UNIVERSIDADE ESTADUAL DE SANTA CRUZ

PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA E

BIOLOGIA MOLECULAR

Avaliação das alterações fisiológicas e metabólicas de plantas

cítricas submetidas ao déficit hídrico

DAYSE DRIELLY SOUZA SANTANA VIEIRA

ILHÉUS-BAHIA-BRASIL

Fevereiro de 2016

DAYSE DRIELLY SOUZA SANTANA VIEIRA

Avaliação das alterações fisiológicas e metabólicas de plantas

cítricas submetidas ao déficit hídrico

Tese apresentada à Universidade

Estadual de Santa Cruz como parte das

exigências para a obtenção do título de

Doutora em Genética e Biologia Molecular.

Área de Concentração: Genética e

Melhoramento Vegetal

Orientador: Dr. Abelmon da Silva

Gesteira

ILHÉUS-BAHIA-BRASIL

Fevereiro de 2016

V658 Vieira, Dayse Drielly Souza Santana. Avaliação das alterações fisiológicas e metabólicas de plantas cítricas submetidas ao déficit hídrico / Dayse Drielly Souza Santana Vieira. – Ilhéus, BA: UESC, 2016. xi, 103 f. : il. Orientador: Abelmon da Silva Gesteira. Tese (doutorado) – Universidade Estadual de Santa

Cruz. Programa de Pós-graduação em Genética e Biologia Molecular.

Inclui referências.

1. Cítricos. 2. Porta-enxertos. 3. Stress (Fisiologia). 4. Frutas cítricas – Condições hídricas. 5. Frutas cítricas – Doenças e pragas. 6. Secas. I. Título.

CDD 634.3

DAYSE DRIELLY SOUZA SANTANA VIEIRA

AVALIAÇÃO DAS ALTERAÇÕES FISIOLÓGICAS E

METABÓLICAS DE PLANTAS CÍTRICAS SUBMETIDAS AO

DÉFICIT HÍDRICO

Tese apresentada à Universidade

Estadual de Santa Cruz como parte das

exigências para a obtenção do título de

Doutora em Genética e Biologia Molecular.

Área de Concentração: Genética e

Melhoramento Vegetal

APROVADA: Ilhéus - Bahia, 25 de fevereiro de 2016.

__________________________________ _______________________________

Dr. Alfredo Augusto Cunha Alves Drª. Bruna Carmo Rehem (Embrapa CNPMF) (IFBA)

__________________________________ _______________________________

Drª. Fabienne Florence L. Micheli Drª. Virgínia Lúcia Fontes Soares (CIRAD - UESC) (UESC)

_______________________________

Dr. Abelmon da Silva Gesteira (Embrapa CNPMF - Orientador)

ii

À minha amada e

abençoada família, pelo amor

e apoio incondicional.

OFEREÇO

Aos meus pais, Sidelma e

Sérgio, e ao meu marido Jonathan.

DEDICO

iii

AGRADECIMENTOS

À DEUS, pela vida, oportunidades, inspiração e força interior.

À Universidade Estadual de Santa Cruz (UESC), em especial ao Programa

de Pós-Graduação em Genética e Biologia Molecular (PPGGBM), pela

oportunidade.

À Coordenação de Aperfeiçoamento de Pessoal de Nível Superior

(CAPES), pela bolsa.

Ao programa Ciência sem Fronteira (CAPES), pela oportunidade e bolsa

do doutorado sanduíche.

Ao meu DEZorientador, Dr. Abelmon da Silva Gesteira, pelo apoio,

confiança, orientação e amizade.

A todos os membros da “família Gesteira” pela ajuda, apoio, abrigo em

Cruz das Almas e amizade, especialmente para Diana Matos, Lucas da Hora,

Diogo Moraes, Liziane Marques, Maria Santos e Naiara Almeira.

A toda a equipe da Embrapa Mandioca e Fruticultura, especialmente ao

Dr. Maurício Coelho pela ajuda na montagem e condução do experimento. Além

disso, gostaria de agradecer a todos os técnicos de campo e de laboratório,

representados aqui por Sr. Santana, Sr. Raimundo, Mabel e Andressa, por toda

ajuda.

Ao grupo do Istituto per la Protezione Sostenibile delle Piante

(CNR/Florença-Itália) e do Instituto Valenciano de Investigaciones Agrarias

(Valencia – Espanha), em especial a Drª Biancaelena Maserti e ao Dr. Raphael

Morillon, pela recepção, atenção e orientação.

Aos amigos “recebidos” no doutorado sanduíche, aqui representados por

minha família italiana - Família Claps -, a Fabiana Zanelato e família, Valdir

Mano, Eliana Tassi, Aansa Rukya, Alireza Khaleghi e Wafa.

iv

A todo o grupo do Laboratório de Fisiologia do Desenvolvimento Vegetal

(IB/USP), de forma especial ao Dr. Luciano Freschi e a Aline Bertinatto Cruz,

pela recepção, atenção e ajuda.

À Fabrícia, Mara e Kátia pela eficiência e carinho no atendimento da

secretaria do PPGGBM.

À minha amada, abençoada e grande família, pelo amor, confiança e

exemplo de vida.

Aos meus pais, Sidelma e Sérgio, por todo amor e dedicação, pela minha

educação, pelos “puxões de orelha” e por serem meus maiores exemplos!

Ao meu marido Jonathan Vieira, pelo amor, cuidado, apoio, incentivo e

compreensão. E ao meu filho cachorro, o Buddy, pelo amor e carinho, além da

companhia nas madrugadas!

A todos os meus amigos de vida, especialmente para Marília, Matheus,

Aurizangela, Ícaro, Daniela e a família “caminho de casa” - Manu, Keu, Josi e

Louise -, pela verdadeira amizade.

Aos professores, familiares e amigos que contribuíram direta ou

indiretamente para a minha formação profissional e pessoal.

v

“Quem decidir se colocar como juiz da Verdade e do

Conhecimento será naufragado pela gargalhada dos deuses.”

Albert Einstein

vi

ÍNDICE

EXTRATO ........................................................................................................... vii

ABSTRACT .......................................................................................................... ix

LISTA DE FIGURAS .......................................................................................... xi

1. INTRODUÇÃO ................................................................................................ 12

1.1 Objetivos ......................................................................................................... 14

1.1.1 Geral .............................................................................................................. 14

1.1.2 Específicos .................................................................................................... 14

2. REVISÃO DE LITERATURA ....................................................................... 16

2.1 A citricultura .................................................................................................. 16

2.2 Interação copa/porta-enxerto ........................................................................ 18

2.3 Déficit hídrico ................................................................................................. 21

2.3.1 Estratégias de sobrevivência ......................................................................... 23

2.3.2 Hormônios vegetais.......................................................................................24

2.3.3 Carboidratos..................................................................................................26

2.3.4 Compostos orgânicos voláteis.......................................................................27

CAPÍTULO 1: Polyploidization alters constitutive emission of volatile organic compounds (VOC) and improves membrane stability under water deficit in Volkamer lemon (Citrus limonia Osb.) leaves. .................................. 29

CAPÍTULO 2: Survival strategies of citrus rootstocks subjected to drought.47

3. CONCLUSÕES GERAIS ................................................................................ 95

4. REFERÊNCIAS ............................................................................................... 96

vii

EXTRATO

SANTANA-VIEIRA, Dayse Drielly Souza, Universidade Estadual de Santa Cruz,

Ilhéus, Fevereiro de 2016. Avaliação das alterações fisiológicas e metabólicas de

plantas cítricas submetidas ao déficit hídrico. Orientador: Abelmon da Silva

Gesteira.

A produção de citros possui grande importância na economia mundial e

brasileira. Entretanto, as plantas cítricas estão sujeitas a uma série de estresses bióticos e abióticos que são os principais limitantes da produção. Para suportar o período de estresse, as plantas desenvolvem diversos mecanismos em nível fisiológico, molecular e metabólico. Dentre os estresses abióticos, uma atenção especial tem sido dada ao déficit hídrico, especialmente devido às modificações nos regimes de chuvas das regiões produtoras, bem como das possíveis alterações climáticas previstas para os próximos anos. Aliado a isto, a citricultura é cultivada pelo método da enxertia, em que duas plantas são unidas para constituir uma única. O porta-enxerto, que é o responsável pelo desenvolvimento do sistema radicular, é de suma importância para a tolerância às intempéries ambientais. Alguns estudos relatam que plantas poliploides, que podem ocorrer naturalmente em citros, possuem melhor adaptação as alterações do ambiente. Nesse contexto, trabalhos que identifiquem e/ou caracterizem o comportamento dessas plantas, especialmente os porta-enxertos, sob estresse por seca, são de suma importância na busca de genótipos mais tolerantes, que podem ser diretamente aplicados à agricultura. Dessa forma, o objetivo do presente trabalho foi avaliar o comportamento fisiológico e metabólico de porta-enxertos de citros, enxertados ou não enxertados, visando à identificação dos mecanismos desenvolvidos e dos genótipos mais tolerantes, além de avaliar qual a estratégia de sobrevivência adotada durante o déficit. Na tentativa de contribuir e/ou elucidar estas questões, dois experimentos independentes foram desenvolvidos: i) avaliar as trocas gasosas, além do perfil de compostos orgânicos voláteis (VOCs) e da expressão de genes nos porta-enxertos Limão Volkameriano diploide (2xVL) e tetraploide (4xVL) submetidos ao déficit hídrico; e ii) avaliar as trocas gasosas, bem como os perfis dos açúcares e hormônios, dos porta-enxertos Limoeiro Cravo ‘Santa Cruz’

(RL) e Tangerineira Sunki ‘Maravilha’ (SM) em condição não-enxertada (RL e SM), com combinações inversas (SM/RL e RL/SM), além de combinações com duas copas comerciais Laranjeira Valencia (VO – VO/RL e VO/SM) e Lima ácida

viii

Tahiti (TAL – TAL/RL e TAL/SM), também submetidos ao déficit hídrico. Como principais resultados do primeiro experimento, foi constatado que o nível de ploidia das plantas - 2xVL e 4xVL – pode alterar a emissão constitutiva de VOCs, fator importante no desenvolvimento de tolerância ao estresse. Além disso, apesar de não ser constatado diferenças significativas no comportamento fisiológico de 2xVL e 4xVL sob déficit hídrico, as plantas 4xVL demonstraram possuir membranas mais resistentes ao estresse. Já no segundo experimento, foi possível observar que os porta-enxertos RL e SM desenvolvem estratégias diferentes de sobrevivência ao déficit hídrico, sendo ‘evitar a desidratação’ e ‘tolerar a desidratação’, respectivamente. Além disso, o porta-enxerto SM, quando comparado ao RL, apresentou maiores valores de rafinose e trealose, bem como de ABA e SA, na situação de déficit hídrico severo, sendo que tais resultados demonstram que o SM possue um sistema de proteção mais eficiente que o desenvolvido por RL, justificando assim a estratégia adotada por este. Além disso, foi observado que o SM foi capaz de induzir nas copas enxertadas um comportamento semelhante ao desenvolvido por ele quando não exertado. Estes resultados sugerem que, em um estresse prolongado, como os previstos para os próximos anos, as plantas enxertadas em RL podem chegar primeiro ao ponto de murcha permanente que as em SM.

Palavras-chave: citros, estresse abiótico, seca, porta-enxerto, tolerância

ix

ABSTRACT

SANTANA-VIEIRA, Dayse Drielly Souza, Universidade Estadual de Santa Cruz,

Ilhéus, Fevereiro de 2016. Evaluation of physiological and metabolic changes of

citrus plants submitted to drought stress. Supervisor: Abelmon da Silva Gesteira.

