Epigenetic Regulation of ZBTB18 Promotes Glioblastoma ... · Pyrosequencing analysis was performed using a PyroMark Q96 instrument (Qiagen), following the manufacturer's pro-tocol

Chromatin, Epigenetics, and RNA Regulation

Epigenetic Regulation of ZBTB18 PromotesGlioblastoma ProgressionVita Fedele1,2, Fangping Dai1,2, Anie P. Masilamani1,2, Dieter H. Heiland1,2,Eva Kling1,2, Ana M. G€atjens-Sanchez1,2, Roberto Ferrarese1,2, Leonardo Platania1,2,Soroush Doostkam3,4, Hyunsoo Kim5, Sven Nelander6, Astrid Weyerbrock1,2,Marco Prinz3,4, Andrea Califano7,8,9, Antonio Iavarone7,10,11, Markus Bredel12,13, andMaria S. Carro1,2

Abstract

Glioblastoma (GBM) comprises distinct subtypes character-ized by their molecular profile. Mesenchymal identity in GBMhas been associated with a comparatively unfavorable prog-nosis, primarily due to inherent resistance of these tumors tocurrent therapies. The identification of molecular determinantsof mesenchymal transformation could potentially allow forthe discovery of new therapeutic targets. Zinc Finger and BTBDomain Containing 18 (ZBTB18/ZNF238/RP58) is a zincfinger transcriptional repressor with a crucial role in braindevelopment and neuronal differentiation. Here, ZBTB18 isprimarily silenced in the mesenchymal subtype of GBMthrough aberrant promoter methylation. Loss of ZBTB18 con-tributes to the aggressive phenotype of glioblastoma through

regulation of poor prognosis–associated signatures. Restitu-tion of ZBTB18 expression reverses the phenotype and impairstumor-forming ability. These results indicate that ZBTB18functions as a tumor suppressor in GBM through the regula-tion of genes associated with phenotypically aggressiveproperties.

Implications: This study characterizes the role of the putativetumor suppressor ZBTB18 and its regulation by promoter hyper-methylation, which appears to be a common mechanism tosilence ZBTB18 in themesenchymal subtypeofGBMandprovidesa new mechanistic opportunity to specifically target this tumorsubclass. Mol Cancer Res; 15(8); 998–1011. �2017 AACR.

IntroductionGlioblastoma (GBM) is the most malignant primary brain

tumor, characterized by a highly invasive nature, poor prognosis,and resistance to aggressive therapies (1). Over the past decade,

gene expression profiling has contributed to the identification ofmultiple GBM subclasses with distinct molecular and clinicalcharacteristics (2, 3). In particular, the mesenchymal (MES) andthe proneural (PN) groups appear as the most consistent sub-classes reported in both studies (2, 3). The MES subtype ischaracterized by resistance to radiotherapy (4).

Using bioinformatics tools (5, 6), several transcription factorshave been identified asmaster regulators of a "mesenchymal geneexpression signature" (MGES) in GBM, including STAT3, CEBPB,andWWTR1 (a.k.a. TAZ; refs. 7, 8). More recently, a role of NF-kBin controlling the expression of the three master regulators andconsequent mesenchymal differentiation was reported (4). Nota-bly, the transcriptional repressor Zinc Finger and BTB DomainContaining 18 (ZBTB18; formerly ZNF238) was identified as apotential negative regulator of theMGES in GBM (8). ZBTB18 is atranscription factor that belongs to the Broad complex, Tramtrack,Bric �a brac (BTB) or poxvirus and zing finger (POZ)-zinc finger(BTB/POZ-ZF) protein family and plays a crucial role in braindevelopment and neuronal differentiation (9–12). Previous find-ings revealed that ZBTB18 is downregulated or lost in mousegliomas and human GBM cell lines and have implicated ZBTB18as a putative tumor suppressor in the brain (11). However, themechanism of ZBTB18 downregulation in GBM remains to bedefined.

Mounting evidence suggests that alteration of methylationpathways, which can induce silencing of tumor suppressor genes,is one of the earliest events in carcinogenesis that grant a predis-position to mutational changes (13, 14). The DNA repair geneO-6-methylguanine-DNAmethyltransferase (MGMT) is one such

1Department of Neurosurgery, Medical Center, University of Freiburg, Freiburg,Germany. 2Faculty of Medicine, University of Freiburg, Freiburg, Germany.3Institute of Neuropathology, Neurocenter, and Comprehensive Cancer Center,University of Freiburg, Freiburg, Germany. 4BIOSS Centre for Biological Signal-ling Studies, University of Freiburg, Freiburg, Germany. 5The Jackson Laboratoryfor Genomic Medicine, Farmington, Connecticut. 6Department of Immunology,Genetics and Pathology and Science for Life Laboratories, University of Uppsala,Uppsala, Sweden. 7Institute for Cancer Genetics, ColumbiaUniversity, NewYork,New York. 8Department of Biomedical Informatics, Columbia University, NewYork, New York. 9Department of Systems Biology, Columbia University, NewYork, New York. 10Department of Pathology, Columbia University MedicalCenter, New York, New York. 11Department of Neurology, Columbia UniversityMedical Center, New York, New York. 12Department of Radiation Oncology,Comprehensive Cancer Center, University of Alabama at Birmingham School ofMedicine, Birmingham, Alabama. 13Department of Neurosurgery, Stanford Can-cer Institute, Stanford University School of Medicine, Stanford, California.

Note: Supplementary data for this article are available at Molecular CancerResearch Online (http://mcr.aacrjournals.org/).

V. Fedele, F. Dai, and A.P. Masilamani contributed equally to this article.

Corresponding Author: Maria Stella Carro, Freiburg University Medical Center,Breisacherstrasse 64, Freiburg 79106, Germany. Phone: 49-761-27054400;Fax: 49-761-27054470; E-mail: [email protected]

doi: 10.1158/1541-7786.MCR-16-0494

�2017 American Association for Cancer Research.

MolecularCancerResearch

Mol Cancer Res; 15(8) August 2017998

on March 28, 2020. © 2017 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst May 16, 2017; DOI: 10.1158/1541-7786.MCR-16-0494

http://crossmark.crossref.org/dialog/?doi=10.1158/1541-7786.MCR-16-0494&domain=pdf&date_stamp=2018-1-17

http://mcr.aacrjournals.org/

gene for which promoter methylation has been shown to result ingene silencing in many cancers (15–17).

Here, we have characterized the role of ZBTB18 as a transcrip-tional repressor of gene signatures associated with aggressiveproperties and poor prognosis in GBM. Our results indicate thatZBTB18 serves as a tumor suppressor in the brain and is silencedby DNA methylation in mesenchymal GBM.

Materials and MethodsTumor samples and culture of GBM-derived cells

GBM and cortical samples from epilepsy surgery were collectedat the Department of Neurosurgery of the University MedicalCenter Freiburg (Freiburg, Germany) in accordance with anInstitutional ReviewBoard–approvedprotocol. Informed consentwas obtained fromall patients, in accordancewith the declarationof Helsinki. Patient-derived GBM stem cells (BTSCs) were pre-pared from tumor specimens as previously described (18). Forpassaging, neurospheres were incubated in nonenzymatic celldissociation solution (Sigma) and mechanically dissociated bypipetting. Proneural cells 3047, 3082, and 3111were generated atthe University of Uppsala (19). GBM cell lines (SNB19 andLN229) andHEK 293T cells were routinely grown in DMEMwith10% FBS. SNB19 and LN229 cells have been authenticated on3/2/2017 by PCR-single-locus-technology (Eurofins Medigen-omix). All cells were mycoplasma-free.

Classification of brain tumor stem cellsThe classification of brain tumor stem cells (BTSC) was per-

formedusing510genes of the 840 classifier genes usedbyVerhaakand colleagues to classify 260 GBM samples (3) and 529 GBMtissue samples from The Cancer Genome Atlas (TCGA) withassigned subtypes for reference (Cancer Genome Atlas ResearchNetwork, 2008). The 510 genes were selected such that theyreliably classify the extended set of 529 TCGA samples and wererepresented on the Illumina HumanHT-12v3 expression Bead-Chip arrays. The expression levels for these genes on the Illuminaarrays and in the TCGA dataset were converted into z-scores, andthe combinedmatrix was used to classify each BTSC sample basedon a k-nearest neighbors (k¼ 10) and voting procedure, in whicha subtype was assigned on the basis of the majority subtypeamong the 10 TCGA samples with highest correlation coefficientsfor these genes with respect to the BTSC sample. All data manip-ulations were performed in R (R Core Team, 2012) and MATLAB(The MathWorks, Inc.).

