Upload
dodat
View
217
Download
0
Embed Size (px)
Citation preview
UNIVERSIDADE FEDERAL DE PELOTAS Programa de Pós-Graduação em Biotecnologia
DISSERTAÇÃO
Efeito da administração de eritropoetina e de
vetores recombinantes em parâmetros reprodutivos de coelhos
Thaís Farias Collares
Pelotas, 2010.
THAÍS FARIAS COLLARES
Efeito da administração de eritropoetina e de vetores recombinantes em parâmetros reprodutivos de coelhos
Dissertação apresentada ao Programa de Pós-Graduação em Biotecnologia da Universidade Federal de Pelotas, como requisito parcial à obtenção do título de Mestre em Ciências (área do conhecimento: Biotecnologia).
Orientador: Prof. João Carlos Deschamps, PhD.
Comissão de Orientação: Prof. Fabiana Seixas, Dra.
Prof. Odir Dellagostin, Dr
Pelotas, 2010.
Dados de catalogação na fonte: Ubirajara Buddin Cruz – CRB-10/901 Biblioteca de Ciência & Tecnologia - UFPel
C697e Collares, Thaís Farias Efeito da administração de eritropoetina e de vetores recombinantes em parâmetros reprodutivos de coelhos / Thaís Farias Collares; orientador João Carlos Deschamps; co-orientador Fabiana Kömmiling Seixas, Odir Dellagostin. – Pelotas, 2010. – 51f. – Dissertação (Mestrado). Programa de Pós-Graduação em Biotecnologia. Centro de Desenvolvimento Tecnológico. Universidade Federal de Pelotas. Pelotas, 2010.
1.Biotecnologia. 2.Doping genético. 3.rHuEpo.
4.Terapia gênica. 5.Parâmetros reprodutivos. 6.Coelhos. I.Deschamps, João Carlos. II.Seixas, Fabiana Kömmiling. III.Dellagostin, Odir. IV.Título.
CDD: 619.33
Banca examinadora:
Prof. Dr. João Carlos Deschamps, Universidade Federal de Pelotas
Prof. Dra. Fabiana Kömmiling Seixas, Universidade Federal de Pelotas
Prof. Dra. Marta Gonçalves Amaral, Universidade Federal de Pelotas
Prof. Dra. Cláudia Pinho Hartleben, Universidade Federal de Pelotas
AGRADECIMENTOS
À Universidade Federal de Pelotas pela oportunidade de realizar um Curso de
Pós - Graduação de qualidade.
Ao Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
pela concessão da bolsa de estudos.
Ao meu orientador, João Carlos Deschamps, pelo incentivo e experiência na
realização deste trabalho, contribuindo na minha formação pessoal e profissional.
Aos meus pais e irmãos pelo incentivo, carinho e confiança, por estarem do
meu lado em todos os momentos da minha vida, sempre com palavras de apoio.
Eles são os grandes responsáveis pela minha formação pessoal.
Aos amigos e colegas do Laboratório de Embriologia Molecular e
Transgênese animal.
Aos demais professores, colegas e estagiários do Centro de Biotecnologia
pela amizade e convívio agradável.
E a todos que direta ou indiretamente contribuíram de alguma forma para a
realização deste trabalho.
RESUMO
COLLARES, Thaís Farias. Efeito da administração de eritropoetina e de vetores
recombinantes em parâmetros reprodutivos de coelhos. 2010. 51f. Dissertação
(Mestrado) – Programa de Pós-Graduação em Biotecnologia. Universidade Federal
de Pelotas. Pelotas.
A administração de proteínas recombinantes vem sendo utilizada no esporte como
um meio de doping. Na medicina, um método terapêutico bastante recente é a
terapia gênica, que até o momento, possui resultados indicando sua eficiência no
tratamento de algumas doenças. Recentemente, o potencial para uso indevido desta
terapia entre atletas tem despertado a atenção de cientistas e órgãos reguladores do
esporte. A transferência de genes que poderiam melhorar o desempenho esportivo
de atletas saudáveis foi denominada de doping genético. Os principais genes
candidatos são eritropoetina (EPO), fator de crescimento endotelial vascular (VEGF),
fator de crescimento semelhante à insulina tipo 1 (IGF-1) e bloqueadores da
miostatina. Porém a terapia gênica apresenta indicadores adversos, como resposta
inflamatória e falta de controle da ativação do gene. Em indivíduos saudáveis, é
provável que essa situação seja agravada. Ainda não existem testes conclusivos
para a detecção do doping genético, no entanto alguns estudos recentes têm o
intuito de investigar algumas estratégias que apontam como promissoras. O reflexo
do uso da EPO sobre parâmetros reprodutivos in vivo ainda não tem sido descritos,
por outro lado, estudos in vitro com cultivo de células têm demonstrado que a
eritropoetina estimula a esteroidogênese nas células de Leydig desencadeando um
aumento na produção de testosterona. O objetivo deste estudo foi avaliar os efeitos
da administração de rHuEpo (eritropoetina recombinante) e da transferência gênica
com eritropoetina em parâmetros reprodutivos de coelhos. Quinze coelhos foram
divididos em 3 grupos: grupo I (rHuEpo) receberam por via subcutânea 25UI/kg de
eritropoetina humana recombinante, três vezes por semana durante cinco semanas,
grupo II (pTarget/Epo) receberam dose única de vetor recombinante com o gene da
eritropoetina de coelho; grupo III (pTarget) receberam dose única de vetor pTarget
vazio (controle). Parâmetros sanguíneos e reprodutivos foram monitorados durante o
experimento, tais como: motilidade, vigor espermático, concentração espermática,
viabilidade espermática, morfologia espermática, hemácias e hematócrito. A
transferência gênica com eritropoietina e a administração de rHuEpo causaram um
aumento significativo no número de eritrócitos. Os animais que receberam rHuEpo
obtiveram um aumento no hematócrito, alcançando valores entre 41,34 e 52,32. A
análise estatística mostrou que os tratamentos e o tempo não interferiram na
motilidade, concentração espermática e vigor espermático (P <0,05). A porcentagem
de células com morfologia normal, tanto do grupo I como do grupo II diminuiu no
decorrer do tempo, mas não houve diferença estatística entre os tratamentos
(P<0,05). Este é o primeiro estudo que relata as respostas do uso do doping
genético com o gene da eritropoetina e da administração de rHuEpo em parâmetros
sanguíneos e reprodutivos.
Palavras-chave: doping genético; rHuEpo; terapia gênica; parâmetros reprodutivos
ABSTRACT
COLLARES, Thaís Farias. Efeito da administração de eritropoetina e de vetores
recombinantes em parâmetros reprodutivos de coelhos. 2010. 51f. Dissertação
(Mestrado) – Programa de Pós-Graduação em Biotecnologia. Universidade Federal
de Pelotas. Pelotas.
The administration of recombinant proteins is being used in sport as gene doping. In
medicine, a recent therapeutic technique is the genetic therapy, which, up to this
moment, shows results that indicate its efficiency in the treatment of some diseases.
Recently, the potential for misuse of gene therapy among athletes has called the
attention of scientists and sports regulating organs. The transfer of genes that could
enhance athletic performance was named gene doping. The most important
candidate genes for gene doping are Erythropoietin (EPO), vascular endothelial
growth factor (VEGF), insulin-like growth factor I (IGF-1) and myostatin blockers.
Nevertheless, gene therapy presents adverse indicators, such as inflammatory
response and lack of control of gene activation. It is probable that in healthy
individuals such problems would be aggravated. There are still no conclusive tests
capable of detecting gene doping. However, recent researches have studied
promising strategies. The reflection of the use of EPO on reproductive parameters in
vivo has not yet been described. On the other hand, in vitro studies with cultured cells
have shown that erythropoietin stimulates steroidogenesis in Leydig cells, triggering
an increase in testosterone production. The objective of this study is to evaluate the
effects of the administration of recombinant erythropoietin (rHuEpo) and
erythropoietin gene transfer in reproductive parameters of rabbits. Fifteen rabbits
were divided in 3 groups: group I (rHuEpo) received subcutaneously 25UI/kg of
recombinant human erythropoietin, three times a week for 5 weeks; group II
(pTarget/Epo) received a single dose of recombinant vector with the gene of the
rabbit erythropoietin; group III (pTarget) received a single dose of empty pTarget
vector (control). Throughout the experiment, reproductive and blood parameters were
monitored, such as: sperm motility, spermatic vigor, sperm concentration, sperm
viability, sperm morphology, erythrocytes and hematocrit level. Erythropoietin gene
transfer and rHuEpo administration caused a significant increase in the number of
erythrocytes. The animals which received rHuEpo showed an increase in the
hematocrit level, reaching numbers between 41,34 and 52,32. The statistical analysis
proved that the treatment and the time did not interfer on sperm motility, sperm
concentration and spermatic vigor (P<0.05). The percentage of morphologically
normal cells in group I as well as in group II decreased over time, however, there was
no statistical difference between the treatments (P<0.05). This study is the first to
show the answers to the use of gene doping with the erythropoietin gene and the
rHuEpo administration in reproductive and blood parameters.
Key words: gene doping; rHuEpo; gene therapy; reproductive parameters
LISTA DE FIGURAS
Figura 1A
Número de eritrócitos após a transferência com pTarget/Epo e
administração de rHuEpo em coelhos...……………………………….
44
Figura 1B
Nível do hematócrito após a transferência com pTarget/Epo e
administração de rHuEpo em coelhos...……………………………….
45
Figura 2
Porcentagem de células com morfologia normal após a
transferência com pTarget/Epo e administração de rHuEpo em
coelhos..…………………………........................................................
46
Figura 3 Número de células com morfologia anormal na peça intermediária
após a transferência com pTarget/Epo e administração de rHuEpo
em coelhos..…………………………..................................................
47
LISTA DE TABELAS
Tabela 1
Esquema de inoculações, dosagens e vias de administração nos
diferentes grupos experimentais........................................................