The citrus production have been great importance in the world and the Brazilian economy. However, citrus plants are subject to a variety of biotic and abiotic stresses which are the major factor limiting production. To withstand the stress period, the plants developed several mechanisms to physiological, metabolic and molecular levels. Among the abiotic stresses, special attention has been given to water stress, especially due to changes in rainfall regimes in the producing regions as well as the possible climate change expected for the next years. Allied to this, the citrus industry is grown by the method of grafting, in which two plants are joined to form a single. The rootstock, which is responsible for the development of the root system, is of paramount importance for tolerance to environmental weathering. Some studies report that polyploid plants, which may occur naturally in citrus, have better adaptation to environmental changes. In this context, work to identify and / or characterize the behavior of these plants, especially rootstocks, under drought stress, are extremely importance to identify the most tolerant genotypes that can be directly applied to agriculture. Thus, the objective of this study was to evaluate the physiological and metabolic behavior of citrus rootstocks, grafted or not grafted, aiming at the identifying the mechanisms developed and more tolerant genotypes and to evaluate which survival strategy adopted during the deficit. In an attempt to contribute and / or clarify these issues, two independent experiments were developed: i) evaluate the physiological behavior and the volatile profile (VOCs) of rootstock Lemon Volkameriano diploid (2xVL) and tetraploid (4xVL) submitted to water deficit ; and ii) assess physiologically as well as the profiles of sugars and hormones, rootstock Limoeiro Cravo 'Santa Cruz' (RL) and Sunki 'mandarin Wonder' (SM) in non-grafted condition (RL and SM), with inverse combinations (SM / RL and RL / SM), as well as combinations of two commercial tops Orange Valencia (VO - VO / RL and PO / SM) and acid Lima Tahiti (TAL - TAL / RL and TAL / SM), also submitted to deficit. The main results of the first experiment, it was found that the ploidy level of plants - 2xVL and 4xVL - can change the constitutive emission of VOCs, an important factor in the development of tolerance to stress. Further,

x

although not found significant differences in physiological and behavioral for 2xVL and 4xVL plants under drought, the 4xVL plants were found to have more resistant to stress membranes. In the second experiment, it was observed that the rootstocks RL and SM develop survival strategies to different water deficit, and 'avoid dehydration' and 'tolerate dehydration', adopted by them respectively. Furthermore, the rootstock SM when compared to RL, showed higher raffinose and trehalose values, as well as ABA and SA during the severe drought, and these results show that SM had a more efficient protection system than RL, thus justifying the strategy adopted by him. Furthermore, it was observed that the SM was able to induce the scions grafted behavior similar to that developed by him when ungrafted. These results suggest that in a prolonged stress, as envisaged for the coming years, the plants grafted on RL can arrive first at the permanent wilting point than SM. Key words: citros, abiotic estress, drought, rootstock, tolerance

xi

LISTA DE FIGURAS

Figura 1. Ilustração de algumas das principais maneiras em que os porta-enxertos

podem afetar a água nas copas, bem como suas relações e crescimento. Adaptado

de Hamlyn Jones, 2012 (How do rootstocks control shoot water relations? /New

Phytlogist).. ............................................................................................................ 19

Figura 2. Efeitos primários e secundários em plantas causadas pelo déficit

hídrico. Adaptado de Taiz e Zeiger, 2013.. ............................................................ 22

Figura 3. Balanço entre a tolerância ao estresse e manutenção do crescimento.

Adaptado de Claeys e Inzé, 2013.. ......................................................................... 24

12

1. INTRODUÇÃO

A produção de citros gera um grande volume de receita, possuindo assim

ampla importância mundial. Nesse contexto, o Brasil se destaca como o segundo

maior produtor, ficando atrás apenas da China, que produz, essencialmente,

tangerina (Franck Curk, 2014). A laranja é a fruta mais produzida no território

nacional, sendo considerada uma commodity bastante expressiva no Produto

Interno Bruto (PIB), e tendo relevância na geração de emprego e renda (Neves et

al., 2010; Neves e Jank, 2006). A produção brasileira de laranja representa cerca

de 30% da safra mundial da fruta (MAPA-Citros, 2016), e valores próximos a

98% da laranja nacional é exportada em forma de suco concentrado para países

como EUA, União Europeia, Japão e China (Lohbauer, 2011). Essa produção

corresponde a cerca de 60% da produção mundial de suco (MAPA-Citros, 2016).

A safra brasileira de laranja 2015/2016 tem previsão de atingir 410

milhões de caixas de 40,8kg cada, representando um aumento de 10 milhões de

caixas, relativa à safra anterior (2014/2015) (Canal Rural, 2016; Revista Globo

Rural, 2016). Este aumento da safra se deve, especialmente, ao volume de chuva

satisfatório no ano de 2015. Entretanto, apesar da expressividade da produção

brasileira, problemas ocasionados por estresses bióticos e abióticos estão

ameaçando a produtividade (Neves e Jank, 2006). Dentre estes problemas podem

ser citados o avanço do greening (Huanglongbing/HLB), causada pelas bacterias

Candidatus Liberibacter asiaticus e Candidatus Liberibacter americanus, que são

transmitidas para as plantas de citros pelo psilídeo Diaphorina citri. O HLB é uma

das doenças mais graves que vem atingindo a cadeia citrícola brasileira desde

2004 (Fundecitrus, 2016). Além desse fator, as alterações climáticas,

13

especialmente o déficit hídrico – compreendendo os períodos de seca prolongados

na época da floração e/ou enchimento dos frutos – preocupam os produtores.

As plantas cítricas precisam de umidade no solo durante praticamente todo

o ano (de 600 a 1300 mm anuais) para que tenham um bom crescimento e uma

boa produção, mantendo assim os níveis de produtividade comercial (Vieira,

1991; Sentelhas et al., 2005). Na grande parte das regiões de produção do Brasil, a

exemplo dos estados de São Paulo, Minas Gerais, Bahia e Paraná, existe um

volume de chuvas adequado a produção, contudo a distribuição pluviométrica é

irregular. Nesse contexto, os períodos prolongados de estiagem prejudicam o

desenvolvimento da cultura, levando a reduções de produção entre 30 a 40%,

como o observado no ano de 2007 (Viana e Braga, 2007). A irrigação é uma

alternativa para mitigar este problema, além de proporcionar um aumento de

produção entre 35 a 75% quando comparado ao não irrigado (Coelho et al, 2004).

Porém, a irrigação possui alto custo de implantação, manutenção e operação

(custos com água e energia), o que interfere na adoção da tecnologia pelos

produtores. Outra alternativa, que por sua vez pode ter um menor custo ao

produtor, é a utilização de variedades que suportem melhor os períodos de

estiagem prolongados, e que também apresentem uma boa capacidade de

recuperação após as primeiras chuvas.

Durante o período de estiagem, as plantas apresentam diversas alterações

em níveis fisiológicos, moleculares e metabólicos, objetivando sobreviver ao

estresse por déficit hídrico (Verslues et al, 2006; Taiz e Zeiger, 2013). Dentre as

modificações apresentadas pelas plantas, pode-se citar a alteração nas trocas

gasosas, como a redução dos valores de condutância estomática (gs), resultando

na diminuição das taxas fotossintéticas (A) e de transpiração (E); além de

diferentes padrões de expressão gênica, bem como na emissão e produção de

compostos voláteis (VOCs), e nos conteúdos de hormônios, açucares e prolina. Os

Citros apresentam uma alta diversidade genética (Fang e Roose, 1997),

abrangendo laranjas (Citrus sinensis), tangerinas (Citrus reticulata e Citrus

deliciosa), limões (Citrus limon), limas ácidas como o Tahiti (Citrus latifolia) e o

Galego (Citrus aurantiifolia), e doces como a lima da Pérsia (Citrus limettioides),

o pomelo (Citrus paradisi), a cidra (Citrus medica), a laranja-azeda (Citrus

aurantium) e as toranjas (Citrus grandis) (Mattos Junior et al., 2005). Além disso,

14

as plantas cítricas possuem uma porcentagem, que gira em torno de 7%, de

formação de plantas poliploides naturais (Barrett e Hutchinson, 1982; Saleh et al.,

2008), incrementando assim a sua diversidade. A composição genética das plantas

pode vir a determinar a sua maior ou menor tolerância ao estresse, bem como qual

será a estratégia de sobrevivência que esta adotará. De forma geral, as plantas

podem adotar a estratégia de evitar a desidratação - objetivando a diminuição da

perda de água, e mantendo a produção; ou a estratégia de tolerar a desidratação -

onde adotam mecanismos para evitar os danos causados pelo estresse na planta, e

reduzem a produção, na tentativa de sobreviver ao estresse (Verslues, 2006). Com

base no exposto, o objetivo do presente trabalho é entender o comportamento

fisiológico e metabólico de plantas cítricas expostas a condição de estresse hídrico

por falta de água, visando identificar genótipos mais tolerantes, bem como obter

um melhor entendimento da tolerância ao estresse hídrico.

1.1 Objetivos

1.1.1 Geral

Avaliar as possíveis modificações fisiológicas e metabólicas promovidas

pelo déficit hídrico em plantas de citros.

1.1.2 Específicos

· Cap. I – Projeto Doutorado Sanduíche (Itália/Espanha)

o Analisar as trocas gasosas do Limão Volkameriano diploide (V2X)

e tetraploide (V4X) sujeito ao déficit hídrico;

o Diferenciar o perfil de compostos voláteis (VOCs) produzidos em

situação de controle, estresse hídrico severo e reidratação com 24h

em folhas de V2X e V4X;

15

o Identificar as diferenças entre V2X e V4X nas três situações

supracitadas referente ao conteúdo de prolina e melondialdeído

(MDA);

o Avaliar a expressão gênica de genes importantes na tolerância ao

déficit hídrico nas plantas de V2X e V4X.

· Cap. II – Projeto Brasil

o Analisar as trocas gasosas e os potenciais hídrico foliar, osmótico e

matricial dos porta-enxertos Sunki Maravilha (SM) e Limão Cravo

Santa Cruz (RL), bem como em suas combinações invertidas

(SM/RL e RL/SM), além desses com duas copas comerciais

Laranjeira Valencia (VO) e Lima ácida Tahiti (TAL), em três

situações: controle, déficit hídrico severo e reidratado com 48h;

o Avaliar as alterações nos perfis de hormônios e açucares nas oito

combinações supracitadas;

o Identificar qual a estratégia de sobrevivência adotada pelos porta-

enxertos em estudo.

16

2. REVISÃO DE LITERATURA

2.1 A citricultura no Brasil

A laranja foi introduzida no Brasil por volta de 1540 pelos portugueses,

com sementes provenientes da Espanha (Lima, 2014). As primeiras plantas foram

cultivadas em Salvador – Bahia, onde através de uma mutação natural da

variedade ‘Seleta’, surgiu à variedade ‘Bahia’. Posteriormente, a laranja foi

propagada nos estados de São Paulo e Rio de Janeiro, e em decorrência das

condições climáticas favoráveis para o desenvolvimento das frutas e a

aglomeração de pessoas nesses estados, formou-se o núcleo citrícola do país

(Donadio et al., 2005).

Entretanto, o grande marco do desenvolvimento de citros no Brasil se deu

na década de 60, quando ocorreu a queda na produção de laranja nos Estados

Unidos da América (EUA) - principal produtor na época - dando espaço para o

surgimento de um novo produtor. Além disso, nessa mesma época, empresas

extratoras de suco começaram a se instalar na região de São Paulo, bem como

incentivos governamentais para produção de laranja e suco concentrado foram

desenvolvidos, formando assim o cinturão citrícola do país (Paullilo, 2006). Pode-

se dizer que o cultivo de laranja no Brasil se divide em dois períodos distintos: de

1990 a 1999 - que se caracteriza pelo aumento da produção e conquista da posição

de líder do setor; e a partir de 1999 até os dias atuais – onde ocorreu a

consolidação da capacidade e desempenho produtivo. O Ministério da Agricultura

17

e Pecúaria (MAPA), objetivando manter a liderança do setor, no que diz respeito à

produção de laranja e suco concentrado, vêm investindo no apoio a adoção de

sistemas mais eficientes, como a produção integrada, com medidas para reduzir os

custos, e aperfeiçoar e ampliar a comercialização do produto (MAPA, 2016).

Associado aos incentivos do governo e em decorrência do aumento da

produção e a percepção de que a atividade citrícola era lucrativa, campos

experimentais começaram a ser montados, dando suporte aos produtores

brasileiros, que seguiam os padrões de produção dos EUA, não adequados ao

clima e solo local (Donadio et al., 2005). Desde então, a citricultura nacional

evoluiu bastante, tanto pelo interesse dos produtores, quanto pelo incentivo e

desenvolvimento científico. Nesse contexto, surgiu em 1988 o Programa de

Melhoramento Genético de Citrus na Embrapa Mandioca e Fruticultura

(CNPMF), localizada no município de Cruz das Almas – BA. Como suporte para

desenvolvimento das pesquisas, a instituição conserva um Banco Ativo de

Germoplasma (BAG) com mais de 800 acessos em campo, sendo que grande parte

já está em telados. Além disso, instituições públicas e privadas servem de apoio

aos projetos desenvolvidos, a exemplo da Universidade Estadual de Santa Cruz

(UESC). Dentre os principais objetivos desse programa podem ser citados:

selecionar genótipos, principalmente porta-enxertos, mais tolerantes à seca e ao

alumínio, reduzir o período juvenil, aumentar a longevidade dos pomares, obter

variedades mais resistentes à gomose de Phytophthora spp. e ao complexo do

Vírus da Tristeza dos Citros – CTV (Citrus Tristeza Vírus), além de adaptados a

altas densidades populacionais [Soares-Filho, W. dos S., 2003(a); Soares-Filho,

W. dos S., 2003(b)] .

Os maiores estados produtores de laranja no Brasil são São Paulo, Bahia,

Paraná, Minas Gerais e Sergipe, nessa ordem. O sudeste detém a maior produção,

com cerca de 80%, enquanto Bahia e Sergipe, juntamente, representam em torno

de 9% da produção nacional (IBGE, 2013). As estimativas até 2023 é que a

produção de citros no país cresça de 20,2 (2013) para 23,8 mil toneladas, um

aumento de 17,8%, ao passo que a exportação de suco concentrado deve crescer

de 2,1 (2013) para 2,6 mil toneladas (AGE/Mapa e SGE/Embrapa, 2016).