The classification of BTSCs was performed using a method ofhierarchical clustering with a Euclidean distance metric to clusterthe samples alongside the TCGA samples. Two mRNA datasetswith subtype assignment were used as references: an mRNAdataset of 529 patient samples from TCGA assignment and asubset of the 810 signature genes published by Verhaak andcolleagues (3). Gliomas (BT) and BTSC classification is reportedin Supplementary Table S1.

ZBTB18 vector construction, lentiviral production, andinfection

ZBTB18 coding sequence was PCR amplified from normalbrain RNA using the following primers: BstXI-flag-hZBTB18v1-sense (TGGCCACAACCATGGACTAC AAGGACGACGATGA-CAAGTGTCCTAAAGGTTATGAAGACAG) and PmeI-hZBTB18-antisense (GCCTTGGTTTAAACTTATTTCCAAAGTTCTTGAGAG).

The PCR product was first cloned into pDrive cloning vector(Qiagen), sequence validated, and subsequently transferred inthe pCHMWS-EGFP lentiviral vector (kind gift from V. Baeke-landt, University of Leuven, Leuven, Belgium). Lentiviral infec-tions were performed as previously described (18).

Proteomic analysisFor protein analysis of the 30 kDa band detected by the ZBTB18

antibody, SNB19 cells transduced with either control or FLAG-ZBTB18 lentiviral vector were subjected to immunoprecipitationusing the M2 FLAG antibody (Sigma). The immunoprecipitatedproteins were analyzed by gel electrophoresis and stained byCoomassie blue staining. The 30 kDa band was cut from the geland analyzed by MS (Agilent 6520 Q-TOF) at the Core FacilityProteomics of the Center for Biological SystemAnalysis (ZBSA) atthe University of Freiburg (Freiburg, Germany). The identifiedpeptides were aligned using themascot software (Matrix Science).

DNA/RNA extraction and quantitative real-time-PCRDNA and RNA were extracted from human cortex, tumor

tissue, or cell culture using the All Prep DNA/RNA Mini Kit ormiRNeasy Mini Kit (Qiagen). First-strand cDNA synthesis wasgenerated using the Superscript cDNA synthesis Kit (Invitro-gen). Quantitative RT-PCR was performed using SYBR Green(Applied Biosystems) and analyzed relative to 18sRNA (house-keeping) using the DCt method. Primer sequences are listed inSupplementary Table S2.

ImmunoblottingTotal protein extracts were prepared in RIPA buffer supplemen-

ted with protease inhibitor cocktail (Thermo Scientific), phos-phatase inhibitor cocktail (Sigma), and PMSF (Sigma). The fol-lowing antibodies were used: mouse anti-FLAG M2 (Sigma),rabbit anti-ZBTB18 (Abcam, ab118471), andmouse anti–b-actin(Abcam, ab7291).

Microarray expressionFor microarray expression profiling, total RNA was prepared

using the RNeasy Kit or the all Prep DNA/RNA/Protein miniKit (Qiagen) and quantified using 2100 Bioanalyzer (Agilent).A total of 1.5 mg of total RNA was processed and analyzed atthe Deutsches Krebsforschungszentrum (DKFZ) in Heidelberg(Germany). Hybridization was carried out on IlluminaHumanHT-12v4 expression BeadChip. Microarray data were ana-lyzed using the GSEA software (http://www.broadinstitute.org/gsea/index.jsp). Microarray gene accession number: GSE97350(subseries GSE97347 and GSE97349).

Methylation analysis and pyrosequencingGenomicDNA from tissues and cell lineswasbisulfitemodified

using the EZ DNA methylation–gold Kit (The Epigenetics Com-pany) according to the manufacturer's instructions. A pool ofnormal brain tissues or glioma samples were subjected to PCR toamplify ZBTB18 promoter CpG islands using a PyroMark PCR kit(Qiagen) and primers summarized in Supplementary Table S3.Non–CpG-containing primers, methylation-specific primers, andunmethylation-specific primers were designed to cover the entireregion. PCR products were cloned into pDrive cloning vector(Qiagen) and submitted for sequencing with SP6 primer and T7primer (GATC).

Promoter Methylation of ZBTB18 in GBM

www.aacrjournals.org Mol Cancer Res; 15(8) August 2017 999



http://www.broadinstitute.org/gsea/index.jsp

http://www.broadinstitute.org/gsea/index.jsp


Pyrosequencing analysis was performed using a PyroMarkQ96 instrument (Qiagen), following the manufacturer's pro-tocol. Primers are summarized in Supplementary Table S3.The results were analyzed by PyroMark CpG software (Qia-gen). The methylation index for each sample was calculatedas the average value of CpG methylation in the CpGexamined.

In vitro methylation and luciferase reporter assayDifferent regions of the ZBTB18 promoter were amplified by

PCR from brain (cortex)-derived RNA and cloned in the pGL3vector (Promega). The activity of each promoter was measuredby dual-luciferase reporter assay system (Promega) according tothe manufacturer's instructions. Cells were seeded at 50%confluence in 6-well plates 24 hours prior to transfection. Cellsat 80% to 90% confluence were transiently transfected with2.5 mg of each pGL3-ZBTB18 promoter vector or pGL3 as anegative control, together with 0.5 mg of pRL-TK (Renillaluciferase reporter, Promega). Transfections were done usingLipofectamine 2000 as directed by the manufacturer (LifeTechnologies) in serum-freemedium. All transfections were donein triplicate. After 48 hours, cells were lysed with passive lysisbuffer (Promega). Luciferase activity of each sample was deter-mined in technical triplicate using a Thermo Scientific Appliskanluminometer. All data were reported relative to luciferase activity(firefly/renilla). Twenty micrograms of pGL3-ZBTB18 promoter 4vector was methylated with SssI methylase or with HpaII meth-ylase (all from New England Biolabs, 2.5 U/mg DNA) in thepresence of 160 mmol/L S-Adenosylmethionine (SAM; NewEngland Biolabs), in a manufacturer-supplied buffer at 37�Cfor 2 hours. The unmethylated DNA was treated as above butwithout methylases or SAM. The plasmid DNA was extracted byphenol/chloroform, ethanol precipitated, and quantified using aNanodrop Spectrophotometer (Peqlab). The completion ofmethylation reactionwas controlledbydigestingbothmethylatedand unmethylated DNAs using the methylation-sensitive restric-tion enzyme Hpa II and the methylation-insensitive restrictionenzyme McrBC.

Chromatin immunoprecipitationPromoter analysis was performed with the MatInspector

software (www.Genomatix.de). Primers were designed usingthe Primer 3 software (http://bioinfo.ut.ee/primer3-0.4.0/) andare listed in Supplementary Table S4. Chromatin immunoprecip-itation (ChIP) was performed as previously described (20) withsome modifications. SNB19 cells expressing ZBTB18 were firstcrosslinked with 1% formaldehyde (Polysciences) for 30 min-utes at room temperature and quenched by addition of 125mmol/L Glycine for 15 minutes. Lysates were sonicated for 15minutes (30 seconds on/30 seconds off) using Branson digitalsonifier and centrifuged at 14,000 rpm for 15 minutes at 4�C.Fifty micrograms of sonicated chromatin per IP was preclearedand incubated with primary antibody (4 mg) anti-ZBTB18(Abcam, ab118471). Chromatin–antibody complexes wereeluted by two 15-minute incubations at 30�C with 250 mLElution Buffer (1% SDS, 100 mmol/L NaHCO3). Chromatinwas reverse-crosslinked by adding 20 mL of NaCl 5 mol/L andincubated at 65�C for 12 hours. DNA was extracted by phenol-chloroform after RNase and proteinase K digestion. Quantita-tive RT-PCR was performed using SYBR Green (AppliedBiosystems).