41
Tabela 2
Média da viabilidade espermática (%) de coelhos submetidos a
diferentes tratamentos.......................................................................
42
Tabela 3
Coeficientes de Correlação de Pearson entre as variáveis testadas 43
Tabela 4
Média do número de eritrócitos (milhões/mm3) de coelhos
submetidos a diferentes tratamentos ao longo do tempo..................
44
Tabela 5
Média dos níveis de hematócrito (%) de coelhos submetidos a
diferentes tratamentos ao longo do tempo........................................
45
Tabela 6
Média de células espermáticas normais (%) submetidas a
diferentes tratamentos ao longo do tempo........................................
46
Tabela 7
Média do número de anormalidades na peça intermediária de
espermatozóides de coelhos submetidos a diferentes tratamentos
ao longo do tempo.............................................................................
47
LISTA DE ABREVIATURAS E SIGLAS
ANOVA – Análise de Variância
AZT – Zidovudina
cDNA – Ácido Desoxirribonucléico Complementar
DNA – Ácido Desoxirribonucléico
EPO – Eritropoetina
GH – Hormônio do crescimento
GnRH – Hormônio liberador de gonadotrofina
HIV – Vírus da Imunodeficiência Humana
IGF-1 - Fator de crescimento semelhante à insulina tipo 1
LH – Hormônio Luteinizante
mRNA – Ácido Ribonucléico mensageiro
rHuEPO – Eritropoetina Humana Recombinante
VEGF - Fator de crescimento vascular endotelial
SUMÁRIO
1. INTRODUÇÃO GERAL................................................................................. 10
2. ARTIGO I....................................................................................................... 14
Abstract.............................................................................................................. 16
1. Introduction………………………………………………………………….…..... 17
2. The bioethical analysis of gene doping…………………………………..….… 18
3. Candidate genes for use in the gene doping……………………………..…… 19
3.1. Molecular mechanisms of synthesis and action of erythropoietin………... 19
3.2. VEGF: Increasing the supply of oxygen to the tissues….………...……..… 21
3.3. IGF-1: The stimulant of muscle and bone growth………………………..… 21
3.4. Myostatin: a negative regulator of muscle growth and differentiation…..... 22
4. The detection of gene doping: challenges and limitations………………..…. 23
5. Conclusions………………………………………………………………….…… 24
Acknowledgements….………………………………………………………….….. 25
References……..………………………………………………………………….… 25
3. ARTIGO II...................................................................................................... 28
Abstract.............................................................................................................. 30
1. Introduction………………………………………………………………….…..... 31
2. Material and Methods………………………….................…………………...… 32
3. Results……………...........……………………………………………………...… 35
4. Discussion……………………………………………………………................... 36
5. Conclusion………………………………………………………………………… 38
Acknowledgements………………………………………………………................. 38
References………………………………………………………………................... 39
4. CONCLUSÃO……………………………………………………………………... 48
5. REFERÊNCIAS.............................................................................................. 49
10
1. INTRODUÇÃO GERAL
A eritropoetina (EPO) é o regulador primário da eritropoiese, a qual é um
hormônio glicoprotéico produzido inicialmente no fígado de fetos e mais tarde nos
rins. Este hormônio age sinergicamente com outras citocinas para promover a
proliferação, diferenciação e sobrevivência de células progenitoras de linhagens
eritróides (VARLET-MARIE et al., 2004).
A rHuEPO (eritropoetina recombinante humana) é aprovada para uso em
humanos no tratamento de anemias, associada com hemodiálise ou doença renal
crônica, pacientes com câncer em quimioterapia, pacientes HIV positivos em terapia
com AZT, bem como para minimizar o uso de transfusões de sangue alogênica em
pacientes anêmicos submetidos a grandes cirurgias (LANGSTON et al., 2003).
Nenhum produto derivado da eritropoetina está aprovado para uso em
animais, no entanto, a eritropoetina recombinante humana é comumente utilizada no
tratamento da anemia promovida por falha renal crônica. O risco de abuso da
eritropoetina recombinante é aumentado pela sua obtenção e administração sem
supervisão médica (SHARPE et al., 2002).
Em esportes de resistência e corridas de cavalo, especula-se que a rHuEPO
passou a ser utilizada de forma rotineira como meio artificial de produção de
glóbulos vermelhos, devido a vantagem adicional da difícil detecção de sua presença
na matriz biológica através dos métodos analíticos convencionais, além do efetivo
ganho no desempenho esportivo (GUAN et al., 2007; PASCUAL et al., 2004).
O uso de eritropoetina recombinante para aumento de performance de atletas
é ilegal, mas a prática presumivelmente continua ilícita (ASHENDEN et al., 2006).
Em cavalos de corrida, qualquer aumento de performance promovido pela EPO é
obscurecido pelo risco de formação de anticorpos contra as moléculas administradas
e com possível reação contra moléculas de eritropoetina endógena. Observações
11
preliminares sugerem que o uso abusivo de eritropoetina recombinante pode
provocar um risco de parar abruptamente a produção de eritropoetina endógena,
desencadeando uma severa anemia. Nesse caso, estes indivíduos seriam incapazes
de desenvolver respostas eritropoiéticas adequadas a condições de estresse
(AZZAZY et al., 2005).
Efeitos adversos do uso da eritropoetina recombinante são anemia
refratária/hipoplasia eritrocitária, hipertensão sistêmica, policitemia, ataque
apoplético, vômito, deficiência de ferro, reações na pele, febre e artralgia.
Hipertensão também tem sido associada à terapia com eritropoetina em pessoas e
animais (LANGSTON et al., 2003). A eritropoetina também aumenta notavelmente a
ativação endotelial e a reatividade plaquetária em humanos, e isto pode aumentar
substancialmente o risco de complicações tromboembólicas, especialmente em
indivíduos com predisposição genética à trombofilia (CAZZOLA, 2000; DIAMANTI-
KANDARAKIS et al., 2005; LASNE et al., 2004).
Em geral, sabe-se pouco sobre os efeitos do tratamento com rHuEPO por um
longo período com fatores de crescimento hematopoiéticos, mas observações em
animais sugerem que há potencialmente um risco de desenvolvimento de desordens
mieloproliferativas (CHENUAUD et al., 2004).
Experimentalmente, o gene que codifica a eritropoetina vem sendo
administrado no tratamento de anemias e de doenças renais, uma vez que produz
uma forma de hormônio efetivamente endógena. Esta ferramenta de terapia gênica
pode ser utilizada como doping genético (LASNE et al., 2004).
O termo doping genético tem origem na utilização de proteínas recombinantes
e vetores de DNA para aumentar o desempenho atlético em humanos e animais.
(BAOUTINA et al., 2008). O doping genético é baseado na introdução e subsequente
expressão de um gene alvo ou por modulação da atividade de um gene existente.
Por exemplo, o doping genético, com IGF-1 tem sido bem sucedido em ratos,
onde um aumento perceptível na massa e força muscular foi observado mesmo
meses após o tratamento concluído (BARTON-DAVIS, 1998). O doping utilizando a
EPO demonstrou efeitos sistêmicos em macacos, incluindo o aumento da
capacidade aeróbia, a melhoria do desempenho e os níveis de hematócrito elevado
(UNAL et al., 2004). Porém alguns estudos relataram um aumento de hiperatividade,
agressividade e outras sequelas comportamentais nos ratos tratados. A
superexpressão de EPO em macacos tem sido relatada por aumentar a viscosidade
12
do sangue, com efeitos sobre o funcionamento cardíaco (MCKANNA, 2010). É
evidente que, embora modelos animais possam demonstrar a promessa do doping
genético, os perigos desse procedimento não podem ser ignorados, porque a sua
utilização está prevista em seres humanos.
Ainda não existem testes conclusivos para a detecção do doping genético, no
entanto alguns estudos recentes têm o intuito de investigar algumas estratégias que
apontam como promissoras (DEFRANCESCO, 2004; HAISMA et al., 2006; UNAL et
al., 2004).
Qualquer processo fisiológico envolvido na produção de uma ação motora ou
de auxiliar na execução de um movimento motor pode ser um candidato para o
doping genético. Os processos fisiológicos da respiração pulmonar, circulação
cardiovascular, de fornecimento de oxigênio, o crescimento do músculo
estriado/eficiência/reparação, e até mesmo a coordenação neuromuscular podem
ser alterados para dar ao atleta uma vantagem na sua competição. Alguns genes
são candidatos potenciais para uso em doping genético como: GH, IGF-1, VEGF,
EPO e Miostatina, os quais também poderão ser utilizados para promover a cura
mais rápida de lesões esportivas, e reduzir dor associada (BAOUTINA et al., 2007;
GAFFNEY et al., 2007).
Embora o uso adequado destes hormônios traga inúmeros benefícios
terapêuticos no tratamento de certas doenças, o seu uso impróprio pode traduzir-se
em enormes riscos para os atletas que utilizam para ganhar vantagem em termos
competitivos.
Com base nos atuais conhecimentos sobre respostas do organismo, celular e
sistêmica, gerados a partir da engenharia genética, imunologia, bioquímica e
fisiologia busca-se uma compreensão dos efeitos e conseqüências sobre o
metabolismo de novos peptídeos gerados por processos biotecnológicos.
O reflexo do uso da EPO sobre parâmetros reprodutivos in vivo ainda não tem
sido descritos, por outro lado, estudos in vitro com cultivo de células têm
demonstrado que a eritropoetina estimula a esteroidogênese nas células de Leydig
desencadeando um aumento na produção de testosterona (YAMAZAKI et al., 2004).
Essa observação leva a formulação da hipótese de que a administração de rHuEPo
in vivo induz ao aumento na síntese de testosterona levando a um feedback negativo
sobre a liberação de GnRH/LH e conseqüentemente afetando direta e indiretamente
13
a espermatogênese e o potencial espermático podendo desencadear uma
infertilidade temporária ou permanente.
