolor for the genus Leopardus (see Tables S2 and S3 [Supplementary Material] for
Genbank accession numbers).
Genomic DNA was extracted from tissue and blood samples following a standard
phenol/chloroform protocol [17]. We analyzed eight gene segments (ATP7AE4, BTK, CHRNA1,
CYP1A1, GHR, PLP1I2, SILV, TCP1) for genus Leopardus, and seven segments (ATP7AE3,
CHRNA1, CYP1A1, FES, GHR, TCP1, VTN) for genus Lycalopex. Segments were amplified by
the Polymerase Chain Reaction (PCR) using primer sets designed here or in previous
phylogenetic studies (Table S4, Supplementary Material). PCR products were examined on a
1% agarose gel stained with GelRed (Biotium, Hayward, CA), purified with shrimp alkaline
phosphatase and exonuclease I, sequenced with the DYEnamic ET Dye Terminator
11
Sequencing Kit (GE Healthcare), and analyzed in a MegaBACE 1000 automated sequencer
(GE Healthcare). Sequences were deposited in GenBank under accession numbers xxx – xxx.
Sequences were visually checked and edited by hand using FinchTV (Geospiza,
Seattle, WA) and final contigs (integrating two or more reads) were constructed using the
software package containing PHRED, PHRAP, and CONSED (http://www.phrap.org/
phredphrapconsed.html). We aligned final contigs with the CLUSTALW algorithm implemented
in MEGA 4.1 [18]. The program Phase [19] was used to identify the gametic phase of segments
bearing complex patterns of heterozygosity. Haplotype networks depicting the evolutionary
relationships among sequences were built using the median-joining approach [20] implemented
in Network 4.2.0 (www.fluxus-engineering.com). To determine the appropriate model of
nucleotide sequence evolution, we used the Akaike information criterion as implemented in
MrModeltest 2.3 [21]. Species trees were inferred using the program *BEAST [16] (see Table S5
[Supplementary Material] for parameters of the *BEAST run).
3. RESULTS
The monophyletic condition of the Leopardus and Lycalopex genera
received significant statistical support, with 1.0 and 0.97 Bayesian posterior
probabilities (BPP), respectively (Figure 1). All genes showed interspecific and
intraspecific variation, which could be clearly observed in haplotype networks
(Figures S1 and S2, Supplementary Material). We also observed considerable
sharing of haplotypes between two or more species in all genes, and several
cases in which species were not monophyletic.
For genus Leopardus, we estimated the species trees for two data sets.
In the first one, only the species represented by multiple individuals (L. colocolo,
L. geoffroyi, L. pardalis, L. tigrinus and L. wiedii) were analyzed. With this data
set, we obtained a high resolution for the species tree, and all nodes bore more
than 0.96 BPP (Figure S3). In the second analysis, all the species contained in
the genus were included (Figure 1A). The species L. jacobita grouped with L.
colocolo (with strong support) and L. guigna was placed as a sister-group to the
(L. geoffroyi + L. tigrinus) group (albeit with lower support). For genus
Lycalopex, we did not obtain strong support for most internal nodes (Figure 1B).
In this group, only the clade that unites the species L. gymnocercus + L. griseus
received high support (0.91 BPP).
12
Figure 1: Species trees inferred with *BEAST for genera Leopardus (A) and Lycalopex
(B). The Bayesian posterior probability of each clade is indicated next to the defining
node.
4. Discussion
Most phylogenetic methods estimate gene trees and assume a complete
correspondence between the topology of these gene trees, which would reflect
the underlying species tree. This assumption is often correct, especially in deep
coalescences, where events of interespecific gene flow or incomplete lineage
sorting are rare [22]. On the other hand, recent and rapid radiations may lead to
B
A
13
departures from this pattern. Our results from the genera Leopardus and
Lycalopex show rampant discordance among independent gene loci, along with
lack of species monophyly and inter-specific haplotype sharing. The occurrence
of intraspecific variation and sharing of haplotypes between species gene can
severely mislead phylogenetic reconstruction, depending on the individuals
included in the analysis. The differential sharing of haplotypes observed among
species and the low support observed for some internal nodes in the multi-locus
analyses are probably a result of variable sorting patterns of ancestral
polymorphisms, which is consistent with expectations for a recent diversification
process. In the case of L. tigrinus, who shared haplotypes with L. geoffroyi and
L. colocolo, we can also raise the alternative hypothesis of hybridization among
these species [5]. Distinguishing between these two causes will remain a
challenge for multi-locus analyses in this lineage, and will likely require an
expanded genomic sample and better understanding of haplotype structure in
target regions.