Methylation arrayFor methylation analysis, DNA was prepared using the All

Prep DNA/RNA/Protein Mini Kit (Qiagen) and quantifiedusing NanoDrop2000c (Thermo Scientific). A total of 1.5 mgof DNA for each sample was processed at DKFZ by IlluminaHumanMethylation450 (Illumina). Data analysis was per-formed using Integrative Genomics Viewer (IGV) software(Broad Institute; refs. 21, 22).

Migration, invasion, and proliferation assayMigration and invasion assays were performed as described

before (18). Images of migrating cells were taken every 24hours. For BTSC233 and JX6 cells, laminin-coated (Invitrogen;4 mg/mL) 60 mm dishes containing a culture insert (Ibidi) wereused. Cell migration was calculated using the following for-mula: (premigration area � migration area)/premigrationarea � 100).

For invasion assay, 1 � 105 BTSC233, JX6, or SNB19 (both2.5 � 104) cells were seeded in triplicates in the upper com-partment. PDGF-BB (20 ng/mL; R&D Systems) was used as achemoattractant. Pictures were acquired using an Axioimager 2Microscope (Zeiss). The assays were validated in two indepen-dent experiments.

Cell proliferation was assessed using a commercially availablekit for EdU detection (EdU Cell proliferation assay, base click).Cells were plated at a density of 2.0 � 104 per well in a 24-wellmicroplates containing laminin-coated coverslips. After 24 hoursof seeding, cells were incubated with EdU solution overnightfollowing the manufacturer's instructions. Upon EdU detection,images were acquired using a fluorescent microscope (Axiovert;Zeiss).

5-AZA-20-deoxycytidine treatmentA total of 100 mmol/L stock solutions of 5-AZA-20-deoxycyti-

dine (5-AZA-dC; Sigma-Aldrich) were prepared by dissolving thesubstances inDMSO (GIBCO) and stored at�80�C. Immediatelybefore treatment, stock solutions were diluted in cold PBS andadded to the cell culture medium. LN229 cells not expressingZBTB18were treated with 10 mmol/L 5-aza-dC for 2, 3, 4, 5, and 8days. JX6 cells and BTSC161s cells were treated with equalamounts of 5-aza-dC for 3 and 6 days. Medium containing freshdrug was changed every 24 hours.

Intracranial injection and immunohistochemistryIntracranial injections were performed in NOD/SCID mice

(Charles River Laboratories) in accordance with the directive86/609/EEC of the European Parliament, following approvalby regional authorities. Experiments were performed asdescribed before (8). Animals were monitored daily until thedevelopment of neurologic symptoms by a blinded operator.Histology was performed as previously described (23). ForMIB1 staining, primary antibody MIB1 (1:50; Dako; M7240)was used.

Statistical analysisLinear regression analyses and graphicalmodel validationwere

executed using R software. Scatterplots and locally weighted leastsquares (LOWESS) smooths were used to confirm the suitabilityof linear regression analyses, and statistical significance of theserelationships was assessed according to the P value for the esti-mated slope of the regression line. A multiple linear regression

Fedele et al.

Mol Cancer Res; 15(8) August 2017 Molecular Cancer Research1000



www.Genomatix.de

http://bioinfo.ut.ee/primer3-0.4.0/


model was computed based on the ordinary least squaresmethod. Expression analysis of the TCGA data was performedby R software. Publicly available Level 3 TCGA (https://tcga-data.nci.nih.gov/docs/publications/tcga/) data were used foranalysis. Data were downloaded at the UCSC Cancer GenomeBrowser. Only patients with full datasets (expression, methy-lome, and clinical information) were included. Expressionanalysis was performed based on Agilent array data (TCGAGBM G4502A) for high-grade glioma and RNA-seq data(TCGA LGG HiSeqV2 PANCAN) for low-grade glioma. Bothdatasets were normalized and log2 transformed. Methylationdata from Infinium HumanMethylation450 BeadChip forlower-grade and high-grade glioma were used for furtheranalysis. For TCGA Expression/Methylation Analysis, normal-ized expression values were analyzed in tumor subtypes (mes-enchymal, proneural, classical, and neural) by a one-wayANOVA model. Survival analysis was performed by Cox pro-portional hazards model and plotted by Kaplan–Meier surviv-al statistics. Patients without survival data were censored.Robustness was ensured by 10-fold cross-validation. Methyl-ation of the cg23829949 was extracted and analyzed by Wilcoxregression model and one-way ANOVA. Significant level wasdefined as P < 0.001. Analysis was performed by survival

package included in R-Software. Different tumor numbersused in the analyses reflects sample availability in differentgenomic datasets and their overlap.

ResultsZBTB18 is downregulated in high-grade gliomas

To study the role of ZBTB18 in gliomas, we looked at itsexpression in 1,161 low- and high-grade gliomas from TCGA.ZBTB18 expressionwas lower in GBM (WHOgrade IV) comparedwith grade II and III gliomas (P < 0.001; Fig. 1A). Interestingly,ZBTB18 expression appeared strongly associated with the pro-neural subclass when we focused our analysis on high-gradegliomas only (n ¼ 561; Fig. 1B). This finding was confirmed bycluster analysis of ZBTB18 correlating genes in high-grade gliomas(Fig. 1C). ZBTB18 was mostly associated with the proneuralsubtype and expressed at lower levels in the mesenchymal andclassical subtype (Fig. 1C), consistent with our previous identi-fication of ZBTB18 as a putative transcriptional repressor of theMGESdescribed byPhillips and colleagues (2, 8). ZBTB18proteinexpression analysis showed low expression of ZBTB18 in GBM-derived cells compared with normal brain samples (cortex; Fig.1D and E), further reinforcing the notion that ZBTB18 is

Figure 1.

ZBTB18 is highly expressed in low-grade gliomas and proneural GBMs. A, Analysis of ZBTB18 expression in low- and high-grade glioma samples from TCGA.B, Analysis of ZBTB18 expression in GBM subtypes from TCGA samples. C, Cluster analysis showing association between expression of ZBTB18-correlatinggeneswithmethylation and tumor subtype inGBM samples fromTCGA. ZBTB18 appears to bemostly expressed in proneural GBMs.D,Western blot showing ZBTB18expression in normal brain tissues and GBM-derived cells. The low band represents a shorter ZBTB18 isoform. a-Tubulin was used as loading control.E, Densitometric analysis of the Western blot displayed in D. The ZBTB18 signal was normalized to the a-tubulin signal.





https://tcga-data.nci.nih.gov/docs/publications/tcga/

https://tcga-data.nci.nih.gov/docs/publications/tcga/


downregulated in high-grade gliomas. Interestingly, a lower bandaround 30 kDa was also detected.

ZBTB18 directly regulates MGES genesOur previous study identified ZBTB18 as a putative negative