As metodologias apresentadas, utilizando modelos biológicos experimentais,
buscam a compreensão das conseqüências fisiológicas da administração do gene
da eritropoetina humana.
Inicialmente é apresentada uma revisão bibliográfica (artigo I) sobre o uso de
genes para o aumento da performance atlética, onde foi relacionado o doping
genético e a terapia gênica, intitulada: “The use of genes for performance
enhancement: doping or therapy? Esta revisão foi submetida à publicação na revista
Sports Medicine.
Em seguida, o artigo II intitulado: "Effect of rHuEpo and erythropoietin gene
transfer on reproductive parameters of rabbits", onde o objetivo foi avaliar o grau de
comprometimento do potencial reprodutivo dos modelos biológicos submetidos a
administrações de eritropoetina recombinante ou de vetores de DNA contendo o
gene da eritropoetina. Este trabalho será submetido à publicação, como artigo
completo, para a revista Scandinavian Journal of Medicine & Science in Sports.
Os dados encontrados estão apresentados na forma de artigos científicos
logo a seguir. Os artigos estão compilados na formatação exigida por cada um dos
periódicos científicos em que foram ou serão submetidos.
14
ARTIGO I
The use of genes for performance enhancement: doping or therapy?
(Artigo científico formatado nas normas do periódico Sports Medicine)
(Submetido - Fator de Impacto 3.018)
15
The use of genes for performance enhancement: doping or therapy?
Thaís Farias Collares, Ruan Oliveira, Vinicius Farias Campos, Priscila Moura
Marques de Leon, Fabiana Kömmiling Seixas, João Carlos Deschamps and Tiago
Collares*
Centro de Desenvolvimento Tecnológico (CDTec), Programa de Pós-Graduação em
Biotecnologia – PPGB, Universidade Federal de Pelotas, Pelotas, RS, Brazil.
Title: 10 words
Abstract: 153 words
Text (manuscript): 2911 words
References: 30 references
Running title: Gene Doping to enhance athletic performance
*Corresponding Author
Tiago Collares
Centro de Desenvolvimento Tecnológico
Universidade Federal de Pelotas
Campus Universitário s/nº, CEP 96010-900
Caixa Postal 354, Pelotas, RS, Brazil
Phone: +55 53 3275 7588, FAX: +55 3275 7551
E-mail: [email protected]
16
Abstract
Recent advances in biotechnology have provided the manipulation of genes to
treat various pathologies in a process called gene therapy. However, the
improvement of this therapy and the potential to enhance athletic performance has
opened the door for gene doping. In this technique, genes are inserted into a specific
tissue, altering the gene expression or the amount of a protein product. The
commonly used genes are erythropoietin (EPO), vascular endothelial growth factor
(VEGF), insulin-like growth factor 1 (IGF-1) or myostatin antagonists, but a lot of new
genes might be used, such as those involved in metabolic pathways of glucose.
Because it is very difficult to detect, gene doping is the most promising method to
corrupt the sports. Unfortunately, the scientific progress may enable new methods of
doping. Thus, it is necessary to continually explore new ways of detection, allowing
the return of sports to its original purpose, the achievement of recognition and glory.
Key-words: Gene doping, gene therapy, bioethics.
17
1. Introduction
The scientific knowledge has made many advances in recent years. In the last
decade, the publication of the human genome, allied with various molecular
knowledge existing at the time, provided the gene manipulation for the treatment of
various diseases. The advent of molecular sciences also provided interventions in
sports performance. Around the world, people have been exposed to the notion of
human enhancement through sport, as some athletes seek a boost to success,
stardom, and financial reward. In the past, doping and cheating in sport have been
enabled by advances in pharmacology and physiology. Recently, the successful
development of gene therapy has provided the concepts, tools, opportunities, and,
for some, justification for genetic modification of functions that affect normal human
traits, including athletic performance[1].
Gene expression is regulated primarily by two main mechanisms: (a) changes
in the DNA structure or (b) direct interventions in the process of transcription and
translation. The first includes the epigenetic modifications and mutations. By
epigenetics, the availability of gene transcription is altered, without causing changes
in DNA sequence. The mutations promote changes in the nucleotide sequence of the
gene and can unchain the process of transcription or generate a new product,
different from the original. The second mechanism consists of repressor and inductor
molecules, transcription factors, enhancers and post-transcriptional modifiers.
Therefore, some changes in the regulatory process may result in an increased or
decreased concentration of the gene product.
The World Anti-Doping Agency (WADA; 2010 prohibited list) considers gene
doping as the use of pharmacological or biological agents that alter gene expression,
or the transfer of cells or genetic elements (DNA and RNA)[2]. As explained by N.C.
Craig Sharp, some changes in gene expression are convenient to increase sports
performance by many ways. These changes can target a wide variety of tissues,
such as bone marrow for increase erythrocytes and enhance the oxygen transfer;
liver and kidney for Cori-cycle lactate-removing kinetics; myocardium for increased
cardiac output; and skeletal muscle to influence fiber-type quality and percentage,
sarcomere structure, creatine-phosphate level, mitochondrial number, glycolytic and
glycogenesis enzymes and chemiosmotic pathway kinetics, levels of myoglobin and
18
intracellular dipeptide buffers, and muscle capillary numbers. Also, the neurologic
areas may be targeted to increase pain tolerance[3].
The fast advancement of biotechnology promotes the development of doping.
From recombinant protein to gene doping, there is a great challenge to their
detection[4]. The new opportunities generated by recent scientific advances require a
thorough ethical analysis. What is the limit to reach victory? The abuse of gene
therapy should be ignored? Is science destroying sports?
2. The Bioethical Analysis of Gene Doping
The real reason for the participation of athletes in sports competitions has
changed radically since its creation. In the Ancient Olympic Games, athletes
competed for recognition, eternal fame and an olive branch. Today, the participation
in international competitions has another motive: money. For an athlete, to win a
medal is a guarantee of lucrative contracts in the future[5].
Dr. Andy Miah explains that there are two ways to analyze the ethic
acceptability of gene doping. The first believes that sports ethics is subservient to
medical ethics. So, if the use of gene therapy for medicine is allowed, it should also
be acceptable to performance increases. This way, a sports physician can prescribe
potentially performance-enhancing drugs to athletes in order to alleviate some illness.
However, this matter is not straightforward and it is not an easy task for a physician
to decide how best to treat their athlete-patient – more as an athlete or more as a
patient. Furthermore, some patients might have more interests in receiving a
treatment that makes them well for sports performance, rather than well for life. The
second way says that sport‟s ethics is separated of medical ethics. Sport is a moral
practice, not requiring an approach that rejects the literature of medical ethics, but
depends more on the sport context than on the medical context [6].
The main argument used by WADA to justify the prohibition of gene doping
consists on the uncertainty created by the insertion of genes or the use of
substances that interfere in the gene expression. The use of such substances can
bring unknown risks to the athlete‟s health which can interfere not only in somatic
cells, but also in the germline. In contrast to somatic cell therapy, germ-line
alterations are permanent and are transmitted to future generations. Moreover, the
use of gene therapy in order to increase sports performance violates the sports spirit,
19
giving unfair physical advantages to those who have a greater access to substances
used in the process [7].
3. Candidate Genes for Use in the Gene Doping
3.1 Molecular Mechanisms of Synthesis and Action of Erythropoietin
In adults, the erythropoietin is produced mostly by the interstitial cells of
kidneys and in small quantities by the liver, where fetal synthesis occurs [8]. This
process is regulated by the concentration of circulating oxygen, differing in the
conditions of normoxia and hypoxia. The enzymes prolyl hydroxylase and
asparaginyl hydroxylase are sensors of the level of intracellular oxygen. In normal
oxygen tension (normoxia), the hypoxia-inducible transcription factor 1α (HIF-1α) has
its proline residues 402 and 567 hydroxylated in sites of proteasomal degradation
dependent of O2. In sequence, occurs the hydroxylation of asparagine residues in
carbon terminal transactivation domain (C-TAD). These hydroxylations prevent the
binding of HIF-1α to the nucleotide sequence (A/G) CGTG, a regulatory region of the
erythropoietin gene (EPO). However, the opposite occurs in conditions of hypoxia -
the hydroxylations not occur, resulting in binding of HIF-1α to the regulatory region of
the EPO gene. Thus, in hypoxia occurs in the induction of gene expression in
question, leading to increased levels of erythropoietin intracellular. Other transcription
factors are also involved in regulating gene EPO expression, such as HIF-1β, HIF-2α
/ β and HIF-3α / β. After the transcription and translation of the EPO gene, the
polypeptide originated suffers post-translational modifications, such as
glycosylations, essential for the establishment of its function in vivo [9;10].
The hematopoietic system is regulated by three main groups of hematopoietic
growth factors: (1) the colony stimulating factors, (2) thrombopoietin and
erythropoietin and (3) cytokines (mainly interleukins). The erythroid lineage, which
ultimately originates the erythrocytes, is regulated primarily by signaling performed by
erythropoietin. The erythropoesis occurs in several steps of cell differentiation: the
stem cell originates the pluripotent hematopoietic myeloid progenitor that
differentiates into the colony-forming unit erythroid (CFU-E). Erythropoietin stimulates
the proliferation and differentiation of this CFU in basophilic, polychromatic and
orthochromatic erythroblast, in this order. These last differentiate into reticulocytes.
20
Last, but not least, the reticulocytes mature and produce the erythrocytes, cells that
contain hemoglobin, a protein involved in gas exchange during cellular respiration [8].
By these cells, oxygen is carried to tissues and, arriving at its destination, it is used
primarily for energy production, through the oxidative phosphorylation. Therefore, an
increase in the number of circulating red blood cells, leads to an increase in the
supply of oxygen to tissues and, thereafter, to greater energy production by aerobic
mechanisms. This is the basic principle for the use of EPO in gene doping.