The species tree inferred for Leopardus was strongly supported and has
a concordant topology relative to a previous study [2]. We corroborate with high
support the placement of L. jacobita as a sister-group of L. colocolo. We
concluded that the selected markers, along with the species tree method
employed here, are effective for robust phylogenetic resolution in this group. In
contrast, for the more recent Lycalopex radiation, we did not obtain a well-
resolved species tree. The reconstructed consensus topology was very similar
to the maximum parsimony tree of Lindblad-Toh et al. (2005). However, in our
analysis, L. vetulus grouped with L. fulvipes (weakly supported), instead of
being placed at a basal position in the genus, as was the case in that study.
Fully resolving the relationships within Lycalopex will likely demand the addition
of more nuclear loci, which is not surprising given the very recent and rapid
radiation of this genus [3,7]. Overall, our results illustrate the potential and
challenges for multi-locus phylogenetic approaches targeting recent radiations,
and highlight the importance of using multiple individuals per species to better
assess the resolution and robustness of such phylogenies.
Acknowledgements
We would like to thank the people and institutions that helped us obtain
biological samples used in this study, especially Tatiane C. Trigo, Manoel L. F.
Rodrigues, Carlos B. Kasper, Patricia Majluf, Marco Cardeña and Walter Diaz.
Peruvian samples were collected under permit number 028-2008-INRENA-
IFFS-DCB. We also thank Cladinara Sarturi, Marina Favarini, Manoel
Rodrigues, Paola Pulido, Rodrigo Corrêa, Sandro Bonatto and Tatiane Trigo for
support at various stages of this research. Financial support for this project was
provided by CNPq and CAPES. This work fulfils part of the requirements for the
14
M.Sc. degree in Cellular and Molecular Biology at the Pontifícia Universidade
Católica do Rio Grande do Sul, Brazil.
References
1. Eisenberg, J. F. and Redford, K. H. 1999 Mammals of the Neotropics, Volume 3: The central
Neotropics: Ecuador, Peru, Bolivia, Brazil. University of Chicago Press, Chicago and London.
2. Johnson, W. E., Eizirik, E. Pecon-Slattery, J. Murphy, W. J. Antunes, A., Teeling, E., O’Brien,
S. J. 2006 The Late Miocene Radiation of Modern Felidae: A Genetic Assessment. Science.
311,73-77. (doi: 10.1126/science.1122277)
3. Eizirik, E. 2010 A Molecular View on the Evolutionary History and Biogeography of
Neotropical Carnivores (Mammalia, Carnivora), Bones, Clones, and Biomes: An Extended
History of Recent Neotropical Mammals (ed. Bruce D. Patterson and Leonora P. Costa)
4. Eizirik, E., Bonatto, S. L. Johnson, W. E. Crawshaw Jr, P. G., Vié, J. C. Brousset, D. M.
O’Brien, S. J. Salzano, F. M. 1998 Phylogeographic patterns and evolution of the mitochondrial
DNA control region in two Neotropical cats (Mammalia, Felidae). Journal of Molecular
Evolution. 47, 613-624. (doi: 10.1007/PL00006418)
5. Trigo, T. C. Freitas, T. R. O. Kunzler, G. Cardoso, L. Silva, J. C. R. Johnson, W. E. O’Brien, S.
J. Bonatto, S. L. Eizirik, E. 2008 Inter-species hybridization among Neotropical cats of the genus
Leopardus, and evidence for an introgressive hybrid zone between L. geoffroyi and L. tigrinus in
southern Brazil. Molecular Ecology 17 4317-4333 (doi: 10.1111/j.1365-294X.2008.03919.x)
6. Wang, X. Tedford, R.H. Van Valkenburgh, B. Wayne, R. K. 2004 Phylogeny, Classification,
and Evolutionary Ecology of the Canidae. In Sillero-Zubiri C, Hoffmann M, Macdonald DW
(eds) Canids: foxes, wolves, jackals and dogs: status survey and conservation action plan, second
edition. Gland, Switzerland and Cambridge, UK, IUCN Canid Specialist Group.