regulator of the MGES of GBM (8). Moreover, cluster analysisshown in Fig. 1B indicates that ZBTB18 is downregulated in bothmesenchymal and classical GBMs, suggesting that low ZBTB18expression is associated with the more aggressive GBM subtypes.To validate ZBTB18-repressive function, we first analyzed theexpression of mesenchymal genes previously predicted to benegatively connected to ZBTB18 in the ARACNE network (8),using SNB19 GBM cell lines transduced with FLAG-ZBTB18 orcontrol vector (Fig. 2A; Supplementary Fig. S3A and S3B). Among13 putative targets analyzed, 8 genes were clearly downregulatedupon ZBTB18 overexpression (Fig. 2A). ChIP revealed ZBTB18binding at ACTN1, PTRF, SERPINE1, and CD97 promoters (Fig.2B), indicating that, at least for a subset of targets, ZBTB18 isdirectly involved in gene repression. To better understand the roleof ZBTB18 in high-grade gliomas, we performed overexpressionstudies and subsequent GSEA (http://software.broadinstitute.org/gsea/index.jsp) on mesenchymal patient-derived BTSC-likecell line (BTSC233; Figs. 1D and E and 2C and D) and a patient-derived GBM xenoline (JX6; ref. 24) which was classified asclassical according to the Verhaak study (Figs. 1D and E and 2Eand F). Interestingly, we also detected a lower band similar tothose observed in GBM-derived cells at around 30 kDa (Figs. 2Cand E and 1D). Sequence analysis by MS confirmed that thepeptides correspond to the N-terminal portion of ZBTB18 up toaround amino acid 270 (Supplementary Fig. S1A and S1B).Western blot analysis of the transduced cells with a polyclonalanti-ZBTB18 antibody showed almost no expressionof ZBTB18 inthe control cells; the shorter band was weakly recognized becausethe antibody is directed to central region of ZBTB18 sequence(amino acids 228–498; Supplementary Fig. S1C and S1D). GSEAanalysis for the gene signatures described by Phillips and collea-gues (2) revealed a strong enrichment for mesenchymal genes inBTSC233 cells expressing a control GFP vector compared withBTSC233 cells expressing ZBTB18 (Fig. 2G; Supplementary Fig.S2A). Surprisingly, the same analysis using gene signatures fromthe Verhaak classification (3) did not show any specific signatureenrichment (Supplementary Fig. S2B). Validation by qRT-PCR inBTSC233 expressing ectopic ZBTB18 confirmed the downregula-tion of several mesenchymal genes (Fig. 2H). The repressivefunction of ZBTB18 on a subset of genes was further validatedin JX6 cells (Fig. 2I). GSEA showed a strong downregulation of thePhillips proliferative signature in JX6 transduced with a ZBTB18expressing lentiviral vector compared with the control vector, butagain no significant changewas induced in the Verhaak signatures(Fig. 2J; Supplementary Fig. S3A). As the classification by Phillipsis based on gene expression data of GBMs and grade III gliomas,with the goal of identifying survival-associated genes,we reasonedthat the different results might indicate a role of ZBTB18 in thenegative regulation of genes associated with poor survival (i.e.,proliferative and mesenchymal genes). Interestingly, some of thevalidated ZBTB18 targets have been previously associated withunfavorable prognosis in glioma (25–27). Further examination ofthe top downregulated genes by ZBTB18 in JX6 cells by geneexpression array highlighted many genes previously reported toplay a role in epithelial-to-mesenchymal transition (EMT; Fig. 3A;refs. 28–34). ID1 and ID3 were also downregulated, as consistent

with previous findings (Fig. 3A; ref. 35). The repressive role ofZBTB18 was validated by qRT-PCR in JX6 (Fig. 3B) and BTSC233(Fig. 3C) cells. Many of the validated genes have been reported aspart of a multi-cancer gene expression signature associated withprolonged time-to-recurrence in GBM (36, 37). As such, GSEAshowed a strong loss of this multi-cancer signature (Anastassiou_cancer_mesenchymal_transition signature) upon ZBTB18 over-expression (Fig. 3D). These data further suggest that ZBTB18downregulation in high-grade gliomas leads to re-expression ofgenes associated with malignant features and poor outcome.Interestingly, ZBTB18 re-expression in BTSC233 and JX6 cells ledto upregulation of epithelial markers which are often repressedduring EMT (refs. 38–43; Fig. 3E and F), further reinforcing theidea that ZBTB18 could play a role in suppressing an EMT-likephenotype in GBM. Consistent with our data and with its previ-ously reported tumor-suppressive role (11), ZBTB18 reexpressionin SNB19 affected cell proliferation, migration, and invasion(Supplementary Fig. S4). The same effect on cell proliferation,migration, and invasion was confirmed in BTSC233 cells (Sup-plementary Fig. S5A, S5C, and S5D). In JX6 cells, ZBTB18 over-expression also reduced cell proliferation and migration (Sup-plementary Fig. S5B and S5E), although no clear effect on inva-sion was observed, probably due to the higher invasive propertiesof those cells (data not shown).

ZBTB18 inhibits brain tumor growth in vivoWe next addressed the role of ZBTB18 in tumor formation in

vivo. Immunocompromised (NOD/SCID) mice were intracrani-ally injected with JX6 or BTSC233 cells stably expressing eitherZBTB18 or control-GFP vector. Histology analysis of the mousebrains revealed thatmice injectedwith JX6 cells expressing controlvector developed bulky tumors. Conversely, only one mouseinjected with JX6 cells expressing ZBTB18 formed a very smalltumor (Fig. 4A and data not shown). In accord, overall survivalwas significantly increased in the ZBTB18 group (Fig. 4B). Thesame experiment in BTSC233 confirmed the effect of ZBTB18 onsurvival even though themice still developed tumors (Fig. 4C andD). Ki67/MIB1 staining showed a high level of proliferation inBTSC233 transduced with the control-GFP vector, whereas cellsexpressing ZBTB18 appeared to be less proliferative or confined insmall satellite areas, suggesting that ZBTB18 might somehowimpair proliferation or restrict it to specific tumor regions (Fig.4E). These results suggest that expression of ZBTB18 prolongsanimal survival by delaying or inhibiting tumor formation andthat the extent of tumor inhibition might depend on the cellbackground.

Promoter methylation silences ZBTB18 in GBMTo elucidate the mechanism by which ZBTB18 is downregu-

lated in GBM, we examined the ZBTB18 promoter in silico (http://genome.ucsc.edu). The analysis revealed the presence of two CpGislands (Fig. 5A and B), suggesting that DNA hypermethylationcould play a role in ZBTB18 transcriptional repression. To verifythis hypothesis, we first cloned several promoter regions coveringthe two CpG islands from a pool of normal brains, GBM samples(BTs), and GBM cell lines after bisulfite modification (Fig. 5A andB). Sequence analysis of the cloned DNA fragments revealed nochange in DNA methylation in the more upstream CpG island(CpG1, containing 27 CpGs; Fig. 5B). Conversely, higher meth-ylation in CpG island 2 (CpG2, containing 9 CpGs) was detectedin the pool of tumor samples (Fig. 5B). Pyrosequencing of

Fedele et al.




http://software.broadinstitute.org/gsea/index.jsp

http://software.broadinstitute.org/gsea/index.jsp

http://genome.ucsc.edu

http://genome.ucsc.edu


Figure 2.

Ectopic expression of ZBTB18 in GBM cells induces repression of poor prognosis signature genes. A, Representative qRT-PCR analysis showing gene expressionchanges of ZBTB18 mesenchymal targets previously predicted by ARACNE in SNB19 cells expressing ectopic ZBTB18 (n¼ 3 PCR replicates; error bars� SD). Geneexpression was normalized to 18sRNA. B, Representative ChIP experiment in SNB19 cells expressing ectopic ZBTB18. The panel shows ZBTB18 bindingto the promoter of a subset of mesenchymal targets (n¼ 3 PCR replicates) expressed as percentage of the initial DNA amount in the immune-precipitated fraction.The OLR1 gene which does not contain putative ZBTB18 binding sites was used as a negative control. C, Western blot showing ectopic expression ofZBTB18 in BTSC233. The low band represents a shorter ZBTB18 isoform.D,Representative images of GFP-positive BTSC233 cells expressing control vector or FLAG-ZBTB18 construct after lentiviral infection. The scale bar represents 100 mm. E, Western blot showing ectopic expression of ZBTB18 in JX6. The shorterZBTB18 isoform is indicated. F, Representative images of GFP-positive JX6 cells transduced with control vector or FLAG-ZBTB18 lentiviral vector. The scale barrepresents 100 mm. G, GSEA enrichment plot for mesenchymal genes in the comparison of 233 cells expressing control vector vs. FLAG-ZBTB18. H and I,Validation by qPCR of selected mesenchymal genes in BTSC233 (H) or JX6 (I) expressing either control vector or FLAG-ZBTB18 construct (n¼ 3; error bars� SD).� , P < 0.05; �� , P < 0.01; and �� , P < 0.001. Gene expression was normalized to 18sRNA. J, GSEA enrichment plot for proliferative genes in the comparison ofJX6 cells expressing control vector vs. FLAG-ZBTB18.






promoter regions containing 6 CpGs located in CpG2 and 2moredownstream CpGs located in the 50UTR revealed that, althoughnot statistically significant, methylation of ZBTB18 CpG2 tendedto be higher in the glioma samples compared with normal brain(Supplementary Fig. S6A). Furthermore, methylation of the 2CpGs in the 50UTR (50UTR CpG -1 and 50UTR CpG -2) was higherin gliomas compared with normal brain samples (P ¼ 0.0184,unpaired t test; Supplementary Fig. S6B and S6C). The significancewas even higher when only GBM samples were included in theanalysis (P ¼ 0.0017, unpaired t test; Fig. 5C).