In the bone marrow are the early stages of the CFU-E progeny. These have a
dimmed receptor for erythropoietin, whose intracellular domain has a tyrosine kinase
coupled, called JAK-2 (Janus Kinase 2). The binding of the erythropoietin to the
receptor, induces the interaction of JAK-2 with the SH2 domain of cytosolic protein
STAT 5 (signal transducer and activator of transcription 5). This interaction promotes
the phosphorylation of STAT 5, forming a homodimer of phosphorylated STAT 5.
This translocates to the nucleus, binds to specific nucleotide sequences in DNA and
promotes the transcription of genes necessary for the continuity of erythropoiesis [10].
Erythropoietin has other physiological effects, non-hematopoietics, as
neuroprotective actions [11], found in patients with schizophrenia by Ehrenreich et al.
[12]. Although there are no descriptions of the reflections of EPO on the reproductive
parameters in vivo and in vitro, studies with cell cultures have shown that
erythropoietin stimulates steroidogenesis in Leydig cells, triggering an increase in
testosterone production, leading to a negative feedback on the release of GnRH/LH
and, consequently affecting the spermatogenesis and the spermatic potential that
may cause infertility [13].
The recombinant human erythropoietin (rhEPO) is produced in large scale by
biotechnological processes and has wide application for the treatment of various
pathologies, such as anemia, chronic renal insufficiency, hematological malignancies,
chemotherapy and premature birth. Also, rhEPO is used to minimise allogeneic blood
transfusions after major surgical procedures and recently for performance
enhancement [14].
Fattori et al. analyzed the efficacy of intramuscular injection of the EPO gene
along with the application of electric pulses to optimize the process of transduction.
The gene was electro-injected into mice, rabbits and cynomolgus monkeys to test for
protein production and biological effect. The study concluded that the injected EPO
gene yields higher levels of circulating transgene product and a more significant
21
biological effect than the wildtype gene in all the species tested, thus showing great
potential in clinically developable gene therapy approaches for EPO delivery [15].
3.2 VEGF: Increasing the Supply of Oxygen to the Tissues
The oxygen is vital for the synthesis of ATP by aerobic respiration. This gas is
a small molecule that can diffuse through the plasma membrane of endothelial cells.
Therefore, an increased vascular branching promotes a more rapid and effective
diffusion of oxygen to the tissues and a greater availability of it for energy production.
The vascular endothelial growth factor (VEGF) promotes the branching of a
preexisting vessel, in a process called angiogenesis. In gene doping, are inserted
several copies of the gene coding for VEGF in the muscle, using viral vectors. Thus,
the muscular microcirculation is stimulated and, with this, the supply of oxygen to the
muscles is increased [16;17].
3.3 IGF-1: The Stimulant of Muscle and Bone Growth
The insulin-like growth factor type 1 (IGF-1) is a 70-amino-acid polypeptide
synthesized primarily in the liver under the control of the growth hormone (GH) [17;18].
The hypothalamus produces two peptides, the growth-hormone-releasing hormone
(GHRH) and somatostatin, which control the release of GH by the somatotropes of
anterior pituitary. The GHRH, sleep, intense physical exercise, hypoglycemia and low
levels of circulating IGF-1 stimulates the release of GH. However, this is inhibited by
the somatostatin, hyperglycemia and increased blood concentrations of IGF-1. The
GH acts on hepatocytes stimulating production and secretion of IGF-1, growth factor
that stimulates the growth and differentiation of skeletal muscle tissue and also the
overall growth of bone tissue [3;19-21].The availability of IGF-1 is regulated by binding
proteins (IGF-BP); mostly is complexed to IGF-BP3. In skeletal muscle also occurs
the production of IGF-1, which acts in an autocrine and paracrine pathways [22].
The main route of intracellular signaling of IGF-1 starts with its binding to the
IGF1R, receptor formed by a dimer of two glycoproteins with cytoplasmic domains of
tyrosine kinase. The interaction of IGF-1 and its receptor induces a tyrosine
autophosphorylation in the cytoplasmic domains of the receptor, triggering an
intracellular signaling cascade that promotes the survival and proliferation of the
22
muscle cell. Thus, IGF-1 has others effects, that go beyond the performance boost,
may cause the development and progression of tumors [19].
In gene doping, multiple copies of the gene coding for the IGF-1 are inserted
in skeletal muscle, promoting an increase in the muscle mass, due to hypertrophy of
muscle cells. This somatic gene insertion can be accomplished through the use of
two different vectors: plasmids or viruses. The plasmids are a more economical
method, although less efficient. Since the viruses, widely used in gene therapy, insert
the foreign DNA into the genome of the target cell. The viral classes commonly used
are: (1) the adenovirus, with double-stranded DNA, and (2) the adeno-associated
viruses, with single-stranded DNA [3;22].
3.4 Myostatin: a negative regulator of muscle growth and differentiation
First described by McPherron et al., the myostatin, member of the superfamily
of transforming growth factor (TGF)-β is a potent negative regulator of growth and
differentiation of skeletal muscle, where its gene expression predominates [23;24]. Just
as the endocrine hormones, myostatin circulates in the blood plasma at high
concentrations. Its inhibition, either through antibodies to myostatin, drugs what binds
to it or the technology of knockout, results in a hypertrophy of skeletal muscle tissue,
principle used in gene doping [25]. Many studies show these effects of increased
performance provided by changes in the activity of myostatin. Among these, is the
analysis performed by Mosher et al. in which was evaluated the relationship between
mutations in the myostatin gene and increased muscle mass and racing performance
in heterozygous dogs [26].
The muscular dystrophies are a heterogeneous group of congenital disorders
characterized by severe muscle weakness, atrophy and destruction of muscle fibers.
These diseases are submitted to three different therapies: genetic, cellular and
pharmacological. In gene therapy, the defective genes are replaced by foreign
genes, with the use of insertion vectors. The cell therapy is based on the replacement
of defective muscle cell through the differentiation of pluripotent stem cells, including
satellite cells found near the muscle fibers, cells of hematopoietic population and
mesoangioblasts. So there are pharmacological treatments, which consist of the use
of steroids, creatine and inhibitors of prostaglandin synthesis. The use of positive
growth factors for myoblasts, like IGF-1, and the blockade of negative regulators of
23
muscle growth, such as myostatin, increases muscle mass and decrease the
phenotypic manifestation of dystrophies. Several substances block the inhibitory
activity of myostatin in muscle growth and differentiation. Among these, are
emphasized the follistatin, its coding gene and some proteins that contain domains of
follistatin, all with the ability to bind to myostatin, which makes it unavailable for its
natural inhibitory function.
Still, other applications of myostatin are present in literature. High levels of
myostatin are seen in skeletal muscles of elderly, indicating that this is a biological
marker associated with age. With advancing age, there is a loss of muscle mass and
strength in clinical cachexia, sarcopenia and muscle atrophy. Thus, the
administration of myostatin antagonists has great value in treating these disorders.
The inhibition of myostatin activity also promotes the fall of adipogenesis with aging,
minimizing the effects of obesity and diabetes mellitus type 2 [27]. Besides the use of
myostatin antagonists in therapy for muscular disorders and metabolic syndromes,
they are also commonly used in gene doping for performance enhancement in sports
competition. The inhibiting of the natural function of myostatin leads to hypertrophy of
muscle cells, increasing the muscle mass.
4. The Detection of Gene Doping: Challenges and Limitations
The detection of gene doping is very difficult, although it can be accomplished
by either direct or indirect methods. Direct methods involve the detection of
recombinant proteins or gene insertion vectors - viruses or plasmids. Indirect
methods consist in an analysis of the immune system responses to gene transfer
and/or of changes in the transcriptome of a particular cell type.
A direct method to distinguish the purpose of gene modifications is the
analysis of gene expression. When used for gene therapy, the transgene replaces a
defective gene and, thus, gene expression is detected where it was previously
lacked. However, in gene doping, the changes promote an increased concentration
of gene product that already exists in a normal quantity, might induce different post-
translational modifications [28]. A study performed by Lasne et al. showed some
structural differences between endogenous and recombinant erythropoietin,
responsible for their different isoelectric behavior [29]. Another possibility for direct
detection is based on the use of molecular tests to differentiate the genomic DNA
24
from the cDNA. The sequence of complementary DNA does not contain introns, may
be distinguished using the techniques of polymerase chain reaction (PCR) or
Southern Blotting.
The detection of insertion vectors in blood plasma presents great difficulties,
considering the extremely short half-life of circulating plasmids, adenoviruses and
adeno-associated viruses. So, the only way to detect the insertion vectors in bodily
fluids through the application of molecular tests with relatively short intervals, with the
need to create a regular testing regime.
The use of indirect methods is an alternative strategy based on analysis of
gene doping effects on cells, tissues or entire organism such the immune system
responses to gene insertion vectors or „non-self‟ peptides encoded by introduced
nucleic acid [28].
Recently, the use of transcriptomics, which consists in analysis of tissue‟s
complement of mRNA transcripts, became a promissory method to detect gene
doping. The quantity and composition of a tissue‟s transcriptome is highly reflective of
metabolic activity. Some tissues can be easily accessed to construct a pattern of
gene expression. So, it‟s possible to estimate some changes in each tissue‟s pattern,
enabling the development of doping detection techniques [30].
5. Conclusions
The scientific development tests human reason and ethics. Great advances,
such as the advent of “omics sciences”, provide new alternatives for the treatment of
many diseases, but aggregate inappropriate opportunities that destroy and corrupt
human values.
Science has elucidated genomes, mechanisms of gene regulation and
metabolic pathways. These discoveries enabled the use of gene doping, a process
that would hide the paths of fraud at the genomic level. Therefore, the biotechnology
must find reliable methods of detection for these misapplications of knowledge. Last
but not least, athletes and sports physicians must think about the real purpose of
sports. There will always be a choice.