7. Perini, F. A. Russo, C. A. M. and Schrago, C. G. 2010 The evolution of South American
endemic canids: A history of rapid diversification and morphological parallelism. Journal of
Evolutionary Biology. 23,311-322. (doi: 10.1111/j.1420-9101.2009.01901.x)
8. Zrzavy, J. and Ricankova, V. 2004 Phylogeny of Recent Canidae (Mammalia, Carnivora):
relative reliability and utility of morphological and molecular datasets. Zoologica Scripta. 33,
311-333. (doi: 10.1111/j.0300-3256.2004.00152.x)
9. Lindblad-Toh, K. et al. 2005 Genome sequence, comparative analysis and haplotype structure of
the domestic dog. Nature. 438, 803-819 (doi:10.1038/nature04338)
10. Bazin, E. Glémin, S. Galtier, N. 2006 Population size does not influence mitochondrial genetic
diversity in animals. Science. 312, 570-572. (doi: 10.1126/science.1122033)
11. Degnan, J. H. and Rosenberg, N. A. 2009 Gene tree discordance, phylogenetic inference and the
multispecies coalescent. Trends in Ecology and Evolution. 24 n° 6332-340.
(doi:10.1016/j.tree.2009.01.009)
12. Yang, Z. and Rannala, B. 2010 Bayesian species delimitation using multilocus sequence data.
PNAS 107 n°20 9264–9269 (doi: 10.1073/pnas.0913022107)
15
13. Edwards, S. V. Liu, L. Pearl, D. K. et al. 2007 High-resolution species trees without
concatenation. PNAS. 104 n°14 5936–5941 (doi: 10.1073/pnas.0607004104)
14. Brito, P. H. and Edwards, S. V. 2009 Multilocus phylogeography and phylogenetics using
sequence-based markers. Genetica 135, 439–455 (doi: 10.1007/s10709-008-9293-3
15. Liu, L. Pearl, D. K. 2007 Species trees from gene trees: reconstructing Bayesian posterior
distributions of a species phylogeny using estimated gene tree distributions. Systematic Biology
56, 504–514. (doi: 10.1093/bioinformatics/btp079)
16. Heled, J. & Drummond, A. J. 2010 Bayesian Inference of Species Trees from Multilocus Data.
Mol Biol Evol 27, 570-580. (doi: 10.1093/molbev/msp274)
17. Sambrook, J. Fritsch, E. F. Maniatis, T.1989 Molecular Cloning: a Laboratory Manual, 2nd edn.
Cold Spring Harbor Laboratory Press, New York.
18. Tamura, K. Dudley, J. Nei, M. and Kumar, S. 2007 MEGA4: molecular evolutionary genetics
analysis (MEGA) software, version 4.0. Mol. Biol. Evol. 24, 1596–1599.
(doi:10.1093/molbev/msm092)
19. Stephens, M. Smith, N. J. Donnelly, P. 2001 A New Statistical Method for Haplotype
Reconstruction from Population Data. Am. J. Hum. Genet. 68, 978–989 (doi:10.1086/319501)
20. Bandelt, H. J. Forster, P. Röhl, A. 1999 Median-joining networks for inferring intraspecific
phylogenies. Molecular Biology and Evolution. 16, 37-48 (doi:10.1234/12345678)
21. Nylander, J. A. A. 2004 MrModeltest v2. Program Distributed by the Author. Evolutionary
Biology Centre, Uppsala University.
22. Maddison, W. 1997 Gene trees in species trees. Syst Biol 46,523–536. (doi:10.2307/2413694)
16
SUPPLEMENTARY MATERIAL
Table S1: Number of sequences generated here per species for each gene segment.