Contudo, para que tais níveis de produção sejam mantidos e/ou aumentados,

problemas relativos ao controle de pragas e doenças, bem como as variações

18

climáticas e ambientais, especialmente relativas ao regime de chuvas, devem ser

minimizados e/ou superados.

2.2 Interação copa/porta-enxerto

A enxertia é uma técnica milenar utilizadas em diversas culturas (Mudge

et al., 2009). Nessa técnica, duas plantas distintas – a copa e o porta-enxerto – são

unidas para formar um único genótipo, sendo que uma planta será responsável

pelo desenvolvimento do sistema radicular – absorvendo água e os nutrientes do

solo – e outra pela copa – responsável pela realização da fotossíntese, floração e

consequente produção de frutos (Ribeiro et al, 2005). Em diversas culturas, sejam

elas perenes ou anuais, a enxertia é utilizada para unir sistemas radiculares

resilientes (porta-enxerto) com uma copa produtiva, formando assim um

“produto” que gere “frutos” (Warschefsky et al., 2015). A depender da forma da

união dessas duas plantas – seja pela técnica utilizada ou pelas características

intrínsecas da planta –, essa pode ser um fator determinante para limitar o

crescimento da copa, bem como a taxa de sobrevivência da planta enxertada

(Johkan et al., 2009; Martínez-Ballesta et al., 2010).

A utilização adequada da combinação copa/porta-enxerto pode ser de

fundamental importância para o aumento de produtividade, visto que, a utilização

de um único porta-enxerto para diferentes copas, pode subestimar o potencial

produtivo destas. Na planta enxertada, a comunicação entre a parte aérea e o

sistema radicular ocorre como em uma planta não enxertada. Entretanto, o porta-

enxerto, responsável pelo sistema radicular, pode interferir diretamente nas

características da copa, tais como: tamanho, precocidade de produção e

produtividade de frutos, época de maturação, peso do fruto, coloração da casca e

da polpa dos frutos, teor de açúcares e de ácidos, permanência dos frutos na

planta, conservação do fruto após a colheita, transpiração e composição química

das folhas, fertilidade do pólen, capacidade de absorção, síntese e utilização de

nutrientes, tolerância à seca, à salinidade e ao frio, resistência e/ou tolerância a

pragas (Pompeu Junior, 1991).

A disponibilidade de água no solo é um dos fatores mais limitantes da

produção mundial, e nesse contexto, o melhoramento vegetal visa selecionar

19

plantas que sejam mais tolerantes aos períodos secos, e que, consequentemente,

tenham uma maior eficiência do uso da água (EUA) (Condon et al., 2004). Dentro

deste cenário, o porta-enxerto tem fundamental importância para que este objetivo

seja alcançado. Em diversas culturas, já foi comprovada a influência que o porta-

enxerto exerce na característica de tolerância ao déficit hídrico (Soar et al., 2006;

García-Sánchez et al., 2007; Sánchez-Rodríguez et al., 2012; Liu et al., 2012).

Dentre os mecanismos desenvolvidos na interação copa/porta-enxerto, podemos

citar a sinalização química – realizada através de estímulos hormonais para

controlar o consumo e perda de água pela parte área – e a sinalização hidráulica –

regulada, em grande parte, pelo tamanho dos vasos do xilema, que influência na

capacidade de captura da água no solo (Figura 1) (Jones, 2012).

Figura 1. Ilustração de algumas das principais maneiras em que os porta-enxertos

podem afetar a água nas copas, bem como suas relações e crescimento. Adaptado

de Jones, 2012 (How do rootstocks control shoot water relations? /New

Phytlogist).

As plantas desenvolvem diferentes mecanismos para sobreviver ao estresse

por déficit hídrico, e estas respostas vão depender da duração e da intensidade do

período de estresse (Bray, 1997). Vários estudos foram desenvolvidos para

identificar mecanismos e/ou características para facilitar a seleção de genótipos de

porta-enxerto mais tolerantes. Em videiras, Marguerit et al. (2012) demonstraram

20

que a taxa de transpiração e a adaptação ao déficit hídrico em copas, são

influenciados geneticamente pelos porta-enxertos. Na revisão de Aroca et al.

(2012), eles enfatizaram a importância da capacidade de extração de água do solo

do porta-enxerto na determinação da maior tolerância a deficiência hídrica.

Enquanto que no trabalho de Martínez-Ballesta et al. (2010), focada

especialmente para enxertia em Solanaceas e Curcurbitaceas, foi relatada a

importância da correta conexão entre copa e porta-enxerto, pois distúrbios

fisiológicos - como inibição de crescimento e restrição de comunicação – podem

ser decorrentes da descontinuidade da união vascular. Já em citros, Tzarfati et al.,

2013, demonstrou que o enxerto promove alterações no padrão de expressão de

micro-RNAs (miRNAs), e que esta interferência pode estar relacionada com a

redução do período juvenil.

Em citros, e também na maioria das culturas enxertadas, as partes unidas

para originar a nova planta, são propagadas assexuadamente (Warschefsky et al.,

2015). O gênero Citrus possui uma característica chamada poliembrionia, onde

em uma semente são gerados vários embriões, e destes, boa parte são nucelares,

ou seja, idênticos a planta mãe. Os porta-enxertos utilizados, em quase 100% dos

casos, são propagados através dessa característica (Oliveira et al., 2008). Ao passo

que, as copas são obtidas através de gemas e/ou pedaços do caule de uma planta

matriz. A citricultura brasileira, atualmente, ainda é mantida, em sua grande parte,

em um único porta-enxerto, o Limoeiro Cravo Santa Cruz, que ganhou o apreço

dos produtores devido a sua rusticidade, potencial produtivo mesmo em condições

adversas, como a seca, além de tolerância a algumas doenças (Oliveira et al.,

2008). Entretanto, o uso de um único porta-enxerto é um risco eminente, devido à

susceptibilidade dos pomares às pragas e doenças. Na década de 40, cerca de 75%

dos pomares brasileiros, enxertados em laranjeira ‘Azeda’, foram dizimados em

decorrência da alta sensibilidade ao vírus da tristeza dos citros (CTV). Dessa

forma, a diversificação de porta-enxertos – que é um tema bastante discutido nos

últimos tempos por pesquisadores e citricultores – é um ponto chave para

manutenção da produção nacional, especialmente com chegada do HLB.

21

2.3 Déficit hídrico

As plantas cultivadas estão sujeitas a uma série de estresses que podem ser

de origem biótica e/ou abiótica. Uma redução que gira em torno de 50 a 70% da

produtividade nas grandes culturas tem sido atribuída aos estresses abióticos

(Mittler, 2006). Adicionado a isto, os estresses abióticos desenvolvem um papel

determinante na distribuição das espécies de plantas nos mais diversos ambientes

do planeta (Verslues et al., 2006). Dentre os estresses abióticos que mais

preocupam os produtores, o deficit hídrico tem se destacado, especialmente com

as previsões de períodos secos mais prolongados nos próximos anos (Marengo,

2014). O estresse hídrico por seca pode ser definido como o período em que

ocorre baixa precipitação quando comparada ao normal, limitando a produtividade

no sistema natural ou agrícola (Kramer e Boyer, 1995; Taiz e Zeiger, 2013).

Dessa forma, o componente que define a seca é a disponibilidade de água no solo

(Verslues et al., 2006).

Para sobreviver a tais condições de estresses, as plantas respondem com

várias modificações através de uma cascata de sinais (Dos Reis et al., 2012).

Dentre estes mecanismos podemos citar como efeitos primários a redução do

potencial hídrico (Ψw), a desidratação celular e a resistência hidráulica.

Adicionado a estes, efeitos secundários ocorrem, a exemplo: redução da expansão

celular; redução das atividades celulares e metabólicas; fechamento estomático e

consequente inibição da fotossíntese; abscisão foliar; cavitação – que é o processo

de redução da coluna líquida sob tensão no xilema; produção de ROS (espécies

reativas de oxigênio); morte celular; desestabilização de membranas e proteínas,

dentre outros (Figura 2) (Taiz e Zeiger, 2013). São estes mecanismos que ajudam

as plantas a sobreviver aos períodos de estresse hídrico, bem como a sua

recuperação após as primeiras chuvas ou reidratação.

Em citrus, diversos estudos foram desenvolvidos no intuito de caracterizar

o comportamento destas plantas durante o déficit hídrico. Rodríguez-Gamir et al.,

(2010) avaliaram três genótipos de citros sob deficiência hídrica e constataram

que o déficit afeta as trocas gasosas e a relação de água nas folhas, além de

constatarem que a tolerância ao déficit é ligada ao genótipo. Este último fato

também foi observado nos trabalhos de Romero et al., (2006), Brito et al. (2012)

22

Argamasilla et al., (2014), e Pedroso et al. (2014), especialmente quando relata-se

a importância do genótipo do porta-enxerto. Allario et al. (2013) trabalharam com

plantas diploides (2x) e tetraploides (4x) de citrus também submetida ao estresse

por seca, e constataram que as plantas 4x são mais tolerantes que as 2x, além de

desenvolverem mecanismos que possibilitam maior aclimatação, a exemplo da

expressão genética diferenciada para controle da sinalização de longa distância

pelo ácido abscísico (ABA).

Figura 2. Efeitos primários e secundários em plantas causadas pelo déficit

hídrico. Adaptado de Taiz e Zeiger, 2013.

No trabalho de Argamasilla e Gómez-Cadenas (2014), que avaliaram dois

genótipos de citros submetidos ao estresse por seca e alagamento, foi constatado

alterações nos perfis de prolina, ácido jasmônico (AJ), ácido indolacético (AIA) e

ABA durante o déficit hídrico, além de enfatizarem que o genótipo possui

características intrínsecas (metabolismo basal) que podem influenciar na maior ou

menor aclimatação a condição de estresse. Já no trabalho de Pedroso et al. (2014),

onde avaliou-se a capacidade dos porta-enxertos na modulação de carboidratos

não estruturais e a tolerância ao déficit hídrico, foi demonstrado que o genótipo

mais tolerante, incentivou o crescimento de raiz, havendo acúmulo de

carboidratos nas mesmas. Além disso, foi constatado neste trabalho que folhas

23

jovens maduras possuem maiores taxas fotossintéticas durante o déficit hídrico

que folhas maduras.

2.3.1 Estratégias de sobrevivência

A alteração climática pode ser definida como a indisponibilidade e/ou

alteração das condições e/ou recursos fundamentais para o desenvolvimento das

plantas (Nicotra et al., 2010). Quando submetidas a tais condições, as plantas

desenvolvem respostas induzidas por estas alterações ambientais, resultando em

um processo denominado de plasticidade fenotípica. A plasticidade fenotípica

pode ser entendida por possuir controle genético e/ou hereditário (epigenética),

sendo considerada fundamental para a evolução das espécies (Nicotra et al., 2010;

Reed et al., 2010). O entendimento de como as plantas se comportam e/ou

adaptam a tais alterações ambientais é de suma importância para o

desenvolvimento de técnicas de manejo visando minimizar os impactos nas

culturas.

Alguns estresses abióticos possuem ao menos um dos seus efeitos

negativos no desenvolvimento da planta relativo ao conteúdo de água disponível.

Esse efeito pode ser causado devido à alteração do teor de íons e absorção de água

decorrente do estresse salino, pela desidratação celular devido a formação de gelo

extracelular em conseqüência do frio, ou pela redução da disponibilidade de água

causada pelo estresse hídrico (Verslues et al., 2006). Dentre as alterações

climáticas, o déficit hídrico tem tido destaque devido às limitações que causam na

produção. Para superar o período com restrição hídrica, as plantas podem adotar

diferentes estratégias de sobrevivência, sendo que as duas principais são: evitar e

tolerar a desidratação (Verslues et al., 2006; McDowell et al., 2008; Claeys and

Inzé, 2013).