25
Acknowledgements
T. F. Collares, V. F. Campos and P. M. M. de Leon are students of Graduate
Program in Biotechnology at Universidade Federal de Pelotas. T. F. Collares and R.
Oliveira are supported by Brazilian CNPq and V. F. Campos and P. M. M. de Leon
are supported by CAPES. J.C. Deschamps is research fellow of CNPq. The authors
have no conflicts of interest that are directly relevant to the content of this review.
References
1. Friedmann T, Rabin O, Frankel MS. Ethics. Gene doping and sport. Science
2010; 327(5966):647-648.
2. World Anti-Doping Agency. The 2010 Prohibited List. Montreal: WADA, 2010.
http://www.wada-ama.org, acessed 3 March 2010
3. Sharp NC. The human genome and sport, including epigenetics, gene doping,
and athleticogenomics. Endocrinol Metab Clin North Am 2010; 39(1):201-215.
4. Wang W, Zhang S, Xu J, Xia X, Tian Y, Zhang X et al. [Current status and
prospects of gene doping detection]. Se Pu 2008; 26(4):408-412.
5. Filipp F. Is science killing sport? Gene therapy and its possible abuse in
doping. EMBO Rep 2007; 8(5):433-435.
6. Miah, A. Gene-Doping: Sport, Values & Bioethics. In Glasa, J. (Ed.) The Ethics
of Human Genetics. Strasburg, Council of Europe 2003; 171-180
7. Haisma HJ, de HO. Gene doping. Int J Sports Med 2006; 27(4):257-266.
8. Fisher JW. Erythropoietin: physiology and pharmacology update. Exp Biol Med
(Maywood ) 2003; 228(1):1-14.
9. Ebert BL, Bunn HF. Regulation of the erythropoietin gene. Blood 1999;
94(6):1864-1877.
10. Jelkmann W. Molecular biology of erythropoietin. Intern Med 2004; 43(8):649-
659.
26
11. Juul S, Felderhoff-Mueser U. Epo and other hematopoietic factors. Semin
Fetal Neonatal Med 2007; 12(4):250-258.
12. Ehrenreich H, Degner D, Meller J, Brines M, Behe M, Hasselblatt M et al.
Erythropoietin: a candidate compound for neuroprotection in schizophrenia.
Mol Psychiatry 2004; 9(1):42-54.
13. Yamazaki T, Kanzaki M, Kamidono S, Fujisawa M. Effect of erythropoietin on
Leydig cell is associated with the activation of Stat5 pathway. Mol Cell
Endocrinol 2004; 213(2):193-198.
14. Diamanti-Kandarakis E, Konstantinopoulos PA, Papailiou J, Kandarakis SA,
Andreopoulos A, Sykiotis GP. Erythropoietin abuse and erythropoietin gene
doping: detection strategies in the genomic era. Sports Med 2005; 35(10):831-
840.
15. Fattori E, Cappelletti M, Zampaglione I, Mennuni C, Calvaruso F, Arcuri M et
al. Gene electro-transfer of an improved erythropoietin plasmid in mice and
non-human primates. J Gene Med 2005; 7(2):228-236.
16. Arveschoug A, Christensen KS. Constitutive expression of phVEGF165 after
intramuscular gene transfer promotes collateral vessel development in
patients with critical limb ischemia. Circulation 1999; 99(22):2967-2968.
17. Gaffney GR, Parisotto R. Gene doping: a review of performance-enhancing
genetics. Pediatr Clin North Am 2007; 54(4):807-822.
18. Harridge SD, Velloso CP. Gene doping. Essays Biochem 2008; 44:125-138.
19. Tentori L, Graziani G. Doping with growth hormone/IGF-1, anabolic steroids or
erythropoietin: is there a cancer risk? Pharmacol Res 2007; 55(5):359-369.
20. Kanaley JA, Weltman JY, Veldhuis JD, Rogol AD, Hartman ML, Weltman A.
Human growth hormone response to repeated bouts of aerobic exercise. J
Appl Physiol 1997; 83(5):1756-1761.
27
21. Segura J, Gutierrez-Gallego R, Ventura R, Pascual JA, Bosch J, Such-
Sanmartin G et al. Growth hormone in sport: beyond Beijing 2008. Ther Drug
Monit 2009; 31(1):3-13.
22. Harridge SD, Velloso CP. IGF-I and GH: potential use in gene doping. Growth
Horm IGF Res 2009; 19(4):378-382.
23. McPherron AC, Lawler AM, Lee SJ. Regulation of skeletal muscle mass in
mice by a new TGF-beta superfamily member. Nature 1997; 387(6628):83-90.
24. Carnac G, Ricaud S, Vernus B, Bonnieu A. Myostatin: biology and clinical
relevance. Mini Rev Med Chem 2006; 6(7):765-770.
25. Rodgers BD, Garikipati DK. Clinical, agricultural, and evolutionary biology of
myostatin: a comparative review. Endocr Rev 2008; 29(5):513-534.
26. Mosher DS, Quignon P, Bustamante CD, Sutter NB, Mellersh CS, Parker HG
et al. A mutation in the myostatin gene increases muscle mass and enhances
racing performance in heterozygote dogs. PLoS Genet 2007; 3(5):779-786.
27. Tsuchida K. The role of myostatin and bone morphogenetic proteins in
muscular disorders. Expert Opin Biol Ther 2006; 6(2):147-154.
28. Baoutina A, Alexander IE, Rasko JE, Emslie KR. Developing strategies for
detection of gene doping. J Gene Med 2008; 10(1):3-20.
29. Lasne F, Martin L, de CJ, Larcher T, Moullier P, Chenuaud P. "Genetic
Doping" with erythropoietin cDNA in primate muscle is detectable. Mol Ther
2004; 10(3):409-410.
30. Rupert JL. Transcriptional profiling: a potential anti-doping strategy. Scand J
Med Sci Sports 2009; 19(6):753-763.
28
2. ARTIGO II
Effect of rHuEPO and erythropoietin gene transfer on reproductive parameters
and of rabbits
(Artigo científico formatado nas normas do periódico Scandinavian Journal of
Medicine & Science in Sports) (Fator de impacto 2.264)
29
Effect of rHuEpo and erythropoietin gene transfer in reproductive parameters of rabbits
T. F. Collares1; G. Urtiaga1; V. F. Campos1; P. M. M. Leon1; M. G. Amaral2; .F. K. Seixas3; T. Collares1; O. Dellagostin4; J. C. Deschamps1
1 Laboratório de Embriologia Molecular e Transgênese, Centro de Desenvolvimento Tecnológico (CDTec), Universidade Federal de Pelotas, Pelotas, RS, Brazil 2 Laboratório de Imunohistoquímica, Centro de Desenvolvimento Tecnológico (CDTec), Universidade Federal de Pelotas, Pelotas, RS, Brazil 3 Laboratório de Genômica Funcional, Centro de Desenvolvimento Tecnológico (CDTec), Universidade Federal de Pelotas, Pelotas, RS, Brazil 4 Laboratório de Biologia Molecular, Centro de Desenvolvimento Tecnológico (CDTec), Universidade Federal de Pelotas, Pelotas, RS, Brazil
*Corresponding Author
Tiago Collares
Centro de Desenvolvimento Tecnológico
Universidade Federal de Pelotas
Campus Universitário s/nº, CEP 96010-900
Caixa Postal 354, Pelotas, RS, Brazil
Phone: +55 53 3275 7588, FAX: +55 3275 7551
E-mail: [email protected]
30
Abstract
The aim of this study is to evaluate the effects of the administration of recombinant
erythropoietin (rHuEpo) and erythropoietin gene transfer in reproductive parameters
of rabbits. Fifteen rabbits were divided in 3 groups: group I (rHuEpo) received
subcutaneously 25UI/kg of recombinant human erythropoietin, three times a week for
5 weeks; group II (pTarget/Epo) received a single dose of recombinant vector with
the gene of the rabbit erythropoietin; group III (pTarget) received a single dose of
empty pTarget vector (control). Throughout the experiment, reproductive and blood
parameters were monitored, such as: sperm motility, spermatic vigor, sperm
concentration, sperm viability, sperm morphology, erythrocytes and hematocrit level.
Erythropoietin gene transfer and rHuEpo administration caused a significant increase
in the number of erythrocytes. The animals which received rHuEpo showed an
increase in the hematocrit level, reaching numbers between 41,34 and 52,32. The
statistical analysis proved that the treatment and the time did not interfer on sperm
motility, sperm concentration and spermatic vigor (P<0.05). The percentage of
morphologically normal cells in group I as well as in group II decreased over time,
however, there was no statistical difference between the treatments (P<0.05). This
study is the first to show the answers to the use of gene doping with the
erythropoietin gene and the rHuEpo administration in reproductive and blood
parameters.
Key-words: gene doping; rHuEpo; gene therapy; reproductive parameters
31
Introduction
Erythropoietin (EPO) is an essential growth factor for the red cell lineage,
controlling the survival, proliferation and differentiation of erythroid precursors.
Inadequate erythropoietin production, as observed in patients with end-stage renal
disease, results in an anemia (Lacombe and Mayeux, 1998). Genetic engineering
has enabled the production of recombinant human erythropoietin (rHuEpo) to treat
this and other diseases. Unfortunately, rHuEpo is misused by athletes to stimulate
erythropoiesis, increasing, therefore, blood oxygen capacity and endurance capacity
(Jelkmann, 2003).
In addition to this main focus of rHuEpo treatment, (Reichel and Gmeiner,
2010) described secondary benefits: increased exercise tolerance, normalization of
increased cardiac output, improved quality of life, among others. In addition, some
possible adverse effects were described, such as: hypertension, vascular access
thrombosis and pure red cell aplasia (anti-EPO antibodies). In case of doping with
rHuEpo, it is assumed that adequate medical supervision is not present during the
treatment, posing, therefore, health risk for the athletes.