Treatment with the hypomethylating agent 50-Aza-20-dC(Decitabine) in GBM cell line LN229 and two patient-derivedmesenchymal GBM cell lines (BT161s and JX6), all showingdownregulation of ZBTB18 and hypermethylation of theZBTB18 promoter, resulted in reexpression of ZBTB18 after72 hours (Fig. 5D). Pyrosequencing analysis confirmed con-comitant reduction of 50UTR CpG-1 and 50UTR CpG-2 inLN229 cells (Supplementary Fig. S6C). Together, these datasupport a role of promoter hypermethylation in the silencing ofZBTB18 in GBM.

Figure 3.

Ectopic expression of ZBTB18 in GBM cells affects a cancer-mesenchymal transition signature.A, List of the top 20 genes downregulated by ZBTB18 overexpression,in JX6 cells, analyzed by gene expression array. Genes selected for validation are in blue. B and C, Validation by qRT-PCR of selected genes listed in A inBTSC233 (B) or JX6 (C) expressing either control vector or FLAG-ZBTB18 construct (n¼3; error bars�SD). � ,P<0.05; �� ,P<0.01; and �� ,P<0.001. Gene expressionwas normalized to 18sRNA. D, GSEA enrichment plot for the Anastassiou_cancer_mesenchymal_transition signature described in ref. 37. E and F, qRT-PCRanalysis of epithelial genes in BTSC233 (E) and JX6 (F) transduced with either control vector or FLAG-ZBTB18.

Fedele et al.





JX6

Control ZBTB18

Control ZBTB18

JX6

Cum

ulat

ive

surv

ival

Cum

ulat

ive

surv

ival

Days

Days

1,0

0,8

0,6

0,4

0,2

0,0

1,0

0,8

0,6

0,4

0,2

0,0

ControlZBTB18

ControlZBTB18

BTSC233BTSC233

BTSC233

Control

ZBTB18

P < 0.0005(Log rank)

P < 0.0005(Log rank)

A

C

E

D

B

.00 100.00 200.00 300.00 400.00

.00 50.00 100.00 150.00 200.00

Figure 4.

Expression of ZBTB18 affects tumor formation and survival in vivo. A, Hematoxylin and eosin (H&E) staining of representative tumors resulting from intracranialinjection of JX6 cells infected with either control (left) or FLAG-ZBTB18 overexpressing vector (right) in immunocompromised mice. The scale bar represents1 mm. B, Kaplan–Meier survival curves of mice intracranially injected with JX6 cells expressing full-length ZBTB18 or control vector (n ¼ 8). C, H&E staining ofrepresentative mice tumors upon intracranial injection of BTSC233 cells infected with either control (left) or FLAG-ZBTB18 overexpressing vector (right) inimmunocompromised mice. The scale bar represents 1 mm. D, Kaplan–Meier survival curves of mice intracranially injected in C (n¼ 9). E, Representative images ofmice tumors resulting from intracranial injection of BTSC233 transduced with either control or FLAG-ZBTB18 stained with anti-MIB1 antibody. The scale barrepresents 200 mm. A reduced proliferation or pattern of proliferating cells is observed upon ZBTB18 overexpression.






Figure 5.

ZBTB18 promoter is methylated in a group of GBM.A, Schematic representation of strategy used formethylation analysis of ZBTB18 promoter.B,Detailed analysis ofZBTB18 promoter showing the region analyzed, the CpGs islands identified, and their relative methylation status in normal tumor samples (Control), braintumors (BTs), and brain tumor–derived cells (called MBs). C, Comparison of the 50UTR CpG-1 and -2 methylation status between controls (N¼ 33) and grade 4 braintumors (n ¼ 28). D, Expression of ZBTB18 in LN229, JX6, and BTSC161s cells after treatment with 5-Aza-20-dC and relative control. Representative imageof an experiment performed in triplicate (n ¼ 3; error bars � SD).

Fedele et al.





To further prove that the ZBTB18 region, including 50UTRCpGs-1 and -2, is important for ZBTB18 promoter activity, wecloned several ZBTB18 promoter regions and analyzed theiractivity by luciferase reporter assay. As shown in Fig. 6A andB, the ZBTB18 promoter region 3, which does not contain thecore promoter and the 50UTR CpGs-1 and -2, had no promoteractivity compared with other cloned promoter regions in whichthe core promoter and 50UTR CpGs-1 and -2 were included (Fig.6A and B). Next, we investigated the effect of DNA methylationon the luciferase reporter activity controlled by the ZBTB18

promoter region with the highest activity. As displayed in Fig.6C and D, the promoter activity was completely inhibited by theSssI methylase, an enzyme that methylates all CGs, and to a lessextent by HpaII methylase, which methylates only CGs in theCCGG context (Fig. 6C and D). These results further indicate thatthe ZBTB18 promoter region, which includes the core promoterand 50UTR CpGs-1 and -2, is responsible for promoter activityand sensitive to DNA methylation. This is consistent with theexpected role of methylated CpGs close to the TSS in geneexpression regulation (44).

Figure 6.

The core promoter region of ZBTB18 is essential for promoter activity and is sensitive to DNA methylation. A, Schematic representation of the ZBTB18 promoterregions cloned in the pGL3 luciferase reporter vector. B, Analysis of ZBTB18 promoter constructs activity by dual-luciferase assay. C, In vitro methylationassay of ZBTB18 promoter 4. The plasmid DNA was methylated with SssI or HpaII methylase. D, Control restriction digestion of the methylase reaction using themethylation-sensitive (HpaII) and the methylation-insensitive (McrBC) restriction enzymes.






ZBTB18 promoter methylation is a hallmark of mesenchymalGBMs

Correlation analysis between ZBTB18 expression and DNAmethylation in 251 GBM samples from TCGA (HumanMethyla-tion27 platform, http://cancergenome.nih.gov) revealed a signif-icant inverse correlation between ZBTB18 expression and pro-moter methylation (P¼ 1.96� 10�05, linear regression; Fig. 7A).Interestingly, the examined probe (cg23829949)mapped into thesame region analyzed by pyrosequencing (CpG island 2). Con-sistently, in our set of patient-derived glioma samples, ZBTB18promoter methylation of 6 CpGs located at the 30 end of CpGisland 2 (Fig. 7B) and of 50UTR CpGs-1 and -2 (SupplementaryFig. S6B) measured by pyrosequencing was higher in a subset ofsamples showing low ZBTB18 expression (high-grade gliomas,red line), whereas low promoter methylation was detected insamples with higher ZBTB18 expression (low-grade gliomas,blue line; Fig. 7B). Thus, methylation of CpG island 2 and 50UTRCpGs-1 and -2 correlates with ZBTB18 expression, at least in asubset ofGBM.However, a fractionof glioma samples that didnotshow promoter hypermethylation still had low ZBTB18 expres-sion, suggesting that DNA hypermethylation is not the onlymechanism regulating ZBTB18 expression, or alternatively, thatadditional methylated regions might be involved.