Na estratégia de evitar a desidratação o ponto principal é o balanço entre a

captura de água do solo e a perda de água por transpiração (Verslues et al., 2006;

Claeys and Inzé, 2013). Normalmente esta estratégia é adotada em estresses

moderados ou de curta duração, onde são desenvolvidos mecanismos como o

aumento do sistema radicular e o fechamento estomático, visando manter o

crescimento e a produção (Figura 3) (Verslues et al., 2006; McDowell et al., 2008;

Claeys and Inzé, 2013).

24

Entretanto, quando o estresse hídrico se torna mais severo e/ou mais

prolongado, os mecanismos desenvolvidos na estratégia de evitar a desidratação,

não são suficientes. Nesse contexto, existe a estratégia de tolerar a desidratação,

cujo objetivo principal é a proteção aos danos celulares ocasionados pelo estresse

hídrico. Alguns dos mecanismos desenvolvidos nessa estratégia incluem a

desintoxicação causada pelas espécies reativas de oxigênio (ROS), a acumulação

de proteínas de proteção, bem como de solutos a exemplo da prolina, glicina

betaína e açúcares, que possuem importância na mantenção da turgescência

celular (Verslues et al., 2006; Claeys and Inzé, 2013). Nessa estratégia o ponto

principal é garantir a sobrevivência da espécie após o estresse (Figura 3).

Figure 3 – Balanço entre a tolerância ao estresse e manutenção do crescimento.

Adaptado de Claeys e Inzé, 2013.

2.3.2 Hormônios vegetais

Os hormônios vegetais são substancias que, em pequenas concentrações,

regulam o desenvolvimento e crescimento das plantas (Taiz e Zeiger, 2013).

Normalmente eles são produzidos em uma parte da planta, e posteriormente

translocado para células visinhas ou para outras partes da planta, onde irão induzir

25

as respostas fisiológicas. Dentre os vários tipos de hormônios vegetais, três serão

enfatizados a seguir: o ácido abscísico (ABA), a auxina (ácido indolacético - AIA)

e o ácido salicílico (AS).

O ABA é um hormônio bastante conhecido devido ao seu importante papel

no crescimento e fechamento estomático, principalmente quando as plantas estão

sujeitas as alterações climáticas, de forma especial ao déficit hídrico. Além disso,

o ABA também é importante na maturação, regulação do crescimento e na

dormência das sementes, dormência de gemas e senescência foliar (Taiz e Zeiger,

2013). Muitos estudos relatam que o ABA seria produzido nas raízes e

posteriormente translocados para a parte aérea, especialmente em condições de

deficiência hídrica, induzindo o fechamento estomático. Entretanto, alguns

estudos sugerem que também existe produção de ABA na parte área, e que esta

pode ser de grande importância na indução de uma maior tolerância ao déficit

hídrico (Christmann et al., 2007; Ikegami et al., 2009; Bauer et al., 2013). O ABA

pode ser transportado tanto pelo xilema quanto pelo floema, sendo este transporte

altamente influenciado pelas condições ambientais, especialmente de déficit

hídrico.

A auxina foi o primeiro hormônio descoberto, sendo a sua forma natural

mais comum o ácido indol-3-acético (AIA). Este hormônio é normalmente

sintetizado em meristemas e/ou tecidos jovens em divisão, sendo movida através

do transporte polar, ou seja, do ápice para a região basal (Friml, 2003; Taiz e

Zeiger, 2013). A auxina promove o crescimento através do alongamento celular,

ou seja, ocorre uma alteração nas paredes celulares, e devido ao armazenamento

de água nos vacúolos, ocorre a expansão celular. Além da função de promoção do

crescimento/alongamento celular, a auxina também é importante no

desenvolvimento dos tropismos vegetais e em diversas etapas do desenvolvimento

da plantas, sendo este dependente da composição genética e/ou das condições que

a plantas estão sujeitas (Sachs, 2005).

Já o AS não é reportado como um dos principais grupos de hormônios,

contudo, nos últimos anos, vários estudos estão relatando sua importância como

molécula sinalizadora. O SA é associado, principalmente, a resposta ao ataque de

patogenos, desenvolvendo o fenômeno denominado de resistência sistêmica

adquirida (RSA), onde sinais são enviados do local infectado para o restante da

26

planta através do floema, e também para plantas vizinhas, estimulando assim o

aumento da tolerância ao ataque (Dempsey et al., 2011; Taiz e Zeiger, 2013).

Recentes estudos, contudo, também estão relatando a importância deste hormônio

no desenvolvimento da tolerância ao déficit hídrico, sendo este associado ao

controle estomático em associação com o ABA (Horváth et al., 2007; Miura e

Tada, 2014). De acordo com a composição genética da planta e as condições de

estresse em que são submetidas, os níveis destes hormônios – ABA, AIA e AS –

podem ser aumentados ou reduzidos durante o déficit hídrico, influenciando

diretamente em uma maior ou menor tolerância ao mesmo.

2.3.3 Carboidratos

Os carboidratos são substâncias que fornecem energia para as plantas. É

por meio da fotossíntese que a planta consegue transformar energia luminosa em

energia química (através de pigmentos fotossintéticos), usando água e CO2, e

produzindo carboidratos (Taiz e Zeiger, 2013). Diversos fatores podem influenciar

na maior ou menor eficiência dessa conversão, dentre eles podemos destacar o

estresse hídrico (Santos e Carlesso, 1998; da Cruz et al., 2015). As plantas

normalmente acumulam carboidratos que servem de estoque de energia para um

período com fornecimento energético limitado e/ou para reforçar uma maior

demanda energética (Krasensky e Jonak, 2012).

O amido é a principal reserva de carboidratos das plantas, sendo

rapidamente convertido em açúcares solúveis quando a planta está submetida a

qualquer alteração ambiental – como seca e salinidade (Basu et al., 2007; Kempa

et al., 2008) –, fornecendo energia para continuidade do metabolismo celular

(Krasensky e Jonak, 2012). Estudos relatam o acumulo de açúcares durante do

déficit hídrico (Krasensky e Jonak, 2012; Pedroso et al., 2014; da Cruz et al.,

2015). Durante muito tempo, os açúcares foram considerados como sinalizadores

para a produção de ROS, ou seja, o aumento da concentração de açúcares

intracelular induzia a produção de ROS, desencadeando assim uma resposta das

plantas ao estresse (Couée et al., 2006). Entretanto, trabalhos mais recentes estão

defendendo que o acumulo de açúcares, de forma especial trealose e rafinose

(Keunen et al., 2013; Lunn et al., 2014), podem ser verdadeiros seqüestradores de

27

ROS, auxiliando assim na desintoxicação celulares, podendo induzir uma maior

tolerância ao déficit hídrico.

Em citros, diversos estudos foram realizados para avaliar o comportamento

dos carboidratos durante o déficit hídrico, realçando a importância destes

componentes no metabolismo celular (Yakushiji et al, 1998; Barry et al., 2004;

Magalhaes Filho et al., 2008; Arbona et al., 2013; Pedroso et al., 2014). Embora o

conceito dos açúcares como reguladores na atividade fotossintetica e metabolismo

celular seja bem difundido, é relativamente nova a ideia que os açúcares são

moleculas sinalizadoras (Rolland et al., 2002). Ao nosso conhecimento, estudos

que quantifiquem trealose e rafinose, potenciais sequestradores de ROS, ainda não

foram desenvolvidos em plantas cítricas. Este estudo poderá ser de grande valia

para a abertura de novas vertentes de estudo, bem como servir de suporte para um

melhor entendimento da influência destes carboidratos na indução da tolerância ao

déficit hídrico.

2.3.4 Compostos Voláteis

Os compostos orgânicos voláteis (VOCs) são metabólitos secundários

vegetais que evaporam sob temperatura ambiente (Taiz e Zeiger, 2013). Os VOCs

possuem diversas funções eco-fisiológicas (Pinto-Zevallos et al., 2013) dentre

elas: defesa de plantas contra agentes de estresse, possibilitando a comunicação

entre planta e o meio ambiente; protegem a planta do calor, reduzindo ROS

produzidos em altas temperaturas (Copolovici, et al., 2005); repelem insetos

(McCallum et al., 2011); atraem polinizadores para as flores e animais dispersores

de sementes; além de serem atração para predadores naturais em plantas atacadas

(Arimura et al., 2010).

Loreto e Schnitzler (2010) enfatizam que os VOCs são moléculas

fundamentais de sinalização do estresse e por consequência ativa a RSA e a

resposta de hipersensibilidade (RH). Esta última desencadeia a morte celular no

local da infecção, privando o patógeno de nutrientes e impedindo a propagação na

planta (Taiz e Zeiger, 2013). Os VOCs podem ser emitidos constitutivamente

pelas plantas (Kesselmier e Staut, 1999) ou ser induzido por estresse abiótico

(Loreto, Schnitzler, 2010) e biótico (Paré, Tumlinson, 1999).

28

Dentre os compostos voláteis, podemos citar os terpenos – que são

hidrocarbonetos formados a partir da união de isoprenos –, os compostos

fenólicos e os alcalóides. Estes são emitidos constitutivamente, entretanto, em

condição de ataque de herbívoros, podem apresentar diferentes padrões de

emissão dependendo da espécie do inseto. Além destes, quando tem-se um dano

mecânico, as plantas podem emitir os voláteis de folhas verdes (VGLs), que são

derivados de lipídeos (Taiz e Zeiger, 2013). Os compostos voláteis são emitidos

em vários tecidos, bem como abaixo do solo, e possuem fundamental importância

na comunicação entre plantas, bem como entre plantas e outros organismos,

exercendo assim diversas funções nos estresses bióticos e abióticos (Loreto,

Schnitzler, 2010; Pinto-Zevallos et al., 2013).

Diversos fatores podem influenciar – reduzindo ou estimulando – na

emissão dos voláteis pelas plantas, a exemplo da luminosidade, umidade do solo e

do ar, temperatura, nutrientes disponíveis, herbivoria, etc (Hare, 2011). Dessa

forma, o estudo dos compostos orgânicos voláteis (COV) liberados pelas plantas

em situações de estresse, seja pela picada de insetos, introdução de bactéria,

excesso de luminosidade, deficiência nutricional e/ou estresse hídrico por falta de

água, é de fundamental importância na tentativa de elucidar o papel destes

componentes na maior ou menor tolerância aos estresses bióticos e abióticos, de

forma especial no déficit hídrico.

29

CAPÍTULO 1:

Polyploidization alters constitutive emission of volatile

organic compounds (VOC) and improves membrane stability

under water deficit in Volkamer lemon (Citrus limonia Osb.)

leaves

Artigo submetido à Environmental and Experimental Botany em 07/12/2015

Artigo aceito com menores correções na Environmental and Experimental Botany

em 25/01/2016 e resubmetido em 05/02/2016

Artigo publicado na Environmental and Experimental Botany em 15/02/2016

Polyploidization alters constitutive content of volatile organiccompounds (VOC) and improves membrane stability under waterdeficit in Volkamer lemon (Citrus limonia Osb.) leaves

Dayse Drielly Souza Santana Vieiraa,b, Giovanni Emilianic, Marco Michelozzid,Mauro Centrittoc, François Luroe, Raphaël Morillonf, Francesco Loretog,Abelmon Gesteirah, Biancaelena Masertia,*aCNR-IPSP, Istituto per la Protezione Sostenibile delle Piante, Area della Ricerca,Via Madonna del Piano 10, 50019 Sesto Fiorentino (FI), ItalybDepartamento de Ciências Biológicas, Universidade Estadual de Santa Cruz, Rodovia Jorge Amado, Km 16 45662-900 Ilhéus, Bahia, BrazilcCNR!IVALSA, Istituto per la Valorizzazione del Legno e delle Specie Arboree, Area della Ricerca, Via Madonna del Piano 10, 50019 Sesto Fiorentino (FI), ItalydCNR-IBBR, Istituto di Bioscienze e Biorisorse, Area della Ricerca, Via Madonna del Piano 10, 50019 Sesto Fiorentino (FI), ItalyeUMR AGAP!INRA de Corse, équipe APMV, 20230 San Giuliano, FrancefUMR AGAP!CIRAD, équipé APMV – Station de Roujol, 97170 Petit Bourg, Guadaloupe, FrancegCNR-DISBA!Dipartimento di Scienze Bio-Agroalimentari, Piazzale Aldo Moro 7, 00185 Roma, Italyh EMBRAPA Mandioca Fruticultura, Cruz das Almas, Bahia, Brazil

A R T I C L E I N F O

Article history:

Received 7 December 2015Received in revised form 4 February 2016Accepted 14 February 2016Available online 16 February 2016

Keywords:

DREB2A

Green leaf volatileHPL

MonoterpenoidsOxylipinsPolyploidizationVOC

A B S T R A C T

In Citrus species chromosome doubling naturally occurs in somatic embryos and doubled diploid plantsoften show better adaptation to adverse environmental condition. To understand the moleculardeterminants of stress acclimation, we examined the response to water deficit in diploid (2"VL) anddoubled diploid (4"VL) seedlings of Volkamer lemon (Citrus limonia Osb.) assessing the profile ofconstitutive volatile organic compound (VOC) in control and stressed conditions. Physiologicalparameters and leaf volatile compound profiles were measured during water deficit and 24 h afterrehydration of plants to field capacity. Net photosynthesis and stomatal conductance were reduced inwater stressed leaves, with no significant differences between 2"VL and 4"VL plants. Malondialdehydeconcentration, a marker of lipid peroxidation of cellular membranes, was significantly more higher instressed 2"VL leaves than in 4"VL. The blend of constitutive VOC was different in control leaves beingoxygenated sesquiterpenoids more abundant in 2"VL leaves, and monoterpenoids more abundant in4"VL leaves. Water deficit did not stimulate biosynthesis of terpenoids, whereas accumulation of trans-2 hexenal, a green leaf volatile (GLV) synthesized after membrane denaturation, was observed in stressedleaves of 2"VL leaves, but not in 4"VL leaves. Semiquantitative PCR showed an increase of the expressionof HPL, the gene encoding for hydroperoxidase lyase which catalyzes 2-hexenal formation, only in 2"VLplants. The expression of the putative dehydration transcription factor DREB2A was also observed only in2"VL water stressed plants. This work shows that level of ploidy may alter constitutive content of GLV byCitrus, therefore likely affecting plants capacity of protection and interaction with other organisms.Whereas diploid and double diploid plants showed similar physiological responses to water deficit, abiochemical marker indicated that membranes of double diploid leaves were more resistant to the stress.These results provide intriguing insights into the regulation of terpenoids and oxylipins pathways as afunction of polyploidization in a non-model plant species.