One of the modern techniques of molecular biology applied to health is gene
therapy. Although, there are different definitions for the gene therapy, it is,
essentially, the manipulation of the expression of specific genes, considering the
nature of the disease. The strategies in gene therapy are designed to treat or prevent
infectious or degenerative diseases, cancer, inherited or immune system disorders
(Gatzidou et al, 2009).
As explained by Friedmann et al (2010) recently the successful development
of gene therapy has provided the concepts, tools, opportunity, and, for some, the
justification for genetic modification of functions that affect normal human aspects,
including athletic performance. The potential misuse of this type of therapy is
regarded as doping: gene doping.
Gene doping, thus, is based on the introduction and subsequent expression of
a target gene into a host. It also involves the modulation of expression of
endogenous genes. In vivo or ex vivo methods can be used for the introduction of the
target gene into the athlete's body (Azzazy et al, 2009). The World anti-Doping
Agency (WADA) prohibits this as “the non-therapeutic use of cells, genes, genetic
32
elements, or the modulation of gene expression, having the capacity to enhance
athletic performance” (Wells, 2009).
Although the means of detecting this type of doping are being widely studied,
there is still no efficient technique. The strategies used for detecting gene doping can
be direct (evidence of doping agent) or indirect (evidence of consequences of gene
doping) (McKanna and Toriello, 2010).
Many genes with potential to enhance athletic performance are available, such
as erythropoietin, insulin-like growth factor, vascular endothelial growth factor, growth
hormone and myostatin. These genes not only have the potential to improve athletic
performance of human athletes, but they can also be applied in animal sports, such
as horse racing (Haisma and Hon, 2006).
There are major current risks in gene therapy and potential gene doping, and
three brief but serious examples are: cancers, severe autoimmune reaction to the
product and reaction to the carrier virus (Sharp, 2010). Overexpression of
erythropoietin has a number of potential safety risks. Administration of Epo causes an
increase in hematocrit and this makes the blood more viscous and increases the load
on the heart. Potential consequences include blockage of the microcirculation, stroke
and heart failure (Wells, 2008).
The reflection of the use of EPO on reproductive parameters in vivo has not
yet been described. On the other hand, in vitro studies with cultured cells have shown
that erythropoietin stimulates steroidogenesis in Leydig cells, triggering an increase
in testosterone production (Yamazaki et al, 2004).
Thus, the aim of this study was to evaluate the effects of erythropoietin gene
transfer and rHuEpo administration on reproductive parameters of rabbits.
Materials and Methods
Animals and experimental design
Adult male New Zealand White rabbits weighing 4.5 to 5 kg used in all
experiments were obtained from the Central Animal Facility of the Federal University
of Pelotas (UFPel) and kept under conventional housing conditions. The animals
were housed with appropriate bedding and provided free access to drinking water
and food. Rabbits were kept in standard single cages under controlled temperature
33
and light conditions. The study protocol was approved and maintained in accordance
with the guidelines of the Ethics Committee in Animal Experimentation of the UFPel.
Fifteen rabbits were randomly divided in 3 different groups: group I (rHuEpo)
received subcutaneously 25UI/kg of recombinant human erythropoietin dissolved in
normal saline three times a week for 5 weeks; group II (pTarget/Epo) received a
single dose of recombinant vector with the gene of erythropoietin of rabbit; group III
(pTarget) received a single dose of vector pTarget empty (control). Intramuscular
DNA injection was performed essentially as previously described, but with
modifications (Maruyama et al, 2001). A total of 400 µg of plasmid DNA was injected
into the lateral sides of each lower leg (200 µg per each site). The recombinant
human erythropoietin used in experiment was the Eprex (Issy-les-Moulinaux,
France). All the groups, treatments and doses are described in Table 1.
Cloning of rabbit EPO cDNA
Two rabbits were euthanatized with sodium pentobarbital (200mg/kg), which
was injected intravenous. Subsequently, whole kidneys were resected and
immediately frozen in liquid nitrogen until their use. The total RNA was isolated with
TRIzol® Reagent (Invitrogen™, Carlsbad, USA), according to the recommended
protocol. The final RNA concentrations were determined by the QuBit® fluorometer
(Invitrogen™, Carlsbad, USA) and 2µg was used to the synthesis of first strand
cDNA performed with SuperScript™ III Reverse Transcriptase (Invitrogen™,
Carlsbad, USA) according to the manufacturer‟s protocol. Primers sets were
designed with the Primer Express v. 3.0 software (Applied Biosystems™, USA) to
amplify EPO cDNA sequences of rabbit (GenBank accession no. AF290943.1) based
on conserved EPO DNA sequence among several mammals, as follows: FOR - 5‟
ATGGGGGCGCGCGGACGC 3‟ and REV - 5‟ TCACCTGTCCCCTCTCCTGCAGGC
3‟. The PCR parameters were 35 cycles of 94°C for 1 min, 55°C for 1 min and 72°C
for 1 min, with an additional initial 15 min denaturation at 95°C and a 10 min final
extension at 72°C. PCR amplification from rabbit kidney cDNA produced a DNA
fragment of 588bp. PCR products were sequenced using a MegaBACE 1000
automatic sequencer (Amersham Biosciences, USA).
34
Plasmid vectors
The PCR products were purified with illustra GFX™ PCR DNA and Gel Band
Purification Kit (Amershan®) and then were cloned into plasmid pTARGET contained
in pTARGET™ Mamalian Expression Vector System (Promega®, USA), according to
the manufacturer′s instructions. After transformation into E. coli TOP10, colonies
grown in competent cells were picked and recombinant DNA plasmids were isolated
using the Plasmid Miniprep procedure (Sigma, USA). The colonies were screened for
correct insert direction and length with bacteria colony PCR and digestion with EcoRI.
The selected clone was sequenced by automatic sequencer. This clone was
cultivated and submitted to the DNA extraction on a large scale using the Perfectprep
Plasmid Maxi Kit (Eppendorf®, Germany).
Semen collection and evaluations
One ejaculate per male was collected each week using an artificial vagina.
The volume of fresh semen was measured in a graduated conical tube. The
percentage of motile sperm was evaluated subjectively from samples diluted 1:10 in
Ringer with sodium lactate (BASA Pharmaceutical Industry, BRA). The motility
percentage and spermatic vigor was estimated at 37°C and observed using a
microscope with phase-contrast optics at a magnification of 200x. The microscope
was connected to a video camera and the motility samples were examined by two
experienced technician. The concentration sperm was measured by a Neubauer
counting cell chamber. The sperm viability was assessed by using a Live/Dead
Sperm Viability kit (Molecular Probes, Inc.) according to the manufacturer′s
instructions. The visualization was performed with a 200x objective on a fluorescence
microscope (Olympus BX 51). One hundred spermatozoa from each sample were
counted to determine the percentage of negative and positive spermatozoa. In order
to evaluate the morphology of each sample, it was prepared smears and they were
stained with hematoxylin-eosin. Subsequently, the sperm was analyzed under a light
microscope with 200x objective, and it was observed the sperm defects, considering
the count of 100 cells. Individual spermatozoa were classified as having normal or
abnormal morphology (including head, neck, and tail defects).
35
Blood Parameters
Blood samples were collected on the first day of the experiment, before the
injections, once every week and at the end of the experiment. Blood samples (1.0 ml)
were obtained from the auricular artery. The blood count test was performed by Ary
Costa Laboratory (BRA), using the automated method ABX Micros 60 and
microscopy.
Histological analysis
The animals were sacrificed at the end of experiment through injectable
chemical method using intravenous Pentobartital in the dose of 200mg/kg. The testis
were dissected, fixed in 10% buffered formaldehyde for 24 hours, embedded in
paraffin and processed for analysis under light microscopy (LM). Later, they were
stained with hematoxylin-eosin for the detection of possible tissue injury.
Statistics
All calculations were performed using SAS statistical software (SAS Institute
Inc., Cary, NC). The experimental design used was ANOVA with split plots in time.
Analysis of variance with Tukey correction was performed for the test of average
comparison. Furthermore, we calculated the Pearson correlation coefficient among
the following variables. Statistical significance was set at P<0.05.
Results
Blood Analysis
Injection of pTarget/Epo significantly increased the levels of erythrocytes on
week 1 (P<0.05). On week 2, the hematocrit levels of pTarget/Epo rabbits lowered
and on week 3 returned to the pre-injection level (Figure. 1A – Table 4). In the
rHuEpo group, the number of erythrocytes decreased on week 1 and then increased
over time. Consequently, it is possible to observe that the rHuEpo administration
caused a significant increase in the number of erythrocytes. Group III, the control
36
group, maintained stable levels of red blood cells. This way, differences were
observed regarding time and treatments (P<0.05). Additionally, the hematocrit level
on week 1 was significantly higher in the pTarget/Epo group than in others groups
and on week 4 the rHuEpo group had the highest hematocrit level (Figure 1B – Table
5). Statistical difference was observed between the control and treatment groups.
Reproductive parameters
The statistical analysis showed that both treatments as well as time had no
effect (P<0.05) on sperm motility, sperm concentration and spermatic vigor. The
semen viability of rHuEpo rabbits decreased over time, with significant differences
starting on week 3 (P<0.05) (Table 2). The percentage of cells with normal
morphology of both rHuEpo and pTarget/Epo groups started decreasing on week 2
and showed significant difference on week 4. There was no statistical difference
between treatments (P<0.05). (Figure 2 – Table 6). Moreover, in the morphological
evaluations it was observed in rHuEpo and pTarget/epo rabbits that the middle piece
defects increased over time. However, there was a change in head defects only in
rHuEpo rabbits, observing a reduction of this abnormality over time. It was not
observed any alteration regarding defects of the tail. The Pearson correlation
coefficients between the analyzed parameters are presented in Table 3.