Promoter methylation analysis of the subset of gliomas withlow ZBTB18 expression/high promoter methylation (indicated inred) versus high ZBTB18 expression/low promoter methylation(indicated in blue) previously analyzed using the InfiniumHumanMethylation450 BeadChip (ref. 45; Supplementary Fig.S7D) confirmeddifferentialmethylation of CpG island 2betweenthe two tumor groups covering CpGs located in the same regionanalyzed by pyrosequencing (probes cg19698993 andcg12869659). Intriguingly, tumor samples with high ZBTB18expression and low ZBTB18 promoter methylation analyzed byDNAmethylation array showed high levels of global methylation(45), suggesting that silencing of ZBTB18 by promoter methyl-ation could be a hallmark of non G-CIMP gliomas. Consistentwith this hypothesis, ZBTB18 methylation correlated withG-CIMP and IDH1 mutation status so that ZBTB18 was moremethylated in IDH1 wild-type compared with IDH1-mutantgliomas (Fig. 7C P ¼ 1.914e�10, Welch two-sample t test).Consistent with this, ZBTB18 expression was higher in G-CIMPGBMs (Fig. 7D). We then investigated the relationship betweenZBTB18methylation (HumanMethylation27platform) andGBMsubclasses in 283 TCGA GBM samples. This analysis revealed ahighly significant association between ZBTB18 methylation in aregion confirmed by pyrosequencing (probe cg23829949) andmesenchymal GBM subtype (Fig. 7E). Accordingly, regressionanalysis of ZBTB18 expression on ZBTB18 methylation revealeda strong correlation only in mesenchymal tumors but not innonmesenchymal tumors (all GBMs: P ¼ 0.000026; mesenchy-mal tumors: P ¼ 0.0136; nonmesenchymal tumors: P ¼ 0.13,linear regression), further highlighting that methylation-inducedsilencing of ZBTB18 might be particularly important in themesenchymal subclass (Supplementary Fig. S7A–S7C). This isconsistent with previous analysis indicating that the mesenchy-mal tumors are usually non–G-CIMP (46, 47). Expression anal-ysis of selected mesenchymal genes (CD97, ACTN1, EMP3, andCHI3L1) revealed an inverse association with ZBTB18 promotermethylation (Fig. 7E and F), further indicating that silencing ofZBTB18 through promoter hypermethylation could play a role inmesenchymal differentiation in GBM.

Survival modeling did not show a statistically significant asso-ciationwithpatient survival (datanot shown). Instead,weobserveda significant link between time-to-tumor progression and ZBTB18methylation in a two-class model of 109 GBM patients stratifiedaccording to lower-than-median versus higher-than-medianZBTB18methylation (log-rank P¼ 0.029), such that patients withhigh methylation demonstrated a comparatively unfavorable out-come (Fig. 7G). This association betweenZBTB18methylation andtime-to-tumor progression was also evident in a continuous uni-variate Coxmodel [univariate Coxmodel P¼ 0.037, HR for tumorprogression with methylated ZBTB18: 8.30, 95% confidence inter-val (CI), 1.13–60.80] and prevailed in a multivariate Cox modelthat included GBM subclass (classical, mesenchymal, neural, pro-neural) as a covariate (multivariateCoxmodelP¼ 0.048;HR, 7.49;95% CI, 1.01–65.32), suggesting that ZBTB18 methylation por-tends a more aggressive tumor phenotype.

DiscussionHere, we describe a new role for the transcriptional repressor

ZBTB18 as a negative regulator of signatures associated with poorsurvival in GBM, and we propose DNA methylation as a mech-anism to silence ZBTB18 in themesenchymal tumor subtype. Ourfinding is in accordance with a previous study reporting thatZBTB18 is lost in established human GBM cells and identifyingZBTB18 as a brain tumor-suppressor gene (11). We demonstratethat ZBTB18 is mostly expressed in low-grade gliomas and pro-neural GBMs but less expressed in mesenchymal GBMs. This isconsistent with our previous identification of ZBTB18 as a tran-scription factor negatively associated with mesenchymal GBMs(8). ZBTB18 reexpression in primary BTSCs dampens the adher-ence poor-prognosis proliferative and mesenchymal signatures,which were identified as mutually exclusive to proneural in thesubtype classification by Phillips and colleagues. Although theassociation between patient survival and mesenchymal subtypehas not been confirmed in the previous TCGA study involvingGBMs only (18), mouse models for glioma show that sequentialmutations causing a shift from proneural to mesenchymal GBMare also associated with reduced survival (19, 20). Moreover,because tumors often show mixed subtype profiles (20, 21), itis possible that this might mask an association with survival. Thiswas clearly shown by Patel and colleagues who demonstrated thatpure IDH1 wild-type proneural tumors were associated with abetter survival compared with highly heterogeneous proneuraltumors containing cells with other subtypes (21). Similarly,tumor purity was recently shown to be an important parameterto determine a positive association of MGMT methylation withpatient survival (17). We show that ZBTB18 attenuates theexpression of genes associated with EMT and with time-to-tumorprogression in GBM (36, 37). This is in line with our analysis thatpresented a strong linkbetweenZBTB18methylation and time-to-tumor progression of GBM but only a trend of association withpatient overall survival (data not shown). This finding is inaccordance with the prevailing argument that time-to-tumorprogression might relate more closely to tumor repopulation,aggressiveness, and therapy resistance, which are biological prop-erties also associated with mesenchymal differentiation of GBM.Given this link to tumor progression and the fact that the mes-enchymal phenotype is more prevalent in recurrent GBM (2),ZBTB18 hypermethylation might play a role in both the mesen-chymal differentiation characteristics of the de novo tumor and the


Fedele et al.



http://cancergenome.nih.gov


Figure 7.

Methylation at the ZBTB18 promoter causes ZBTB18 repression in GBM. A, Linear regression of ZBTB18 expression on methylation status in n ¼ 251 samples(P ¼ 0.0000196). B, Methylation level of ZBTB18 in a series of glioma samples assessed by pyrosequencing (n ¼ 3; error bars � SD). ZBTB18 expression levelmeasured by qRT-PCR is indicated by blue circles (high expression and low expression are indicated by dark blue and blue circles, respectively). Red linehighlights the high methylation/low ZBTB18 expression samples, and blue line highlights the low methylation/high ZBTB18 expression samples. BTSC 145(GBM-derived cell line) was analyzed instead of the corresponding BT 145 GBM sample which was no longer available. C, Association between ZBTB18methylationand IDH1mutation status.D, Cluster analysis of methylation profiles of the G-CIMP and non–G-CIMP GBMs using the 450/27 K BeadChip from TCGA. The associationbetween expression of ZBTB18 and tumor subtypes (methylation or expression) is shown. ZBTB18 appears to be mostly expressed in G-CIMP GBMs. E,Association analysis between ZBTB18 promoter methylation and GBM subtypes. F and G, Representative experiment showing expression of mesenchymaltargets in samples of brain tumors highlighted inA assessedbyqRT-PCR (n¼3PCR replicates; error bars�SD). Red line, highmethylation; blue line, lowmethylation.H, Kaplan–Meier estimates of time-to-tumor progression in 109 GBM patients from TCGA, with patients stratified according to low versus high (relative tothe median) ZBTB18 methylation (log-rank P ¼ 0.029).






progression toward a more mesenchymal phenotype. However,as reported in our previous study (8) and also confirmed byothers (7), several transcription factors usually cooperate toregulate specific GBM subclasses. So, it would be interesting tostudy how deregulation of ZBTB18 fits in the previouslydescribed regulation of mesenchymal genes by other masterregulators (i.e., STAT3, CEBPB, and TAZ). The recent report that,at the single-cell level, a GBM often consists of mosaic ofsubtype makes the picture even more complicated (48). Still,identifying regulators of different GBM subtype could be impor-tant since regulators of different subclasses co-existing in thetumor could be targeted.

The mechanism leading to ZBTB18 downregulation in GBMremained to be defined. Our data reveal a link between ZBTB18promoter methylation and loss of ZBTB18 expression. However,we observed that, in some cases, low expression of ZBTB18 alsooccurs in the absence of promoter hypermethylation, suggestingthat additional molecular mechanisms downregulating ZBTB18are potentially operative inGBM.We further demonstrate a strongassociation betweenZBTB18 promoter hypermethylation and themesenchymal subtype ofGBM, implying that silencing of ZBTB18by promoter methylation is a particular hallmark of this unfa-vorableGBMsubtype.Wealso report a strong correlation betweenZBTB18 methylation and IDH1 wild-type, which is consistentwith previous studies indicating that the majority of mesenchy-mal GBMs are non–G-CIMP (46, 47). Consistently, we show thatkey mesenchymal genes (2, 8), which are also differentiallymethylated in G-CIMP versus non–G-CIMP gliomas (46), arehighly expressed in GBM exhibiting promoter hypermethylation/low expression of ZBTB18.