ã 2016 Elsevier B.V. All rights reserved.

1. Introduction

Citrus is one of the most important fruit crop in the world andits production is challenged by many environmental constraints.

Citrus varieties are routinely grown on rootstocks to help themcoping with a range of stressful conditions (Levy and Syvertsen,2004; Tadeo et al., 2008). Citrus rootstocks are propagated throughpolyembryonic seeds and the seedlings regenerated from nucellarembryos are genetically identical to the maternal plant. Themajority of cultivated citrus genotypes has a partially apomicticreproduction with a somatic embryogenesis of nucellar cellsinduced by the gamete fertilization (Aleza et al., 2011). Doubled

* Corresponding author.E-mail address: elena.maserti@ipsp.cnr.it (B. Maserti).

http://dx.doi.org/10.1016/j.envexpbot.2016.02.0100098-8472/ã 2016 Elsevier B.V. All rights reserved.

Environmental and Experimental Botany 126 (2016) 1–9

Contents lists available at ScienceDirect

Environmental and Experimental Botany

journal homepa ge: www.elsev ier .com/ locate /envexpbot

diploid seedlings in apomictic genotypes are considered to arisefrom somatic chromosome doubling of nucellar embryo cells andshould be genetically identical, at the qualitative level, to the seedsource tree (Rao et al., 2008). In reality, the phenotype of doubleddiploids is modified in various traits, such as a reduced growthvigor and enlargement of cells and organs (Comai, 2005).Polyploidy has been an important determinant in plant evolution,facilitating plant invasiveness and the capability to successfullycolonize habitats characterized by strong fluctuating environmen-tal conditions (Beest et al., 2012). Furthermore, recent studies alsodemonstrate that genome doubling confers to plants also a betteradaptability to various environmental stresses included a highertolerance to salinity (Mouhaya et al., 2010; Jiang et al., 2013) andwater deficit (Li et al., 2009). In citrus plants, Allario et al. (2013)found that in control conditions 4" rootstocks constitutivelyoverexpressed a set of genes putatively involved in water deficittolerance. Podda et al. (2013) found higher levels of antioxidantenzymes, such as superoxide dismutase and ascorbate peroxidase,in 4" Cleopatra and Willow leaf mandarin than the respective 2"plants challenged with salt stress.

Drought stress is a major environmental factor that affects plantgrowth and development and are expected to increase withclimate change (Dai, 2010; Centritto et al., 2011).

Plants release into the surrounding atmosphere a vast range ofvolatile organic compounds (VOC) which have a role as infochem-icals in biotic interaction (Blée, 2002; Niinemets et al., 2013) andalso in abiotic stress acclimation. VOCs are often considered as amechanism for plants to respond to stresses and alleviating theirnegative consequences (Loreto and Schnitzler, 2010).

The terpenoids, and the green leaf volatiles (GLVs), including 2-hexenal (cis,trans aldehydes C6), are two families of volatile organiccompounds (VOC) abundantly emitted by stressed plants (Feuss-ner and Wasternack, 2002; Dudareva et al., 2004). Green leafvolatiles are well-studied as compounds produced by plants inresponse to wounding (Loreto et al., 2006; Brilli et al., 2011), topathogenic infection (Blée, 2002; Scala et al., 2013) and toherbivory (Maja et al., 2014). However, induction of GLV afterabiotic stress was also observed. Emission of (E)-2-hexenal wasdetected in a photoinhibition sensitive Arabidopsis mutant afterexposure to intense light conditions (Loreto et al., 2006), in tomatounder heat and cold stresses (Copolovici et al., 2012), and intobacco after exposure to ozone (Beauchamp et al., 2005), andunder other photooxidative stress condition (Mano et al., 2010).Recently, it has been suggested that 2-hexenal can act asendogenous signal chemical inducing abiotic-responsive genes(Kramell et al., 2000; Savchenko et al., 2014; Yamauchi et al., 2015).

Profiling of VOC has been largely used to evaluate biotic andabiotic stress response in citrus plants, for example in response toCitrus Tristeza Virus (Cheung et al., 2015), winter flooding andsalinity (Velikova et al., 2012) or to blue light (Pallozzi et al., 2013).However, to our knowledge, no study has examined the impact ofploidy combined with water deficit on VOC profile in citrus plants.Thus, the aim of this work was to compare the VOC content in 2"and 4" Volkamer lemon plants, in control and water stressconditions, to gain new insight on the role of VOC in water stressdeficit and on the association of VOC profile with the geneticstructure of citrus plants.

2. Material and methods

2.1. Plant material and growth conditions

Thirty diploid (2"VL) and thirty doubled diploid (4"VL), six-month-old seedlings of Volkamer lemon (Citrus limonia Osb.)were obtained from seeds of fruit picked in adult trees maintainedin the citrus germplasm collection (INRA/CIRAD CRB Citrus), San

Giuliano, Corsica (France). The ploidy status of 2" and 4" plantswas previously checked and confirmed by flow cytometry (Partec I)according to Froelicher et al. (2007). The clonal propagation bynucellar embryogeneis was verified by genotyping the offspringusing 13 SSR markers according to protocols and markersdevelopped by Luro et al. (2008). Markers are listed in theSupplementary Table S1. Non conform Volkamer lemon plantswere discarded. The selected plants were transplanted in 3 L potscontaining commercial fresh soil, and then transferred in achamber of the Institute for Sustainable Plant Protection inFlorence, which was equipped to grow plants for 6 months underthe following controlled condictions: photoperiod of 16 h, withday/night of 25–32 #C/18–20 #C, and relative humidity varyingdaily between 50 and 80%. The photon flux density at leaf level was300–350 mmol m!2 s!1,supplied mainly with cool lights. Theplants were regularly irrigated during the week and werefertilizated with Bayfolan (Bayer) (NPK 5–7–8 + microelements),every 15 days.

2.2. Water deficit

Water deficit experimental design involved two phases(Supplementary Fig. S1). In the first phase, twenty-four plantsfor each genotype were irrigated at field capacity and the excesswater was allowed to drain overnight. After draining, the pots wereweighed to determine the weight at field capacity (Initialpotweight).Each pot was then enclosed in a plastic bag that was tied aroundthe stem to prevent soil evaporation. Then, twelve plants for eachgenotype were water-stressed by withholding water, while other12 plants for each genotype continued to be watered to fieldcapacity (control plants). Water deficit development was followedand parameterized measuring the pot weight and calculating thefraction of transpirable soil water (FTSW) (Sinclair and Ludlow,1986; Brilli et al., 2013). Every two days, during the water deficitexperiment, all plastic bags were unwrapped to weigh plants(nDaypotweight) and to water control plants compensating waterloss by transpiration. The physiologically lower limit of availablesoil water was defined as the FTSW at which stomatal conductanceapproached zero (Sinclair and Ludlow 1986; Brilli et al., 2013).Once this level was achieved, the water-stressed plants wereweighed to determine the final pot weight (Finalpotweight). Then,the FTSW was calculated for each single pot as: FTSW = (nDaypot-weight ! Finalpotweight)/(Initialpotweight! Finalpotweight) and water wasprovided to all plants to reach the initial pot weight. Leaves formetabolomic and biochemical analysis were harvested at (100% ofFTSW) (T0), 50% of FTSW (T1), 0% of FTSW (T2), and after 24 h fromirrigation of water-stressed plants (R).

2.3. Leaf net photosynthesis and stomatal conductance

During water deficit experiment, net photosynthesis andstomatal conductance were recorded with a portable photosyn-thesis system IRGA equipped with an integrated fluorometer (LI-6400, Li-Cor Inc., Nebraska, USA (model 6400; Li-Cor, Lincoln, NE)).Measurements were performed on the central portion of the firstfully expanded leaf using a photosynthetic photon flux density of600 mmol m!2 s!1, a leaf temperature of 25 #C, a relative humiditynear 40% and a CO2 concentration of 390 mmol mol!1. Measure-ments were repeated on 3–5 plants for each genotypes, at the sametimes when destructive sampling was carried out.

2.4. Proline extraction and determination

Proline was extracted according to Bates et al. (1973). Briefly,20 mg of leaf were crushed in liquid N2 with mortar and pestle andhomogenized in 70:30 ethanol:water at 95 #C for 20 min. The

2 D.D.S.S. Vieira et al. / Environmental and Experimental Botany 126 (2016) 1–9

resulting mixture was then centrifuged at 14000"g for 5 min. Analiquot of the ethanolic supernatant (0.5 mL) was added to 1 mLreaction mix (ninhydrin 1% (w/v) in acetic acid 60% (v/v), ethanol20% (v/v)) in a screw-cup eppendorf tube. The tube was sealed,mixed and heated at 95 #C for 20 min. After cooling at roomtemperature, the tube was centrifuged quickly (1 min, 9000"g)and the content transferred in a 1.5 mL cuvettes. Proline contentwas measured with a spectrophotometer (EASYSPEC SAFAS, UV–vis spectrophotometer) at 520 nm and calculated against a prolinestandard curve (5–2–1–0.5–0.2 mM of proline in 40:60 ethanol:water, 40:60 v/v). Data are expressed as mmol g!1 dry weight(DW).

2.5. Lipid peroxidation

Lipid peroxidation was measured as malondialdehyde (MDA)concentration (being MDA a product of lipid peroxidation),following the method of Hodges et al. (1999), with somemodifications. Briefly, leaf samples (0.05 g) were homogenizedin 1 mL of 0.1% (w/v) trichloroacetic acid (TCA). The homogenatewas centrifuged at 15,000"g for 5 min. An aliquot of thesupernatant (0.5 mL) was added with 0.5 mL of 0.5% (w/v)thiobarbituric acid (TBA) in 20% (w/v) TCA. The mixture washeated at 95 #C for 30 min and then quickly cooled in an ice bath.After centrifugation at 10,000"g for 10 min, the absorbance of thesupernatant was recorded at 532, 600 and 440 nm. The MDAcontent was calculated using e = 155 mM!1 cm!1 and expressed asnmol MDA g!1 DW.

2.6. Volatile organic compounds

Volatile organic compound analysis was done by HS-SPME–GC-MS (Head Space Solid Phase Micro Extraction sampling coupledwith Gas Chromatography Mass Spectrometry).