Histological analysis
No histological alteration was found in the analysis of the testis of rabbits. It is
possible that due to the time that the samples were collected, no pathologies were
observed, as the tissue probably had already regenerated.
Discussion
One of the most serious problems of current competitive sport is the increasing
abuse of various performance-enhancing substances. Advances in recombinant DNA
technology have created one of the most powerful weapons in the doping arsenal:
recombinant proteins (Sweeney, 2004; Unal and Ozer, 2004). Thus, with the
advances in molecular biology techniques, attention was drawn to gene therapy and
37
its misuse in sports. There are some risks in gene doping, as not only the product
and the procedures for delivery of the product carry risks, but also the uncontrolled
expression of the genes may themselves be harmful (Wells, 2008).
In our study, we analyzed the different reproductive and blood parameters to
assess the degree of impairment of reproductive potential from biological models
subjected to gene doping with erythropoietin and to administration of recombinant
erythropoietin.
In blood tests we observed significant differences in levels of hematocrit and
erythrocytes in both treatments over time (pTarget/Epo; rHuEpo), and no alterations
in the control group. Additionally, a correlation was detected between these
parameters. However, analyzing the averages among the groups, it was observed
that the averages showed significant differences between treatments and control.
A significant increase in hematocrit was observed in mice injected with more
than 100 µg of plasmid (Rizzuto et al, 1999). In other previous findings hematocrit did
not change in rats that were simply injected with 400 µg of pCAGGS-Epo without in
vivo electroporation (Maruyama et al, 2000). In our study, the levels of hematocrit
and erythrocyte in pTarget/Epo, group showed a significant increase on week 1 and
later a decrease to pre-injection levels. This suggests that there was no long-term
expression of Epo probably due to electroporation.
Previous studies have evaluated the influence of the use of rHuEpo in
reproductive parameters demonstrating that the recombinant erythropoietin
stimulates the production of testosterone in vitro (Yamazaki et al, 2004), this being
consistent with other findings. The effects of Epo on testicular functions have been
investigated. The kidney is known to be the major site of EPO production in the body,
however in a mouse model EPO synthesis occurred at the epididymis (Kobayashi et
al, 2002).
Patients with chronic renal failure developed anemia secondary due to
inefficient Epo synthesis with accompanying poor testicular functions, which are
improved by Epo treatment (Dobashi et al, 2005; Lawrence et al, 1997; Yamamoto et
al, 1997), but studies are necessary in healthy subjects.
Foresta et al (1994) reported that intravenous injection of rHuEpo improved
testicular testosterone production. These findings suggest that Epo may directly
influence human Leydig cell function. However, the increase in testosterone
synthesis, may lead to a negative feedback regarding the release of GnRH/LH and,
38
therefore, affect directly and indirectly reproductive parameters and sperm, potentially
triggering a temporary or permanent infertility.
In reproductive parameters of motility, sperm concentration and spermatic
vigor, the analysis in our study did not show significant differences after the animals
were under treatment. In the rHuEpo group, the viability of sperm decreased over
time, but there was no significant difference in relation to the control group. It was
also observed the correlation between sperm motility, concentration, vigor,
morphology and viability.
In the analysis of the morphology, despite the statistical differences in the
groups treated, there was no difference in the control group, which may indicate an
effect of the environment. According to previous reports (Kuzminsky et al, 1996) on
the abnormalities of rabbit spermatozoa, our findings are consistent with an
acceptable number of abnormal cells. In our study, there was no relation between
blood and reproductive parameters, only a weak correlation between levels of
hematocrit and erythrocyte to the number of abnormalities in the head.
Conclusion
The present study is the first to report the evaluation of reproductive and blood
responses to the use of gene doping and administration of rHuEpo. Gene transfer of
Epo significantly increased levels of red blood cells and decreased number of cells
with normal morphology. The administration of rHuEpo caused a significant increase
in number of erythrocytes and hematocrit levels and a decrease in the viability and
number of sperm cells with normal morphology. Treatments and time did not affect
the motility, concentration and spermatic vigor.
Acknowledgements
T. F. Collares, V. F. Campos and P. M. M. de Leon are students of Graduate
Program in Biotechnology at Universidade Federal de Pelotas. T. F. Collares and R.
Oliveira are supported by Brazilian CNPq and V. F. Campos and P. M. M. de Leon
are supported by CAPES. J.C. Deschamps is research fellow of CNPq. The authors
have no conflicts of interest that are directly relevant to the content of this article.
39
References
1. Azzazy HM, Mansour MM, Christenson RH. Gene doping: of mice and men. Clin Biochem 2009: 42: 435-441.
2. Dobashi M, Goda K, Maruyama H, Fujisawa M. Erythropoietin gene transfer into rat testes by in vivo electropo-ration may reduce the risk of germ cell loss caused by cryptorchidism. Asian J Androl 2005: 7: 369-373.
3. Foresta C, Mioni R, Bordon P, Miotto D, Montini G, Varotto A. Erythropoietin stimulates testosterone production in man. J Clin Endocrinol Metab 1994: 78: 753-756.
4. Friedmann T, Rabin O, Frankel MS. Ethics. Gene doping and sport. Science 2010: 327: 647-648.
5. Gatzidou E, Gatzidou G, Theocharis SE. Genetically transformed world records: a reality or in the sphere of fantasy? Med Sci Monit 2009: 15: 41-47.
6. Haisma HJ, Hon Od. Gene doping. Int J Sports Med 2006: 27: 257-266.
7. Jelkmann W. Erythropoietin. J Endocrinol Invest 2003: 26: 832-837.
8. Kobayashi T, Yanase H, Iwanaga T, Sasaki R, Nagao M. Epididymis is a novel site of erythropoietin production in mouse reproductive organs. Biochem Biophys Res Commun 2002: 296: 145-151.
9. Kuzminsky G, Fausto AM, Morera P. Morphological abnormalities of rabbit spermatozoa studied by scanning electron microscope and quantified by light microscope. Reprod Nutr Dev 1996: 36: 565-575.
10. Lacombe C, Mayeux P. Biology of erythropoietin. Haematologica 1998: 83: 724-732.
11. Lawrence IG, Price DE, Howlett TA, Harris KP, Feehally J, Walls J. Erythropoietin and sexual dysfunction. Nephrol Dial Transplant 1997: 12: 741-747.
12. Maruyama H, Sugawa M, Moriguchi Y, Imazeki I, Ishikawa Y, Ataka K, Hasegawa S, Ito Y, Higuchi N, Kazama JJ, Gejyo F, Miyazaki JI. Continuous erythropoietin delivery by muscle-targeted gene transfer using in vivo electroporation. Hum Gene Ther 2000: 11: 429-437.
13. McKanna TA, Toriello HV. Gene doping: the hype and the harm. Pediatr Clin North Am 2010: 57: 719-727.
14. Reichel C, Gmeiner G. Erythropoietin and analogs. Handb Exp Pharmacol 2010: 251-294.
15. Rizzuto G, Cappelletti M, Maione D, Savino R, Lazzaro D, Costa P, Mathiesen I, Cortese R, Ciliberto G, Laufer R, La MN, Fattori E. Efficient and
40
regulated erythropoietin production by naked DNA injection and muscle electroporation. Proc Natl Acad Sci U S A 1999: 96: 6417-6422.
16. Sharp NC. The human genome and sport, including epigenetics, gene doping, and athleticogenomics. Endocrinol Metab Clin North Am 2010: 39: 201-215.
17. Sweeney HL. Gene doping. Sci Am 2004: 291: 62-69.
18. Unal M, Ozer UD. Gene doping in sports. Sports Med 2004: 34: 357-362.
19. Wells DJ. Gene doping: the hype and the reality. Br J Pharmacol 2008: 154: 623-631.
20. Wells DJ. Gene doping: possibilities and practicalities. Med Sport Sci 2009: 54: 166-175.
21. Yamamoto Y, Sofikitis N, Miyagawa I. Effects of erythropoietin, bromocryptine and hydralazine on testicular function in rats with chronic renal failure. Andrologia 1997: 29: 141-144.
22. Yamazaki T, Kanzaki M, Kamidono S, Fujisawa M. Effect of erythropoietin on Leydig cell is associated with the activation of Stat5 pathway. Mol Cell Endocrinol 2004: 213: 193-198.
41
Table 1. Scheme of inoculations, dosages and routes of administration in different
groups of the experiment.
Groups Animals Dose Route of
administration
rHuEpo 5 75 UI/Kg/week subcutaneous
pTarget/Epo 5 1x400 µg intramuscular
pTarget (Control) 5 1x400 µg intramuscular
42
Table 2: Average of sperm viability (%) rabbits subjected to different treatments in
terms of time
Groups 0 1 2 3 4 5
pTarget/EPO 92.20Aab
89.60Aa
89.40Aa
79.60Aa
82.00Aa
80.00Aa
rHuEPO 93.00Aa
91.50Aa
83.40ABa
72.60ABa
74.40ABa
69.20Ba
Control 74.75Ab
69.50Ab
73.25Aa
72.25Aa
81.67Aa
69.00Aa
Means followed by same capital letters horizontally are not statistically different from each other.