Collectively, our data identify ZBTB18 as a candidate tumorsuppressor and transcriptional regulator of poor prognosis-asso-ciated signatures in GBM. We have identified promoter hyper-methylation as a common mechanism to silence ZBTB18 in themesenchymal subtype ofGBM,which provides a newmechanisticopportunity to specifically target this tumor subclass.

Disclosure of Potential Conflicts of InterestA. Califano is Cofounder and Chief Scientific Advisor at, and has an

ownership interest (including patents) in, DarwinHealth, Inc. No potentialconflicts of interest were disclosed by the other authors.

Authors' ContributionsConception and design: V. Fedele, A.P. Masilamani, S. Nelander, A. Iavarone,M. Bredel, M.S. CarroDevelopment of methodology: V. Fedele, F. Dai, A.P. Masilamani, R. Ferrarese,A. Iavarone, M. Bredel, M.S. CarroAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): A.P. Masilamani, D.H. Heiland, E. Kling,S. Doostkam, A. Weyerbrock, M. Prinz, M. Bredel, M.S. CarroAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): F. Dai, D.H. Heiland, A.M. G€atjens-Sanchez,R. Ferrarese, H. Kim, S. Nelander, A. Califano, M. Bredel, M.S. CarroWriting, review, and/or revision of the manuscript: V. Fedele, F. Dai,A.P. Masilamani, R. Ferrarese, S. Nelander, A. Weyerbrock, A. Califano,A. Iavarone, M. Bredel, M.S. CarroAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): M. Prinz, M. BredelStudy supervision: M.S. CarroOther [Experimental assay (migration and proliferation assay); analysis ofexperimental assay; qPCR; ChIP; Cell culture)]: A.M. G€atjens-SanchezOther (technical support): L. Platania

AcknowledgmentsThe authors thank M. Oberle for mice brain histology, M. L€ubbert for

providing access to pyrosequencing facility, T. Feuerstein for normal braintissues, C. Stein for technical assistance, R. Claus for help with methylation

data analysis, and D. �O. hAilín for editing the article (all University of Freiburg),V.D. Marinescu for BTSCs classification (University of Uppsala), S. Nozell forinput on the article (UAB, Birmingham); Y. Gillespie (UAB, Birmingham)for providing JX6 cells; and V. Baekelandt (Katholieke Universiteit Leuven) forpLV-eGFP lentiviral vector.

Grant SupportThis study was supported by Marie Curie International Reintegration

Grant (MC IRG 268303), Deutsche Forschungsgemeinschaft Grant(DFG, CA 1246/2-1; both to M.S. Carro), and German Cancer AidGrant Award (107714, M. Bredel). M. Prinz was supported by the DFG(SFB 992).

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received December 28, 2016; revised April 7, 2017; accepted May 12, 2017;published OnlineFirst May 16, 2017.

References1. Dunn GP, Rinne ML, Wykosky J, Genovese G, Quayle SN, Dunn IF, et al.

Emerging insights into the molecular and cellular basis of glioblastoma.Genes Dev 2012;26:756–84.

2. Phillips HS, Kharbanda S, Chen R, Forrest WF, Soriano RH, Wu TD, et al.Molecular subclasses of high-grade glioma predict prognosis, delineate apattern of disease progression, and resemble stages in neurogenesis. CancerCell 2006;9:157–73.

3. Verhaak RG, Hoadley KA, Purdom E, Wang V, Qi Y, Wilkerson MD, et al.Integrated genomic analysis identifies clinically relevant subtypes of glio-blastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, andNF1. Cancer Cell 2010;17:98–110.

4. Bhat KP, Balasubramaniyan V, Vaillant B, Ezhilarasan R, Hummelink K,Hollingsworth F, et al. Mesenchymal differentiation mediated by NF-kappaB promotes radiation resistance in glioblastoma. Cancer Cell2013;24:331–46.

5. Basso K, Margolin AA, Stolovitzky G, Klein U, Dalla-Favera R, Califano A,et al. Reverse engineering of regulatory networks in human B cells.Nat Genet 2005;37:382–90.

6. Margolin AA,Nemenman I, BassoK,Wiggins C, StolovitzkyG,Dalla FaveraR, et al. ARACNE: an algorithm for the reconstruction of gene regulatory

networks in a mammalian cellular context. BMC Bioinformatics 2006;7 Suppl 1:S7.

7. Bhat KP, Salazar KL, Balasubramaniyan V, Wani K, Heathcock L,Hollingsworth F, et al. The transcriptional coactivator TAZ regulatesmesenchymal differentiation in malignant glioma. Genes Dev 2011;25:2594–609.

8. Carro MS, Lim WK, Alvarez MJ, Bollo RJ, Zhao X, Snyder EY, et al. Thetranscriptional network for mesenchymal transformation of braintumours. Nature 2010;463:318–25.

9. Ohtaka-Maruyama C, Hirai S, Miwa A, Takahashi A, Okado H. The 50-flanking region of the RP58 coding sequence shows prominent promoteractivity inmultipolar cells in the subventricular zone during corticogenesis.Neuroscience 2012;201:67–84.

10. Okado H, Ohtaka-Maruyama C, Sugitani Y, Fukuda Y, Ishida R, Hirai S,et al. The transcriptional repressor RP58 is crucial for cell-division pat-terning and neuronal survival in the developing cortex. Dev Biol 2009;331:140–51.

11. Tatard VM, Xiang C, Biegel JA, Dahmane N. ZNF238 is expressed inpostmitotic brain cells and inhibits brain tumor growth. Cancer Res 2010;70:1236–46.


Fedele et al.




12. Xiang C, Baubet V, Pal S, Holderbaum L, Tatard V, Jiang P, et al. RP58/ZNF238 directly modulates proneurogenic gene levels and is required forneuronal differentiation and brain expansion. Cell Death Differ 2012;19:692–702.

13. Cadieux B, Ching TT, VandenBerg SR, Costello JF. Genome-wide hypo-methylation inhumanglioblastomas associatedwith specific copynumberalteration,methylenetetrahydrofolate reductase allele status, and increasedproliferation. Cancer Res 2006;66:8469–76.

14. Esteller M, Catasus L, Matias-Guiu X, Mutter GL, Prat J, Baylin SB, et al.hMLH1 promoter hypermethylation is an early event in human endome-trial tumorigenesis. Am J Pathol 1999;155:1767–72.

15. Esteller M, Hamilton SR, Burger PC, Baylin SB, Herman JG. Inactivation ofthe DNA repair gene O6-methylguanine-DNA methyltransferase by pro-moter hypermethylation is a common event in primary human neoplasia.Cancer Res 1999;59:793–7.

16. You JS, Jones PA. Cancer genetics and epigenetics: two sides of the samecoin? Cancer Cell 2012;22:9–20.

17. Schulze Heuling E, et al. Prognostic relevance of tumor purity and TERTpromoter mutations on MGMT promoter methylation in glioblastoma.Mol Cancer Res 2017;15:532–40.

18. Ferrarese R, Harsh GRIV, Yadav AK, Bug E, Maticzka D, Reichardt W, et al.Lineage-specific splicing of a brain-enriched alternative exon promotesglioblastoma progression. J Clin Invest 2014;124:2861–76.

19. Xie Y, Bergstr€om T, Jiang Y, Johansson P, Marinescu VD, Lindberg N, et al.The human glioblastoma cell culture resource: validated cell modelsrepresenting all molecular subtypes. EBioMedicine 2015;2:1351–63.

20. Izzo A, Kamieniarz-Gdula K, Ramírez F, Noureen N, Kind J, Manke T, et al.The genomic landscape of the somatic linker histone subtypes H1.1 toH1.5 in human cells. Cell Rep 2013;3:2142–54.

21. Thorvaldsdottir H, Robinson JT, Mesirov JP. Integrative Genomics Viewer(IGV): high-performance genomics data visualization and exploration.Brief Bioinform 2013;14:178–92.