Species Gene
ATP7AE4 BTK CHRNA1 CYP1A1 GHR PLP1I2 SILV TCP1
Leopradus colocolo 7 15 10 9 3 10 9 3
Leopardus geoffroyi 7 18 10 10 2 9 11 6
Leopardus pardalis 7 15 13 10 2 8 11 2
Leopardus tigrinus 6 13 10 10 3 11 10 5
Leopardus wiedii 6 15 12 9 4 10 10 5
Leopardus guigna 1 0 1 0 1 1 1 1
Leopardus jacobita 1 0 1 0 1 1 1 1
Puma concolor 3 1 2 1 1 3 3 1
Felis catus 3 2 2 2 2 2 2 1
Total 41 79 61 51 19 55 58 25
Species Gene
ATP7AE3 CHRNA1 CYP1A1 FES GHR TCP1 VTN
Lycalopex culpaeus 3 8 6 2 1 6 4
Lycalopex fulvipes 5 7 6 3 2 8 4
Lycalopex griseus 4 9 9 4 2 9 5
Lycalopex gymnocercus 3 7 7 2 4 6 6
Lycalopex sechurae 2 4 5 1 2 3 4
Lycalopex vetulus 5 4 5 3 4 4 8
Cerdocyon thous 0 4 2 4 2 3 2
Total 22 43 40 19 17 39 33
Table S2: Genbank accession numbers for Leopardus genus
Species Gene
ATP7AE4 CHRNA1 GHR PLP1I2 SILV TCP1
Leopardus colocolo DQ082617.1 - DQ082097.1
- DQ082447.1 DQ082490.1
Leopardus geoffroyi DQ082615.1 - DQ082095.1 DQ082703.1 DQ082445.1 DQ082488.1
Leopardus guigna DQ082616.1 DQ081838.1 DQ082096.1 DQ082704.1 DQ082446.1 DQ082489.1
Leopardus jacobita DQ082614.1 DQ081836.1 DQ082094.1 DQ082702.1 DQ082444.1 DQ082487.1
Leopardus pardalis
DQ082612.1 and
AY011434.1 - DQ082092.1
- DQ082442.1 DQ082485.1
Leopardus tigrinus DQ082618.1 - DQ082098.1 DQ082706.1 DQ082491.1
Leopardus wiedii DQ082613.1 - DQ082093.1 DQ082701.1 DQ082443.1 DQ082486.1
Puma concolor -
- DQ082082.1 DQ082692.1
- DQ082475.1
Felis catus -
-
DQ205829.1 and
DQ082070.1 DQ082680.1 DQ082420.1 DQ082464.1
17
Table S3: Genbank accession numbers for genus Lycalopex.
Species Gene
CHRNA1 CYP1A1 FES GHR VTN
Lycalopex culpaeus DQ239440.1 DQ239448.1 DQ239456.1 DQ239464.1 DQ239480.1
Lycalopex fulvipes DQ239441.1 DQ239449.1 DQ239457.1 DQ239465.1 DQ239481.1
Lycalopex griseus AY885319.1 AY885343.1 AY885366.1 AY885390.1 AY885414.1
Lycalopex gymnocercus
EF106987.1 and
AY885320.1 AY885344.1 AY885367.1 AY885391.1 AY885415.1
Lycalopex sechurae AY885321.1 AY885345.1 AY885368.1 AY885392.1 AY885416.1
Lycalopex vetulus
DQ239442.1 and
EF106988.1 DQ239450.1 DQ239458.1 DQ239466.1 DQ239482.1
Cerdocyon thous EF106982.1 AY885341.1
AY885364.1; EF107038.1;
EF107041.1 and EF107040.1 AY885388.1 -
Table S4: List of the segments and primers used in this study.
Gene Gene Name Reference
ATP7AE3 ATPase, Cu++ transporting, alpha polypeptide, exon 3
This study.
F: 5'aaaaatgcaactattatttatgacccta3'
R: 5' taattcgctgaacaccttgc 3'
ATP7AE4 ATPase, Cu++ transporting, alpha polypeptide, exon 4 Eizirik et al. (2001)
BTK Bruton agammaglobulinemia tyrosine kinase Janecka et al. (2008)
CHRNA1
Cholinergic receptor,nicotinic alpha polypeptide
precursor 1, intron 8 Lyons et al. (1997)
CYP1A1 Cytochrome P-450, intron 3 to exon 6 Venta et al. (1996)
FES Feline sarcoma protooncogene, intron 14 Venta et al. (1996)
GHR Growth hormone receptor, intron 9 to exon 10 Venta et al. (1996)
PLP 1 Proteolipid protein-1, intron 2 Murphy et al. (1999)
SILV Melanocyte protein Pmel 17 Johnson et al. (2006)
TCP1 T-complex protein 1, alpha subunit Lyons et al. (1997)
VTN Vitronectin, intron 4 Jiang et al. (1998)
18
Table S5: Parameters employed for the *BEAST analyses.