Means followed by same lowercase letters vertically were not statistically different from each other
P<0.05
43
Table 3. Pearson correlation coefficients among tested variables
MOT VIGOR CONC VIAB NORM HEAD P.I. TAIL ERY
VIGOR 0,68** - - - - - - - -
CONC 0,25* 0,03** - - - - - - -
VIAB 0,48** 0,40** 0,23* - - - - - -
NORM 0,21* 0,27* 0,12 0,57** - - - - -
HEAD -0,09 -0,10 -0,19 -0,32** -0,39** - - - -
P.I. 0,00 -0,03 -0,16 -0,02 0,04 0,72** - - -
TAIL -0,12 -0,23* 0,03 -0,34** -0,86** 0,30** -0,08 - -
ERYT 0,10 0,04 -0,14 -0,13 -0,20 -0,16 -0,21* 0,05 -
HEM 0,19 0,10 -0,05 -0,09 -0,21* -0,18 -0,24* 0,13 0,92**
MOT: sperm motility; VIGOR: spermatic vigor; CONC: sperm concentration, VIAB: viable sperm;
NORM: normal sperm; HEAD: abnormalities in the head; PI: abnormalities in the middle piece; TAIL:
abnormalities in the tail; ERYT: number of erythrocytes; HEM: hematocrit level - ** P<0,01; * P<0,05
44
Figure 1. Time-course of blood parameters after pTarget/Epo transfer and
administration of rHuEpo in rabbits. A) Number of erythrocytes B) Hematocrit levels
A)
5
5,5
6
6,5
7
7,5
8
0 2 4 6
Eryt
hro
cyte
s (m
illio
n/m
m³)
Weeks
pTarget/Epo
rHuEPO
pTarget
Table 4: Average number of erythrocytes (millions/mm3) rabbits subjected to different treatments in terms of time.
Groups 1 2 3 4 5 6
pTarget/EPO 6,48BCa
7,08Aa
6,61ABa
5,99Cb
6,30BCb
6,55Bb
rHuEPO 6,44CDa
6,31Db
6,86BCa
6,93BCa
7,23Ba
7,80Aa
Control 6,63Aa
6,61Ab
6,61Aa
6,25Ab
6,42Ab
6,45Ab
Means followed by same capital letters horizontally are not statistically different from each other.
Means followed by same lowercase letters vertically were not statistically different from each other.
P<0.05
45
B)
35
37
39
41
43
45
47
49
51
53
55
0 2 4 6
Hem
ato
crit
(%)
Weeks
pTarget/Epo
rHuEPO
pTarget
Table 5: Average of hematocrit levels (%) rabbits subjected to different treatments in
terms of time.
Groups 1 2 3 4 5 6
pTarget/EPO 42,62Ba
47,16Aa
42,94Bab
39,02Cb
41,54BCb
42,88Bb
rHuEPO 41,34Da
41,04Db
44,20CDa
45,76BCa
48,38Ba
52,32Aa
Control 42,20Aa
42,18Ab
41,23Ab
39,98Ab
41,30Ab
40,80Ab
Means followed by same capital letters horizontally are not statistically different from each other.
Means followed by same lowercase letters vertically were not statistically different from each other.
P<0.05
46
Figure 2. Time-course of sperm cells with normal morphology after pTarget/Epo
transfer and administration of rHuEpo in rabbits.
35,00
45,00
55,00
65,00
75,00
85,00
95,00
0 2 4 6
No
rmal
mo
rph
olo
gy (%
)
Weeks
pTarget/Epo
rHuEPO
pTarget
Table 6: Average of normal sperm cell rabbits (%) subjected to different treatments in
terms of time.
Groups 0 1 2 3 4 5
pTarget/EPO 87.40Aa
77.00ABa
75.20ABa
61.20Ba
59.80Ba
62.00Ba
rHuEPO 81.40Aa
68.25ABa
64.80ABa
52.60Ba
48.80Ba
51.60Ba
Control 72.75Aa
67.00Aa
65.00Aa
63.50Aa
67.67Aa
49.75Aa
Means followed by same capital letters horizontally are not statistically different from each other.
Means followed by same lowercase letters vertically were not statistically different from each other.
P<0.05
47
Figure 3. Time-course of number of sperm cells with abnormal morphology in middle
piece after pTarget/Epo transfer and administration of rHuEpo in rabbits.
5
10
15
20
25
30
35
40
45
0 1 2 3 4 5
Spe
rm c
ell
s w
ith
ab
no
rmal
itie
s in
PI
Weeks
pTarget/Epo
rHuEpo
pTarget
Table 7: Average of abnormalities in the middle piece of sperm cells rabbits
subjected to different treatments in terms of time.
Groups 0 1 2 3 4 5
pTarget/EPO 8.40Ba
19.60ABa
20.40ABa
34.40Aa
35.60Aa
29.20ABa
rHuEPO 15.00Ba
20.25ABa
25.80ABa
36.80ABa
41.80Aa
35.20ABa
Control 17.25Aa
26.50Aa
27.25Aa
29.50Aa
28.00Aa
32.50Aa
Means followed by same capital letters horizontally are not statistically different from each other.
Means followed by same lowercase letters vertically were not statistically different from each other.
P<0.05
48
3. CONCLUSÃO
Este é o primeiro estudo que avaliou as respostas reprodutivas e sanguíneas
com o uso do doping genético e administração de rHuEpo. A transferência gênica
da Epo aumentou significativamente os níveis de eritrócitos e diminuiu o número de
células com morfologia normal. A administração da rHuEpo causou um aumento
significativo no número de eritrócitos e do hematócrito e uma diminuição na
viabilidade e no número de células espermáticas com morfologia normal. Os
tratamentos e o tempo não interferiram na motilidade, concentração e vigor.
49
4. REFERÊNCIAS
ASHENDEN,M; VARLET-MARIE,E; LASNE,F; AUDRAN,M. The effects of microdose
recombinant human erythropoietin regimens in athletes. Haematologica, v.91, n.8,
p.1143-1144, 2006.
AZZAZY,HM; MANSOUR,MM; CHRISTENSON,RH. Doping in the recombinant era:
strategies and counterstrategies. Clinical Biochemistry, v.38, n.11, p.959-965,
2005.
BAOUTINA,A; ALEXANDER,IE; RASKO,JE; EMSLIE,KR. Potential use of gene
transfer in athletic performance enhancement. Molecular Therapy, v.15, n.10,
p.1751-1766, 2007.
BAOUTINA,A; ALEXANDER,IE; RASKO,JE; EMSLIE,KR. Developing strategies for
detection of gene doping. The Journal of Gene Medicine, v.10, n.1, p.3-20, 2008.
BARTON-DAVIS,ER; SHOTURMA,DI; MUSARO,A; ROSENTHAL,N; SWEENEY,HL.
Viral mediated expression of insulin-like growth factor I blocks the aging-related loss
of skeletal muscle function. Proceedings of the National Academy of Sciences,
v.95, n.26, p.15603-15607, 1998.
CAZZOLA,M. A global strategy for prevention and detection of blood doping with
erythropoietin and related drugs. Haematologica, v.85, n.6, p.561-563, 2000.
CHENUAUD,P; LARCHER,T; RABINOWITZ,JE; PROVOST,N; CHEREL,Y;
CASADEVALL,N; SAMULSKI,RJ; MOULLIER,P. Autoimmune anemia in macaques
following erythropoietin gene therapy. Blood, v.103, n.9, p.3303-3304, 2004.
DEFRANCESCO,L. The faking of champions. Nature Biotechnology, v.22, n.9,
p.1069-1071, 2004.
50
DIAMANTI-KANDARAKIS,E; KONSTANTINOPOULOS,PA; PAPAILIOU,J;
KANDARAKIS,SA; ANDREOPOULOS,A; SYKIOTIS,GP. Erythropoietin abuse and
erythropoietin gene doping: detection strategies in the genomic era. Sports
Medicine, v.35, n.10, p.831-840, 2005.
GAFFNEY,GR; PARISOTTO,R. Gene doping: a review of performance-enhancing
genetics. Pediatric Clinics of North America, v.54, n.4, p.807-822, 2007.
GUAN,F; UBOH,CE; SOMA,LR; BIRKS,E; CHEN,J; MITCHELL,J; YOU,Y; RUDY,J;
XU,F; LI,X; MBUY,G. LC-MS/MS method for confirmation of recombinant human
erythropoietin and darbepoetin alpha in equine plasma. Analytical Chemistry, v.79,
n.12, p.4627-4635, 2007.
HAISMA,HJ; HON,OD. Gene doping. International Journal of Sports Medicine,
v.27, n.4, p.257-266, 2006.
LANGSTON,CE; REINE,NJ; KITTRELL,D. The use of erythropoietin. Veterinary
Clinics of North America: Small Animal Practice, v.33, n.6, p.1245-1260, 2003.
LASNE,F; MARTIN,L; DE,CJ; LARCHER,T; MOULLIER,P; CHENUAUD,P. "Genetic
Doping" with erythropoietin cDNA in primate muscle is detectable. Molecular
Therapy, v.10, n.3, p.409-410, 2004.
MCKANNA,TA; TORIELLO,HV. Gene doping: the hype and the harm. Pediatric
Clinics of North America, v.57, n.3, p.719-727, 2010.
PASCUAL,JA; BELALCAZAR,V; DE,BC; GUTIERREZ,R; LLOP,E; SEGURA,J.
Recombinant erythropoietin and analogues: a challenge for doping control.
Therapeutic Drug Monitoring, v.26, n.2, p.175-179, 2004.
SHARPE,K; HOPKINS,W; EMSLIE,KR; HOWE,C; TROUT,GJ; KAZLAUSKAS,R;
ASHENDEN,MJ; GORE,CJ; PARISOTTO,R; HAHN,AG. Development of reference
ranges in elite athletes for markers of altered erythropoiesis. Haematologica, v.87,
n.12, p.1248-1257, 2002.
UNAL,M; OZER,UD. Gene doping in sports. Sports Medicine, v.34, n.6, p.357-362,
2004.
51
VARLET-MARIE,E; AUDRAN,M; LEJEUNE,M; BONAFOUX,B; SICART,MT;
MARTI,J; PIQUEMAL,D; COMMES,T. Analysis of human reticulocyte genes reveals
altered erythropoiesis: potential use to detect recombinant human erythropoietin
doping. Haematologica, v.89, n.8, p.991-997, 2004.
YAMAZAKI,T; KANZAKI,M; KAMIDONO,S; FUJISAWA,M. Effect of erythropoietin on
Leydig cell is associated with the activation of Stat5 pathway. Molecular and
Cellular Endocrinology, v.213, n.2, p.193-198, 2004.