For sample preparation, 0.1 g aliquots of citrus leaf, finelyground in liquid nitrogen, were transferred to 2 mL screw capheadspace vials and, for each sample, 0.5 mL of distilled water andapproximately 0.150 g of NaCl were added. The vial ensuredhomogeneous sample mixing and favored the partitioning of VOCinto the head space during SPME extraction. An Agilent 7820 GC-chromatograph equipped with a 5977A MSD mass spectrometerwith EI ionisation operating at 70 eV was used for analysis. A three-phase DVB/Carboxen/PDMS 75-mm SPME fibre (Supelco, Bella-fonte, PA, USA) was exposed in the head space of the vials at 60 #Cfor 30 min for volatile compound sampling after a 5-minequilibration time. A Gerstel MPS2 XL autosampler equipped witha magnetic transportation adapter and a temperature controlledagitator (250 rpm with on/cycles of 10 s) was used for ensuringconsistent SPME extraction conditions. A Chromatographic columnJ&W Innovax 30 m, 0.25 mm, ID 0.5 mm DF was used. The GCinjection temperature was 250 #C, splitless mode, and the oven wasprogrammed at 40# for 1 min, followed by a ramp of 5 #C/min to200 #C, and of 10 #C/min to 260 #C. This high temperature was heldfor 5 min. Mass spectra were acquired within the 29–350 m/zinterval with an Agilent 5977 MSD spectrometer at three scans/sspeed. The identification of VOC was done on the basis of both peakmatching with library spectral database, and matching of thecalculated Kovats retention indexes (KRI) with those retrievedfrom literature. The data are expressed as percent area of eachcompound over the sum of all the identified compounds.

As SPME analysis are more qualitative than quantitative, thegreen leaf volatile 2-hexenal whose levels resulted significantlydifferent between control and stressed plants, was quantitatedtogether with its product cis3—hexenol by extraction with pentaneaccording to the protocol of Raffa and Smalley (1995) modified fora better quantitation of the compounds of interest, and GC–MS

analysis. The pentane solution was supplemented with 5 methylhexanol (at 10 mg L!1) as internal standard (IS) instead ofTridecane, as described in the original method. For extraction,200 mg aliquots of the ground samples were soaked in 5 mL of ISpentane solution at room temperature for 24 h, in 20 mL screw capvials. The extracts were then filtered with 0.45 mm PTFE syringefilters and injected in the GC-MS system (1 ml in 1:10 split mode).Chromatographic conditions were the same as for HS-SPME–GC-MS analysis. Calibration lines, constructed with pure 2-hexenaland cis3-hexenol as standards in the same analytical conditionsand in the range 2–50 mg L!1 allowed the calculation of thecompound concentrations in the samples. The data are expressedas nanogram g!1 DW.

2.7. RNA extraction and RT-PCR analysis

In order to design primers for semi-quantitative analyses, thenucleotide coding sequences (CDS) of citrus DREB2A and HPLproteins were retrieved from the Phytozome database (http://www.phytozome.net/). For DREB2A the Arabidopsis thaliana NCBIsequence AY063972 was used as seed for a Blastn analysis on theCitrus (C. sinensis and C. clementina) genome database. Thesequences showing significant hits were downloaded from thePhytozome database, aligned with Muscle (Edgar 2004) and usedto find high similarity regions for primer design (SupplementaryFig. S3). The same approach was used for HPL using C. sinensis NCBIsequence NM_001288924 (Supplementary Fig. S4). The cyclophilin(gene bank: AB981058.1) was used as reference gene for relativequantifications, after preliminary test to select the most suitablereference gene. The web based Primer3Plus toll (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi/) was usedto design the primers (Supplementary Table S2). To ensure that theprimer was amplifying the targeted genes, the amplicons wereexcised and purified from agarose gels using the Wizard1 SV Geland PCR Clean-Up System (Promega) following the manufacturer’sprotocol, and then sequenced by Dipartimento Integrato Inter-istituzionale of University of Pisa, Italy (Supplementary Figs. S3 andS4). Total RNA extraction and cDNA synthesis were performed asalready reported in Podda et al. (2013) modifying the protocol ofthe Taqman Gene Expression Cells-to-CT TM Kit (AppliedBiosystems). The following standard thermal profile was usedfor PCR: 94 #C for 5 min; 33 cycles (for CYP, 35 for DREB2A and HPL)of 94 #C for 30 s, 58 #C for 50 s for cyclophilin and 60 #C for DREB2A

and HPL, and 72 #C for 60 s; 72 #C for 7 min as final extension. NoTemplate Controls (NTC) were include in each PCR. Each samplewas amplified in duplicate reactions (technical replicates). Threeindependent biological and two technical replicates were used.PCR products were separated by 1.5% agarose gel electrophoresisand stained with SYBR safe DNA gel stain (Invitrogen). Gel imageswere acquired with a GE DOC XR+ system (BioRad) and bandsquantification was performed with the Immage Lab Software(BioRad). The transcript levels were expressed in arbitrary units asmean $ SE.

2.8. Statistical analysis

For physiological, biological and expression analysis, thestatistical significance of differences between genotypes orbetween experimental conditions was determined by ANOVAand t-test, using STATISTICA software (StatSoft, Italy) at theprobability level <0.05. Data on volatile compounds were notnormally distributed (Kolmogorov–Smirnov one sample test) andthey were analysed by the non-parametric tests of Kruskal–Wallisand Mann–Whithney using SYSTAT 12.0 software (Systat SoftwareInc., Richmond, California, USA). All data are expressed as the meanvalue $ SE.

D.D.S.S. Vieira et al. / Environmental and Experimental Botany 126 (2016) 1–9 3

3. Results

3.1. Physiological parameters

Net photosynthesis and stomatal conductance showed a signifi-cant decrease along with water deficit progression in bothgenotypes. However both parameters decreased faster (since 70%ofFTSW) in4"VL. Alsonet photosynthesiswassignificant lowerthanthose in 2"VL at 20% of FTSW and at the end of water stressexperiment (Fig. 1a and b), whereas stomatal conductance showedsignificant lower levels in 4"VL than 2"VL since FTSW was reducedof about 50%. At the end of the experiment stomatal conductanceof stressed 4"VL leaves were about 0.008 mmol m!2 s!1,whereas the value in stressed 2"VL leaves was 3-fold higher(0.020 mmol m!2 s!1). After rewatering net photosynthesis andstomatal conductance returned to values around 40% of respectivecontrols, both in 2"VL and 4"VL plants.

3.2. Proline content

At the beginning of the experiment, the concentration ofproline in control 4"VL leaves was slightly higher (99 $ 4.6 mmolg!1 DW) than in control 2"VL leaves (87 $ 2.5 mmol g!1 DW)(Fig. 2A). At the end of the water stress experiment and after 24 h ofrehydration, proline concentration was higher in stressed 2"VLand 4"VL with no significant difference in the levels betweengenotypes.

3.3. Lipid peroxidation

The content of MDA was not different in control 2"VL and 4"VLleaves (about 31.8 $ 0.3nmol g!1 and 32.7 $ 0.2 nmol g !1 DW,

respectively) (Fig. 2B). However, there was a marked increase inMDA concentration during the course of water deficit in bothgenotypes, and especially in 2"VL leaves which reached MDAcontent as high as 44.9 $ 2.8 nmol g!1 DW at the end of theexperiment.

3.4. Volatile organic compounds

3.4.1. Terpenoid profiling in unstressed leaves of the two genotypes

In order to characterize the profile of VOC in 2"VL and 4"VLleaves, SPME coupled with mass chromatography was used.Overall, 23 compounds belonging to the monoterpenoid familywere detected and identified in control leaves of 2"VL and 4"VL.Interestingly, the volatile profile was different in the control of thetwo genotypes (Fig. 3) indicating that some compounds might beused as phenotyping markers for ploidy level. In particular, 4"VLleaves were characterized by significantly higher relative contentsof a-pinene, sabinene, myrcene, limonene, and ocimene, andlower relative contents of citronellol, citral z, citral, and geraniol,with respect to 2"VL leaves.

3.4.2. Terpenoid profiling during and after water deficit

No significant changes in the profile and in the relative amountof monoterpenoids was found during progression of water stress,and after rewatering in the leaves of the two genotypes (Fig. 4A andB).

3.4.3. Green leaf volatile profiling during and after water deficit

Pentane extraction was used to quantify the 2-hexenalconcentration in the two genotypes together with the levels ofcis-hexenol, produced from hexenal after conversion catalyzed byalcohol dehydrogenase (Supplementary Fig. S2). The 2-hexenal

Fig. 1. The effect of water deficit on: Photosynthesis rate and leaf stomatal conductance. White circle: 2"VL, control; black circle: 2"VL, stress condition; white square: 4"VL,control; black square: 4"VL, stress condition. Lower case letters show statistical differences between control and stressed conditions; upper case letters show statisticaldifferences between genotypes (P < 0.05). Bars indicate means $ SE (n = 3–5 plants).

Fig. 2. Proline (A) and MDA (B) concentrations in leaves of 2"VL (grey line) and 4"VL (dark line) plotted against FTSW % during water deficit. Lower case letters showsignificant differences between control and stressed leaves; upper case letter show significant differences between genotypes (P < 0.05). Bars indicate means $ SE (n = 3plants).

4 D.D.S.S. Vieira et al. / Environmental and Experimental Botany 126 (2016) 1–9

content of control leaves was 1.8-fold higher in 4"VL than in 2"VL(32.9 $ 1.7 and 18.1 $1.5 ng g!1 DW, respectively) (Fig. 5). After 6 dof water deficit (50% FTSW) the level of 2-hexenal of 2"VL leaveswas maximum, about 3-fold higher than in controls (from18.1 $1.5 to 58.8 $ 3.2 ng !1 DW), whereas no variation wasobserved in 4"VL leaves. At progressing water deficit levels 2-hexenal content of 2"VL leaves decreased from the value observedat T1, but remained significantly higher than in controls, andsimilar to the content of 4"VL leaves. No accumulation of cis-hexenol was observed in the two genotypes during and after thewater deficit (Fig. 5).

3.5. Expression profile of HPL and of the putative dehydration

transcription factor DREB2A

Semiquantitative PCR technique was performed to evaluate theexpression profile of HPL, the gene encoding for hydroperoxidaselyase, the enzyme synthetizing 2-hexenal from (9Z,11E,15Z)-13-hydroperoxy-9,11,15-octadecatrienoic acid (13-HPOT). As shown inFig. 5a and b the expression of HPL in 2"VL leaves increased withwater deficit, reaching values approximately 3-fold higher than incontrols (from 1.2 to 3 arbitrary units) at T2, and strongly droppedafter rehydration at a value significantly lower than in controls

Fig. 3. Comparison of monoterpenoid profile from unstressed leaves of 2"VL and 4"VL. Data are expressed as percentage of the total monoterpenoid levels. Asterix showsignificant differences between genotypes (P < 0.05). Bars represent means $ SE (n = 3 plants).

Fig. 4. Comparison of the monoterpenoid profile from control and water-stressed leaves of 2"VL (A) and 4"VL (B). White rectangle: T0 100% of FTSW; light grey: T1, 50% ofFTSW, dark grey: T2, 0% of FTSW, black: R, 24 h rehydrated plants. Data are expressed as percentage of the total monoterpenoid levels. Bars represent means $ SE (n = 3 plants).

D.D.S.S. Vieira et al. / Environmental and Experimental Botany 126 (2016) 1–9 5

(0.5 arbitrary units). The expression of HPL of 4"VL control leaveswas similar as control 2"VL leaves. However, HPL expression didnot change during water deficit in 4"VL leaves, and dropped afterrehydration (Fig. 6).

In order to evaluate the potential role of 2-hexenal as signalingcompound, the expression of a putative DREB2A, a gene encoding adehydration transcription factor, was measured in the twogenotypes in control and in water deficit conditions (Fig. 6). Theexpression profile of DREB2A was very similar to that of HPL,

showing a significant increase during water deficit, and a strongdecrease at control levels after rehydration of 2"VL leaves, but nosignificant changes throughout the water deficit experiment in4"VL leaves (Fig. 6).

4. Discussion

The aim of the study was to detect whether polyploidy has aneffect on VOC signature during and after a water deficit episode inVolkamer lemon seedlings. Tetraploidization related to chromo-some doubling is a spontaneous phenomenon in citrus. It leads toanatomical differences when compared to diploid plants, and mayalso lead to specific changes in the phenotype such as dwarfism,reduced number but increased size of the stomata with higher leafwater content (Allario et al., 2011) and enhanced constitutive rootabscisic acid production leading to better tolerance to water deficitconstraint (Allario et al., 2013).

The relative proportion of constitutive monoterpenoid n (themonoterpenoid profile) has been shown to be under strong geneticcontroland isgenerallyunaffectedbyabiotic factors(Hanover,1992;Plomion et al.,1996; Loreto et al., 2009). Therefore, monoterpenoidshave been largely used as interspecific and intraspecific chemo-taxonomical markers, mainly in forest genetics (Müller-Starck et al.,1992; Loreto et al., 2009), and in aromatic plants and tree crops suchas Citrus (Hosni et al., 2010; Lota et al., 2000, 2001; Lin et al., 2010).Thesignificantdifferencesrelatedtoploidyfoundinourexperiment,as 2"VL plants synthesized prevalently aldehydes and alcoholcompounds (namely z-citral, e-citral and e-geraniol) whereas 4"VLplants synthesized more non-oxygenated monoterpenoids

Fig. 5. Levels of 2- hexenal and cis-hexenol in 2"VL and 4"VL during the waterdeficit experiment. 2"C control; 2"T1: 50% of FTSW; 2"T2: 0% of FTSW; 2"R: 24 hafter rehydration. 4"C: control; 4"T1 50% of FTSW; 4"T2: 0% of FTSW; 4"R: 24 hafter rehydration. Bars represent means $ SE (n = 3 plants). Lower case letters showdifferences between control and stressed conditions; upper case letters showdifferences between genotypes (P < 0.05).