Parameter Leopardus Lycalopex
Chain length* 100.000.000 200.000.000
Spacing between data
samples 10.000 20.000
Species tree prior Species tree: Yule process Species tree: Yule process
Population Size Model Piecewise linear & constant root Piecewise linear & constant root
Clock Model Strict Clock Strict Clock
Base frequencies Empirical Empirical
Substitution Model HKY for ATP7AE4, BTK, CYP1A1 and PLP1I2 HKY for ATP7AE3, GHR, TCP1 and VTN
HKY+I for CHRNA1 and SILV HKY+I for CHRNA1, CYP1A1 and FES
GTR for GHR
GTR+I for TCP1
* The initial 10% of each MCMC run was discarded as burn-in.
Figure S1: Median-joining networks estimated for genus Leopardus. Each network was derived from a different gene segment, whose name is indicated on the top. Each haplotype is represented by a circle, whose area is proportional to its frequency. The colors represent different species, described in the legend. Haplotypes shared between two or more species are represented by circles with mixed colors. Bars placed on connecting lines indicate the number of nucleotide differences between haplotypes.
Figure S2: Median-joining networks estimated for genus Lycalopex. Gene names are indicated on the top of each box. Each haplotype is represented by a circle, whose area is proportional to its frequency. The colors represent different species, described in the legend. Haplotypes shared between two or more species are represented by circles with mixed colors. Bars placed on connecting lines indicate the number of nucleotide differences between haplotypes.
20
Figure S3: Species trees inferred with *BEAST for genus Leopardus. Only species
represented by multiple individuals (L. colocolo, L. geoffroyi, L. pardalis, L. tigrinus
and L. wiedii) were analyzed. The Bayesian posterior probability of each clade is
indicated next to the defining node.
References for the Supplementary Material
Eizirik, E. Murphy, W. J. O’Brien, S. J. 2001 Molecular dating and biogeography of the early placental
mammal radiation. The Journal of Heredity 92, n°2 212-219 (doi: 10.1093/jhered/92.2.212)
Janecka, J. E. Helgen, K. M. LIM, N.T-L. BABA, M. Boeadi, M. I. Murphy, W. J. 2008 Evidence for multiple species of Sunda colugo. Current Biology. 18 n°21 R1001-R1002. (doi:10.1016/j.cub.2008.09.005) Jiang, Z. Priat, C. Galibert, F. 1988 Traced orthologous amplified sequence tags (TOASTs) and
mammalian comparative maps. Mamm. Genome 9, 577–587. (doi: 10.1007/s003359900821)
Johnson, W. E. Eizirik, E. Pecon-Slattery, J. Murphy, W. J. Antunes, A., Teeling, E., O’Brien, S. J. 2006
The Late Miocene Radiation of Modern Felidae: A Genetic Assessment. Science. 311,73-77. (doi:
10.1126/science.1122277)
Lyons, L. A. Laughlin, T. F. Copeland, N. G., Jenkins, N. A., Womack, J. E., O’Brien, S. J. 1997
Comparative anchor tagged sequences (CATS) for Integrative mapping of mammalian genomes. Nature
Genetics 15 47–56. (doi:10.1038/ng0197-47)
Murphy, W. J. Menotti-Raymond, M. Lyons, L. A. Thompson, M. A. O’Brien, S. J. 1999 Development of
a feline whole genome radiation hybrid panel and comparative mapping of human chromosome 12 and 22
loci. Genomics 57, 1–8.
Venta, P. J. Brouillette, J. A. Yuzbasiyan-Gurkan, V. Brewer, G. J. 1996 Gene-specific universal
mammalian sequence-tagged sites: application to the canine genome. Biochem. Genet. 34,321–341. (doi:
10.1007/BF02399951)
21
REFERÊNCIAS BIBLIOGRÁFICAS
BANDELT, H.J., FORSTER, P., RÖHL, A., Median-joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution. 16 (1999) 37-48
BAZIN, E., GLÉMIN, S., GALTIER, N. Population size des not influence mitochondrial genetic diversity in animals. Science. 312 (2006) 570-572.