22. Robinson JT, Thorvaldsd�ottir H, Winckler W, GuttmanM, Lander ES, GetzG, et al. Integrative genomics viewer. Nat Biotechnol 2011;29:24–6.

23. Goldmann T, Zeller N, Raasch J, Kierdorf K, Frenzel K, Ketscher L, et al.USP18 lack in microglia causes destructive interferonopathy of the mousebrain. EMBO J 2015;34:1612–29.

24. Han X, ZhangW, Yang X,Wheeler CG, Langford CP,Wu L, et al. The role ofSrc family kinases in growth andmigration of glioma stem cells. Int JOncol2014;45:302–10.

25. Roy A, Coum A, Marinescu VD, P~olajeva J, Smits A, Nelander S, et al.Glioma-derived plasminogen activator inhibitor-1 (PAI-1) regulates therecruitment of LRP1 positive mast cells. Oncotarget 2015;6:23647–61.

26. Ernst A, Hofmann S, Ahmadi R, Becker N, Korshunov A, Engel F, et al.Genomic and expression profiling of glioblastoma stem cell-like spheroidcultures identifies novel tumor-relevant genes associated with survival.Clin Cancer Res 2009;15:6541–50.

27. SafaeeM,Clark AJ,OhMC, IvanME, BlochO, KaurG, et al.Overexpressionof CD97 confers an invasive phenotype in glioblastoma cells and isassociated with decreased survival of glioblastoma patients. PLoS One2013;8:e62765.

28. BacigalupoML,ManziM, EspeltMV,Gentilini LD, CompagnoD, LaderachDJ, et al. Galectin-1 triggers epithelial-mesenchymal transition in humanhepatocellular carcinoma cells. J Cell Physiol 2015;230:1298–309.

29. Tang J, Xiao L, Cui R, Li D, Zheng X, Zhu L, et al. CX3CL1 increasesinvasiveness and metastasis by promoting epithelial-to-mesenchymaltransition through the TACE/TGF-alpha/EGFR pathway in hypoxic andro-gen-independent prostate cancer cells. Oncol Rep 2016;35:1153–62.

30. Sakamaki M, G Bemben M, Abe T. Legs and trunk muscle hypertrophyfollowing walk training with restricted leg muscle blood flow. J Sports SciMed 2011;10:338–40.

31. Anand V, Jaswal S, Singh S, Kumar S, Jena MK, Verma AK, et al.Functional characterization of Mammary Gland Protein-40, a chiti-

nase-like glycoprotein expressed during mammary gland apoptosis.Apoptosis 2016;21:209–24.

32. WangHX, SharmaC,KnoblichK,Granter SR,HemlerME. EWI-2negativelyregulates TGF-beta signaling leading to altered melanoma growth andmetastasis. Cell Res 2015;25:370–85.

33. Chen X, Liu X, Lang H, Zhang S, Luo Y, Zhang J. S100 calcium-bindingprotein A6 promotes epithelial-mesenchymal transition through beta-catenin in pancreatic cancer cell line. PLoS One 2015;10:e0121319.

34. Taube JH, Herschkowitz JI, Komurov K, Zhou AY, Gupta S, Yang J, et al.Core epithelial-to-mesenchymal transition interactome gene-expressionsignature is associated with claudin-low and metaplastic breast cancersubtypes. Proc Natl Acad Sci U S A 2010;107:15449–54.

35. Diotel N, Beil T, Str€ahle U, Rastegar S. Differential expression of id genesand their potential regulator znf238 in zebrafish adult neural progenitorcells and neurons suggests distinct functions in adult neurogenesis. GeneExpr Patterns 2015;19:1–13.

36. Anastassiou D, Rumjantseva V, Cheng W, Huang J, Canoll PD, YamashiroDJ, et al. Human cancer cells express Slug-based epithelial-mesenchymaltransition gene expression signature obtained in vivo. BMC Cancer2011;11:529.

37. Cheng WY, Kandel JJ, Yamashiro DJ, Canoll P, Anastassiou D. A multi-cancer mesenchymal transition gene expression signature is associatedwith prolonged time to recurrence in glioblastoma. PLoS One 2012;7:e34705.

38. Lubeseder-Martellato C, Hidalgo-Sastre A, Hartmann C, AlexandrowK, Kamyabi-Moghaddam Z, Sipos B, et al. Membranous CD24 drivesthe epithelial phenotype of pancreatic cancer. Oncotarget 2016;7:49156–68.

39. Vannier C, Mock K, Brabletz T, Driever W. Zeb1 regulates E-cadherinand Epcam (epithelial cell adhesion molecule) expression to controlcell behavior in early zebrafish development. J Biol Chem 2013;288:18643–59.

40. Raschperger E, Neve EP, Wernerson A, Hultenby K, Pettersson RF,Majumdar A. The coxsackie and adenovirus receptor (CAR) is requiredfor renal epithelial differentiation within the zebrafish pronephros.Dev Biol 2008;313:455–64.

41. Li L, Ying J, Li H, Zhang Y, Shu X, Fan Y, et al. The human cadherin 11 is apro-apoptotic tumor suppressor modulating cell stemness through Wnt/beta-catenin signaling and silenced in common carcinomas. Oncogene2012;31:3901–12.

42. Guaita S, Puig I, Franci C, Garrido M, Dominguez D, Batlle E, et al. Snailinduction of epithelial to mesenchymal transition in tumor cells is accom-panied by MUC1 repression and ZEB1 expression. J Biol Chem 2002;277:39209–16.

43. Gracz AD, Fuller MK, Wang F, Li L, Stelzner M, Dunn JC, et al. Brief report:CD24 and CD44 mark human intestinal epithelial cell populations withcharacteristics of active and facultative stem cells. Stem Cells 2013;31:2024–30.

44. Lin JC, Jeong S, Liang G, Takai D, Fatemi M, Tsai YC, et al. Role ofnucleosomal occupancy in the epigenetic silencing of the MLH1 CpGisland. Cancer Cell 2007;12:432–44.

45. Kling T, Ferrarese R, �O hAilín D, Johansson P, Heiland DH, Dai F, et al.Integrative modeling reveals annexin A2-mediated epigenetic control ofmesenchymal glioblastoma. EBioMedicine 2016;12:72–85.

46. Noushmehr H, Weisenberger DJ, Diefes K, Phillips HS, Pujara K, BermanBP, et al. Identificationof aCpG islandmethylator phenotype that defines adistinct subgroup of glioma. Cancer Cell 2010;17:510–22.

47. Ozawa T, Riester M, Cheng YK, Huse JT, Squatrito M, Helmy K, et al. Mosthuman non-GCIMP glioblastoma subtypes evolve from a common pro-neural-like precursor glioma. Cancer Cell 2014;26:288–300.

48. Patel AP, Tirosh I, Trombetta JJ, ShalekAK,Gillespie SM,WakimotoH, et al.Single-cell RNA-seq highlights intratumoral heterogeneity in primaryglioblastoma. Science 2014;344:1396–401.






2017;15:998-1011. Published OnlineFirst May 16, 2017.Mol Cancer Res Vita Fedele, Fangping Dai, Anie P. Masilamani, et al. ProgressionEpigenetic Regulation of ZBTB18 Promotes Glioblastoma

Updated version

10.1158/1541-7786.MCR-16-0494doi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2017/05/16/1541-7786.MCR-16-0494.DC1

Access the most recent supplemental material at:

Cited articles

http://mcr.aacrjournals.org/content/15/8/998.full#ref-list-1

This article cites 48 articles, 12 of which you can access for free at:

Citing articles

http://mcr.aacrjournals.org/content/15/8/998.full#related-urls

This article has been cited by 1 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/15/8/998To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-16-0494

http://mcr.aacrjournals.org/content/suppl/2017/05/16/1541-7786.MCR-16-0494.DC1

http://mcr.aacrjournals.org/content/15/8/998.full#ref-list-1

http://mcr.aacrjournals.org/content/15/8/998.full#related-urls

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/15/8/998


Documents

Epigenetic Regulation of ZBTB18 Promotes Glioblastoma ... · Pyrosequencing analysis was performed using a PyroMark Q96 instrument (Qiagen), following the manufacturer's pro-tocol