Fig. 6. Expression levels of hydrogen peroxide lyase (HPL) and the putative dehydration transcription factor DREB2A in 2"VL and 4"VL during water deficit experiment.Cyclophiline (CYP) was used as housekeeping gene. 2"C control, 2"T150% of FTSW, 2"T2 0% of FTSW; 2"R:24 h after rehydration. 4"C: control; 4"T1: 50% of FTSW; 4"T2: 0%of FTSW, 4"R: 24 h after rehydration. Bars represent means $ SE (n = 3 plants). Different letters indicate significant differences between control and stressed leaves.

6 D.D.S.S. Vieira et al. / Environmental and Experimental Botany 126 (2016) 1–9

(limonene, a-pinene, mircene, sabinene and ocimene), are intrigu-ing. Several authors suggested that complex forms of geneticdominance determine the biosynthesis pathways of volatilecompounds in allotetraploid citrus hybrids (Gancel et al., 2003)andinsomatichybrids(cybrids)(Fanciullinoetal.,2005).Howeveritis not clear how chromosome doubling might have affected VOCbiosynthesis in unstressed 2"VL and 4"VL opening the way tofurther investigations on the nuclear- cytoplasmic interactions in4"VL plants and whether these differences might be important instressful environments or forcommunicating with otherorganisms.as VOC have prominent roles in plant interactions with biotic andabiotic stresses (Dicke and Loreto 2010).

To study the impact of drought stress on VOC content, 2"VL and4"VL were subjected to a water deficit followed by rehydration.Several reports suggest that photosystems of doubled diploidplants were stressed by water deficit less than in diploid plants (Liet al., 2009; Ruiz et al., 2015). In our work, the photosynthesisparameters decreased along with the water deficit in 2"VL and4"VL leaves with a similar profile. However, stomatal conductancedecreased faster (since 70% of FTSW) in stressed 4"VL respect to2"VL. This behavior might be a strategy for a better adaptation towater deficit trading water saving for carbon assimilation (Chaveset al., 2002; Centritto et al., 2011; Marino et al., 2014).

Drought and salinity may lead to the development of osmoticstress (Bartels and Sunkara, 2005) and lipid peroxidation (Blokinaet al., 2003). Proline is a well-known osmolyte (Ashraf and Foolad,2007) acting as mediator of osmotic adjustment under stressconditions. The similar profile accumulation of proline in bothgenotypes suggested that diploid and doubled diploid Volkamerlemon respond in the same way through osmotic adjustment forsurvival under water deficit condition. Conversely, MDA, asmarker of lipid peroxidation, showed lower concentrations in4"VL than 2"VL plants during and after water deficit. This mayindicate activation of others mechanisms protecting the photo-synthetic membranes regardless of the observed inhibition ofphotosynthesis under water deficit conditions. A strong antioxi-dant system was reported by Zhang et al. (2010) in 4" Dioscorea

plants exposed to heat stress, and by Podda et al. (2013) in 4"citrus plants under salt stress. Enhanced functionality of anti-oxidants might therefore be common to polyploid plants, helpingthem cope with all forms of oxidative stress. Volatile isoprenoidsmight also be a component of the antioxidant system protectingphotosynthetic membranes in 4"VL trees, as HS-SPME analysisshowed that the VOC profile was characterized by high proportionof monoterpenoids in 4"VL plants and of oxygenated terpenoidsin 2"VL plants. Monoterpenoids are believed to cooperate withnon-volatile isoprenoids in scavenging ROS in leaves (Loreto andSchnitzler, 2010). However, water deficit did not cause anymodification in the profiles of VOCs emitted by the leaves from2"VL and 4"VL plants in the condition applied in this work. Thismay indicate that VOC profile is under a strong systematic controland that VOC accumulation of 2"VL and 4"VL plants areconstitutively different. Variation in monoterpenoid profilesclassified into different chemotypes has been reported to affectinsects and fungal pathogens (Michelozzi et al., 1995; Taft et al.,2015). Further investigations might clarify whether differences inmonoterpenoid profiles also have a role in the chemical defense ofdiploid and doubled diploids citrus plants.

The higher levels of lipid peroxidation observed in stressed andrehydrated 2"VL might explain the increased concentration of theGLV 2-hexenal also detected in the same plants. Savchenko andDehesh (2014) found that drought stress finely tuned the oxylipinspathway leading to increased amount of hexenal, without howeverconcurrently increasing hexenol, as typically observed afterwounding. We also found no changes in hexenol concentrationsboth in 2"VL and in 4"VL under water deficit. Hexenal originates

in the hydroperoxide lyase branch of the oxylipin pathway and isformed from fatty acids, mainly as consequence of membraneperoxidation (Matsui, 2006). Up-regulation of HPL, the geneencoding for hydroperoxide lyase, in stressed diploid plants but notin 4"VL plants supports the idea that 2-hexenal is an indicator ofmembrane denaturation in response to water deficit in 2"VLplants. However, gene expression study in rice in response todehydration revealed significant enhancement of the HPL geneexpression also in tolerant lines (Lenka et al., 2011). De Domenicoet al. (2012) reported that during acclimation of sensitive andtolerant pea varieties to water deficiency conditions, the tolerantplants activated components of the lipoxygenase pathwayincluding lipoxygenase, two HPLs, and AOS, faster and strongerthan the sensitive variety. The first enzyme in the pathway, HPL, isencoded by one or more HPL genes, differing in their subcellularlocalization, including microsomes (Pérez et al., 1999), lipid bodies(Mita et al., 2005), the outer envelope of chloroplasts (Froehlichet al., 2001), and in some cases, with no specific localization in aparticular organelle (Nordermeer et al., 2000). Thus, the differentHPL induction in 2"VL and 4"VL plants might depend by adifferential regulation of this pathway, perhaps in response todifferent water deficit effects in the two genotypes.

The GLV 2-hexenal and cis-hexenol should be rapidly emittedafter biotic (Bleé, 2002; Ninemeets et al., 2013) and abioticstresses (Loreto et al., 2006; Loreto and Schnitzler, 2010;Savchenko et al., 2014). Nevertheless, these compounds are moresoluble than non-oxygenated terpenoids, and can be stored insolution, especially when stomata are closed, in response tostresses (Ormeno et al., 2011). Indeed, Mano et al. (2010) foundincreased endogenous levels of (E)-2-pentenal and (E)-2-hexenalin leaves of photo-sensitive and photo-tolerant tobacco plantsunder photo-inhibitory illumination, suggesting that lipid per-oxidation had occurred, and Catola et al. (2015) found higherlevels of GLV in drought stressed than in control pomegranates. Itshould be noted that, according to some authors, 2-hexenalconcentration in leaves might also have a signaling function.Yamauchi et al. (2015) reported that vaporizing trans-2- hexenalrapidly but transiently increased the internal 2-hexenal concen-tration in Arabidopsis plants, and concluded that 2-hexenal mayact as a signaling molecule that induces stress-related genes suchas HSFA and DREB2A. In our experiment, the expression of aputative drought-related transcription factor DREB2A showed aresponse to the stress similar to 2-hexenal and HPL expression.Thus, it cannot be excluded that 2-hexenal also acts as signalingcompound triggering adaptation of the 2"VL genotype to waterdeficit.

5. Conclusion

In conclusion, we reported that VOC content may be underconstitutive, genetic control in citrus, and that the VOC relativeproportion may change with ploidy level. Whereas both 2"VL and4"VL plants were similarly negatively affected by a water deficit,the 4"VL genotype seemed to have less damage to thephotosynthetic membranes, that we also attribute to the mono-terpenoids characterizing its VOC profile. Our data provide newinsights in the understanding of the relationships between VOCand ploidy level in plants and the role of GLV in the response towater deficit in a non-model plant.

Acknowledgements

Dayse Drielly Souza Santana Vieira spent nine months at CNR-IPSP and one month at CIRAD-IVIA laboratories in the framework ofa doctorate sandwich financed by CAPES, http://www.capes.gov.br/(grant: CSF SDW-0268/13-5), Ciências Sem Fronteiras.

D.D.S.S. Vieira et al. / Environmental and Experimental Botany 126 (2016) 1–9 7

Appendix A. Supplementary data

Supplementary data associated with this article can befound, in the online version, at http://dx.doi.org/10.1016/j.envexpbot.2016.02.010.

References

Aleza, P., Froelicher, Y., Schwarz, S., Agustí, M., Hernández, M., Juárez, J., Luro, F.,Morillon, R., Navarro, L., Ollitrault, P., 2011. Tetraploidization events bychromosome doubling of nucellar cells are frequent in apomictic citrus and aredependent on genotype and environment. Ann. Bot. 108, 37–50.

Allario, T., Brumos, J., Colmenero-Flores, J.M., Tadeo, F., Froelicher, Y., Talon, M.,Navarro, L., Ollitrault, P., Morillon, R., 2011. Large changes in anatomy andphysiology between diploid Rangpur lime (Citrus limonia) and its autodoubleddiploids are not associated with large changes in leaf gene expression. J. Exp.Bot. 62, 2507–2519.

Allario, T., Brumos, J., Colmenero-Flores, J.M., Iglesias, D.J., Pina, J.A., Navarro, L., etal., 2013. Doubled diploids Rangpur lime rootstock increases drought tolerancevia enhanced constitutive root abscisic acid production. Plant Cell Environ. 36,856–868.

Ashraf, M., Foolad, M.R., 2007. Roles of glycine betaine and proline in improvingplant abiotic stress resistance. Environ. Exp. Bot. 59, 206–216.

Bartels, D., Sunkara, R., 2005. Drought and salt tolerance in plants. Crit. Rev. Plant Sci.24, 23–58.

Bates, L.S., Waldren, R.P., Teare, I.D., 1973. Rapid determination of free proline forwater stress studies. Plant Soil 39, 205–207.

Beauchamp, J., Wisthaler, A., Hansel, A., Kleist, E., Miebach, M., Niinemets, Ü., Schurr,U., Wildt, J., 2005. Ozone induced emissions of biogenic VOC from tobacco:relationships between ozone uptake and emission of LOX products. Plant CellEnviron. 28, 1334–1343.

Beest, M., Le Roux, J.J., Richardson, D.M., Brysting, A.K., Suda, J., Kubesova, M., Pysek,P., 2012. The more the better? The role of polyploidy in facilitating plantinvasions. Ann. Bot. 109, 19–45.

Blée, E., 2002. Impact of phyto-oxylipins in plant defense. Trends Plant Sci. 7, 315–321.

Blokina, O., Virolainen, E., Fagerstedt, K., 2003. Antioxidants, oxidative damage andoxygen deprivation stress: a review. Ann. Bot. 91, 179–194.

Brilli, F., Ruuskanen, T.M., Schnitzhofer, R., Müller, M., Breitenlechner, M., Bittner, V.,Wohlfahrt, G., Loreto, F., Hansel, A., 2011. Detection of plant volatiles after leafwounding and darkening by proton transfer reaction time-of-flight massspectrometry (PTR-TOF). PLoS One 6, e20419.

Brilli, F., Tsonev, T., Mahmood, T., Velikova, V., Loreto, F., Centritto, M., 2013.Ultradian variation of isoprene emission photosynthesis, mesophyllconductance and optimum temperature sensitivity for isoprene emission inwater-stressed. Eucalyptus citriodora saplings. J. Exp. Bot. 64, 519–528.

Catola, S., Marino, G., Emiliani, G., Huseynova, T., Musayev, M., Akparov, Z., Maserti,B.E., 2015. Physiological and metabolomic analysis of Punica granatum (L.) underdrought stress. Planta doi:http://dx.doi.org/10.1007/s00425-015-2414-1.

Centritto, M., Tognetti, R., Leitgeb, E., St!relcová, K., Cohen, S., 2011. Above groundprocesses: anticipating climate change influences. In: Bredemeier, M., Cohen, S.,Godbold, D.L., Lode, E., Pichler, V., Schleppi, P. (Eds.), Forest Management and theWater Cycle: An Ecosystem-Based Approach, 212. Springer Dordrecht,Ecological Studies, pp. 281–304.

Chaves, M.M., Pereira, J.S., Maroco, J., Rodrigues, M.L., Ricardo, C.P.P., Osorio, M.L., etal., 2002. How plants cope with water stress in the field? Photosynthesis andgrowth. Ann. Bot. 89, 907–916.