BRITO, P.H., and EDWARDS, S.V., Multilocus phylogeography and phylogenetics using sequence-based markers. Genetica 135 (2009) 439–455
BROWN, M.W., GEORGE, M. Jr., WILSON, A.C., Rapid evolution of animal mitochondrial DNA. PNAS. 76 n°4 (1979) 1967–1971.
CUMMINGS, M.P., OTTO, S.P., WAKELEY, J., Sampling Properties of DNA Sequence Data in Phylogenetic Analysis. Molecular Biology and Evolution. 12 n°5 (1995) 814-822
DEGNAN, J.H., and ROSENBERG, N.A., Gene tree discordance, phylogenetic inference and the multispecies coalescent. Trends in Ecology and Evolution. 24 n° 6 (2009) 332-340.
EDWARDS, S.V., LIU, L., PEARL, D.K.,et al. High-resolution species trees without concatenation PNAS. 104 n°14 (2007) 5936–5941
EISENBERG, J. F. and REDFORD, K. H., Mammals of the Neotropics, Volume 3: The central Neotropics: Ecuador, Peru, Bolivia, Brazil. University of Chicago Press, Chicago and London. 1999
EIZIRIK, E., BONATTO, S.L., JOHNSON, W.E., CRAWSHAW Jr, P.G., VIÉ, J.C., BROUSSET, D.M., O’BRIEN, S.J., SALZANO, F.M., Phylogeographic patterns and evolution of the mitochondrial DNA control region in two neotropical cats (Mammalia, Felidae). Journal of Molecular Evolution. 47 (1998) 613-624.
EIZIRIK, E., MURPHY, W. J., O’BRIEN, S.J., Molecular dating and biogeography of the early placental mammal radiation. The Journal of Heredity 92 n°2 (2001) 212-219
EIZIRIK, E., and MURPHY, W. J., Carnivores (Carnivora) Pp. 504-507 in The Timetree of Life, S. B. Hedges and S. Kumar, Eds. Oxford University, 2009.
EIZIRIK, E. A Molecular View on the Evolutionary History and Biogeography of Neotropical Carnivores (Mammalia, Carnivora), Bones, Clones, and Biomes: An Extended History of Recent Neotropical Mammals (ed. Bruce D. Patterson and Leonora P. Costa), 2010
HAFFER, J., Speciation in Amazonian forest birds. Science. 165 n°3889 (1969) 131-137.
HELED, J., & DRUMMOND, A. J., Bayesian Inference of Species Trees from Multilocus Data. Mol Biol Evol 27, (2010) 570-580.
22
HILLIS, D.M., MABLE, B.K., LARSON, A., DAVIS, S.K., ZIMMER, E.A., Nucleic Acids IV: Sequencing and Cloning, 2nd edn. In: Molecular Systematics (eds. Hillis DM, Moritz C, Mable BK), pp 321-381. Sinauer Associates, Massachusetts.1996
JANECKA, J.E., HELGEN, K.M., LIM, N.T-L., BABA, M., BOEADI, M.I., MURPHY, W.J., Evidence for multiple species of Sunda colugo. Current Biology 18 n°21 (2008) R1001-R1002.
JIANG, Z., PRIAT, C., GALIBERT, F.,Traced orthologous amplified sequence tags (TOASTs) and mammalian comparative maps.Mamm. Genome 9 (1998) 577–587.
JOHNSON, W.E, EIZIRIK, E., PECON-SLATTERY, J., MURPHY, W.J.,ANTUNES, A., TEELING, E., O’BRIEN, S.J., The Late Miocene Radiation of Modern Felidae: A Genetic Assessment. Science. 311 (2006) 73-77.
KUMAR, S., TAMURA, K., NEI, M., MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Briefings in Bioinformatics. 5 (2004) 150-163.
LADOUKAKIS, E.D., ZOUROS, E., Recombination in animal mitochondrial DNA: evidence from published sequences. Molecular Biology and Evolution. 18 (2001) 2127–2131
LAIRD, P.W, ZIJDERVELD, A., LINDERS, K. et al. Simplified mammalian DNA isolation procedure. Nucleic Acids Research. 19 n° 15(1991) 4293.
LINDBLAD-TOH, K., et al. Genome sequence, comparative analysis and haplotype structure of the domestic dog. Nature. 438 (2005) 803-819
LIU, L., PEARL, D.K., Species trees from gene trees: reconstructing Bayesian posterior distributions of a species phylogeny using estimated gene tree distributions. Systematic Biology 56 (2007) 504–514.
LYONS, L.A., LAUGHLIN, T.F., COPELAND, N.G., JENKINS, N.A., WOMACK, J.E., O’BRIEN, S.J., Comparative anchor tagged sequences (CATS) for Integrative mapping of mammalian genomes. Nature Genetics 15 (1997) 47–56.
MURPHY, W.J., MENOTTI-RAYMOND, M., LYONS, L.A., THOMPSON, M.A., O’BRIEN, S.J., Development of a feline whole genome radiation hybrid panel and comparative mapping of human chromosome 12 and 22 loci. Genomics 57 (1999), 1–8.
NOWAK, R. M., Walker’s Carnivores of the World. Johns Hopkins University Press, Baltimore. 2005
PALUMBI, S., MARTIN, A., ROMANO, S., The simple fool’s guide to PCR, version 2.0. Dept. of Zoology, University of Hawaii, Honolulu.1991
PALUMBI, S., The polymerase chain reaction. Pages 205–247 in D. M. Hillis, C. Moritz and B. K. Mable, eds. Molecular systematics, 2nd ed. Sinauer: Sunderland, Massachusetts. 1996.
23
RIEDER, M.J., TAYLOR, S.L., CLARK, A.G., NICKERSON, D.A., Sequence variation in the Human angiotensin converting enzyme. Nature Genetics 22 (1999) 59-62.
RONQUIST, F., and HUELSENBECK, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 19 (2003)1572-1574
ROZAS, J., and ROZAS, R., DnaSP version 3: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics 15 (1999) 174-175.
STEPHENS, M., SMITH, N., DONNELLY, P., A new statistical method for haplotype reconstruction from population data. Am J Hum Genet. 68 (2001) 978–989.
SWOFFORD, D.L. PAUP* Phylogenetic Analysis Using Parsimony (*and others methods). Version 4. Sinauer Associates, Suderland. 1998.
TCHAICKA L., EIZIRIK, E., OLIVEIRA, T.G., CÂNDIDO Jr, J.F., FREITAS, T.R.O., Phylogeography and population history of the crab-eating fox (Cerdocyon thous). Molecular Ecology. 16 (2007) 819-839.
TRIGO, T.C., FREITAS, T.R.O., KUNZLER, G., CARDOSO, L., SILVA, J.C.R., JOHNSON, W.E., O’BRIEN, S.J., BONATTO, S.L., EIZIRIK, E., Inter-species hybridization among Neotropical cats of the genus Leopardus, and evidence for an introgressive hybrid zone between L. geoffroyi and L. tigrinus in southern Brazil. Molecular Ecology 17 (2008) 4317-4333
VENTA, P.J., BROUILLETTE, J.A., YUZBASIYAN-GURKAN, V., BREWER, G.J., Gene-specific universal mammalian sequence-tagged sites: application to the canine genome. Biochem. Genet. 34 (1996) 321–341.
WANG, X., TEDFORD, R.H., VAN VALKENBURGH, B., WAYNE, R.K., Phylogeny, Classification, and Evolutionary Ecology of the Canidae. In Sillero-Zubiri C, Hoffmann M, Macdonald DW (eds) Canids: foxes, wolves, jackals and dogs: status survey and conservation action plan, second edition. Gland, Switzerland and Cambridge, UK, IUCN Canid Specialist Group. 2004
YANG, Z., and RANNALA, B., Bayesian species delimitation using multilocus sequence data. PNAS 107 n°20 (2010) 9264–9269
YU, L., LI, Q., RYDER, O.A., ZHANG, Y., Phylogenetic relationships within mammalian order Carnivora indicated by sequences of two nuclear DNA genes. Molecular Phylogenetics and Evolution 33 (2004) 694–705
ZRZAVY, J., and RICANKOVA, V., Phylogeny of Recent Canidae (Mammalia, Carnivora): relative reliability and utility of morphological and molecular datasets. Zoologica Scripta 33 (2004) 311-333
Recommended