Cheung, W.H.K., Pasamontes, A., Peirano, D.J., et al., 2015. Volatile organiccompound (VOC) profiling of citrus tristeza virus infection in sweet orangecitrus varietals using thermal desorption gas chromatography time of flightmass spectrometry (TD-GC/TOF-MS). Metabolomics doi:http://dx.doi.org/10.1007/s11306-015-0807-6.

Copolovici, L., Kannaste, A., Pazouki, L., Niinemets, Ü., 2012. Emissions of green leafvolatiles and terpenoids from Solanum lycopersicum are quantitatively related tothe severity of cold and heat shock treatments. J. Plant Physiol. 169, 664–672.

Comai, L., 2005. The advantages and disvantages of being polyploid. Nat. Rev. Gen. 6,836–846.

Dai, A., 2010. Drought under global warming: a review. WIREs Clim. Change 2, 45–65.

De Domenico, S., Bonsegna, S., Horres, R., et al., 2012. Transcriptomic analysis ofoxylipin biosynthesis genes and chemical profiling reveal an early induction ofjasmonates in chickpea roots under drought stress. Plant Physiol. Biochem. 61,115–122.

Dicke, M., Loreto, F., 2010. Induced plant volatiles: from genes to climate change.Trends Plant Sci. 15, 115–117.

Dudareva, N., Pichersky, E., Gershenzon, J., 2004. Biochemistry of plant volatiles.Plant Physiol. 135, 1993–2011.

Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy andhigh throughput. Nucleic Acids Res. 32 (5), 1792–1797.

Fanciullino, A.-L., Gancel, A.-L., Froelicher, Y., Luro, F., Ollitrault, P., Brillouet, J.-M.,2005. Effects of nucleo-cytoplasmic interactions on leaf volatile compoundsfrom citrus somatic diploid hybrids. J. Agric. Food Chem. 53, 4517–4523.

Feussner, I., Wasternack, C., 2002. The lipoxygenase pathway. Ann. Rev. Plant Biol.53, 275–297.

Froehlich, J.E., Itoh, A., Howe, G.A., 2001. Tomato allene oxide synthase and fatty acidhydroperoxide lyase two cytochrome P450s involved in oxylipin metabolism,are targeted to different membranes of chloroplast envelope. Plant Physiol. 125,306–317.

Froelicher, Y., Bassene, J.B., Jedidi-Nej i, E., Dambier, D., Morillon, R., Bernardini, G., etal., 2007. Induced parthenogenesis in mandarin for haploid production:induction procedures and genetic analysis of plantlets. Plant Cell Rep. 26, 937–944.

Gancel, A.L., Ollitrault, P., Froelicher, Y., Tomi, F., Jacquemond, C., Luro, F., Brillouet, J.-M., 2003. Leaf volatile compounds of seven citrus somatic tetraploid hybridssharing Willowleaf mandarin (Citrus deliciosa Ten) as their common parent. J.Agric. Food Chem. 51, 6006–6013.

Hanover, J.W., 1992. Applications of terpene analysis in forest genetics. New For. 6,159–178.

Hodges, M., DeLong, J.M., Forney, C.F., Prange, R.K., 1999. Improving thethiobarbituric acid-reactive-substances assay for estimating lipid peroxidationin plant tissues containing anthocyanin and other interfering compounds.Planta 207, 604–611.

Hosni, K., Zahed, N., Chrif, R., Abid, I., Medfei, W., Kallel, M., Ben Brahim, N., Sebei, H.,2010. Composition of peel essential oils from four selected Tunisian Citrusspecies: evidence for the genotypic influence. Food Chem. 123, 1098–1104.

Jiang, A.M., Gan, L., Tu, Y., Ma, H.X., Zhang, J.M., Song, Z.J., et al., 2013. The effect ofgenome duplication on seed germination and seedling growth of rice under saltstress. Aust. J. Crop Sci. 7, 1814–1821.

Kramell, R., Miersch, O., Atzorn, R., Parthier, B., Wasternack, C., 2000. Octadecanoid-derived alteration of gene expression and the oxylipin signature in stressedbarley leaves: implications for different signaling pathways. Plant Physiol. 123,177–188.

Lenka, S.K., Katiyar, A., Chinnusamy, V., Bansa, K.C., 2011. Comparative analysis ofdrought-responsive transcriptome in Indica rice genotypes with contrastingdrought tolerance. Plant Biotechnol. J. 9, 315–327.

Levy, Y., Syvertsen, J.P., 2004. Irrigation water quality and salinity effects in citrustrees. Hortic. Rev. 30, 37–82.

Li, W.D., Biswas, D.K., Xu, H., Xu, C.Q., Wang, X.Z., Liu, J.K., et al., 2009. Photosyntheticresponses to chromosome doubling in relation to leaf anatomy in Lonicerajaponica subjected to water stress. Funct. Plant Biol. 36, 1–10.

Lin, S.Y., Roan, S.F., Lee, C.L., Chen, I.Z., 2010. Volatile organic components of freshleaves as indicators of indigenous and cultivated Citrus species in Taiwan. Biosci.Biotechnol. Biochem. 74, 806–811.

Loreto, F., Schnitzler, J.-P., 2010. Abiotic stresses and induced BVOCs. Trends PlantSci. 15, 154–166.

Loreto, F., Barta, C., Brilli, F., Nogues, I., 2006. On the induction of volatile organiccompound emissions by plants as consequence of wounding or fluctuations oflight and temperature. Plant Cell Environ. 29, 1820–1828.

Loreto, F., Bagnoli, F., Fineschi, S., 2009. One species: many terpenes: matchingchemical and biological diversity. Trends Plant Sci. 14, 416–420.

Lota, M.L., De Rocca Serra, D., Tomi, F., Casanova, J., 2000. Chemical variability of peeland leaf essential oils of 15 species of mandarins. Biochem. Syst. Ecol. 28, 61–78.

Lota, M.L., De Rocca Serra, D., Tomi, F., Casanova, J., 2001. Chemical variability of peeland leaf essential oils of 15 species of mandarins. Biochem. Syst. Ecol. 29, 77–104.

Luro, F., Costantino, G., Argout, X., Froelicher, Y., Terol, J., Talon, M., et al., 2008.Transferability of the EST-SSRs developed on Nules clementine (Citrusclementina Hort ex Tan) to other Citrus species and their effectiveness forgenetic mapping. BMC Genom. 9, 287.

Maja, M.M., Kasurinen, A., Yli-Pirilä, P., Joutsensaari, J., Klemola, T., Holopainen, T.,Holopainen, J.K., 2014. Contrasting responses of silver birch VOC emissions toshort- and long-term herbivory. Tree Physiol. 34, 241–252.

Mano, J., Tokushige, K., Mizoguchi, H., Fujii, H., Khorobrykh, S., 2010. Accumulationof lipid peroxide-derived toxic a,b-unsaturated aldehydes (E)-2-pentenal,acrolein and (E)-2-hexenal in leaves under photoinhibitory illumination. PlantBiotechnol. 27, 193–197.

Marino, G., Pallozzi, E., Cocozza, C., Tognetti, R., Giovannelli, A., Cantini, C., Centritto,M., 2014. Assessing gas exchange: sap flow and water relations using treecanopy spectral reflectance indices in irrigated and rainfed Olea europaea L.Environ. Exp. Bot. 99, 43–52.

Matsui, K., 2006. Green leaf volatiles: hydroperoxide lyase pathway of oxylipinmetabolism. Curr. Opin. Plant Biol. 9, 274–280.

Michelozzi, M., White, T.L., Squillace, A.E., Lowe, W.J., 1995. Monoterpenecomposition and fusiform rust resistance in slash and loblolly pines. Can. J. For.Res. 25, 193–197.

Mita, G., Quarta, A., Fasano, P., De Paolis, A., Di Sansebastiano, G.P., Perrotta, C., et al.,2005. Molecular cloning and characterization of an almond 9-hydroperoxidelyase, a new CYP74 targeted to lipid bodies. J. Exp. Bot. 56, 2321–2333.

Mouhaya, W., Allario, T., Brumos, J., Andrés, F., Froelicher, Y., Luro, F., et al., 2010.Sensitivity to high salinity in tetraploid citrus seedlings increases with wateravailability and correlates with expression of candidate genes. Funct. Plant Biol.37, 674–685.

Müller-Starck, G., Baradat, Ph., Bergmann, F., 1992. Genetic variation withinEuropean tree species. New For. 6, 23–47.

Nordermeer, M.A., Van Dijken, A.J., Smeekens, S.C., Veldink, G.A., Vliegenthart, J.F.,2000. Characterization of three cloned and expressed 13-hydroperoxide lyaseisoenzymes from alfalfa with unusual N-terminal sequences and differentenzyme kinetics. Eur. J. Biochem 267, 2473–2482.

8 D.D.S.S. Vieira et al. / Environmental and Experimental Botany 126 (2016) 1–9

Niinemets, Ü., Kännaste, A., Copolovici, L., 2013. Quantitative patterns betweenplant volatile emissions induced by biotic stresses and the degree of damage.Front. Plant Sci. 4, 1–15.

Ormeno, E., Goldstein, A., Niinemets, Ü., 2011. Extracting and trapping biogenicvolatile organic compounds stored in plant species. Trends Anal. Chem. 30, 978–989.

Pallozzi, E., Tsonev, T., Marino, G., Copolovici, L., Niinemets, Ü., Loreto, F., et al., 2013.Isoprenoid emissions, photosynthesis and mesophyll conductance in responseto blue light in Populus x canadensis, Quercus ilex and Citrus reticulata. Environ.Exp. Bot. 95, 50–58.

Pérez, A.G., Sanz, C., Olías, R., Olías, J.M., 1999. Lipoxygenase and hydroperoxidelyase activities in ripening strawberry fruits. J. Agr. Food Chem. 47, 249–253.

Plomion, C., Yani, A., Marpeau, A., 1996. Genetic determinism of 83-carene inmaritime pine using RAPD markers. Genome 39, 1123–1127.

Podda, A., Checcucci, G., Mouhaya, W., Centeno, D., Rofidal, V., Del Carratore, R., et al.,2013. Salt-stress induced changes in the leaf proteome of diploid and tetraploidmandarins with contrasting Na+ and Cl! accumulation behaviour. J. PlantPhysiol. 170, 1101–1112.

Raffa, K.F., Smalley, E.B., 1995. Interaction of pre-attack and induced monoterpeneconcentrations in host conifer defense against bark beetle-fungal complexes.Oecologia 102, 285–295.

Rao, M.N., Soneji, J.R., Chen, C., Huang, S., Gmitter Jr., F.G., 2008. Characterization ofzygotic and nucellar seedlings from sour orange-like citrus rootstock candidatesusing RAPD and EST-SSR markers. Tree Genet. Genom. 4, 113–124.

Ruiz, M., Pina, J.A., Alcayde, E., Morillon, R., Navarro, L., Primo-Millo, E., 2015.Behavior of diploid and tetraploid genotypes of ‘Carrizzo’ citrange under abioticstress. ISHS Acta Hortic. 1065: XII Int. Citrus Cong. – Int. Soc. Citriculture doi:http://dx.doi.org/10.17660/ActaHortic.2015.1065.163.

Savchenko, T., Dehesh, K., 2014. Drought stress modulates oxylipin signature byeliciting 12-OPDA as a potent regulator of stomatal aperture. Plant Signal.Behav. 9, e28304.

Savchenko, T., Kolla, V.A., Wang, C.-Q., Nasafi, Z., Hicks, D.R., Phadungchob, B., et al.,2014. Functional convergence of oxylipin and abscisic acid pathways controlsstomatal closure in response to drought. Plant Physiol. 164, 1151–1160.

Scala, A., Allmann, S., Mirabella, R., Haring, M.A., Schurink, R.C., 2013. Green leafvolatiles: a plant’s multifunctional weapon against herbivores and pathogens.Int. J. Mol. Sci. 14, 17781.

Sinclair, T.R., Ludlow, M.M., 1986. Influence of soil water supply on the plant waterbalance of four tropical grain legumes. Funct. Plant Biol. 13, 329–341.

Tadeo, F.R., Cercos, M., Colmenero-Flores, J.M., et al., 2008. Molecular physiology ofdevelopment and quality of citrus. Bot. Res. Incorporating Adv. Plant Pathol. 47,147–223.

Taft, S., Najar, A., Godbout, J., Bousquet, J., Erbilgin, N., 2015. Variation in foliarmonoterpenes across the range of jack pine reveal three widespreadchemotypes: implications to host expansion of invasive mountain pine beetle.Front. Plant Sci. 6, 342. doi:http://dx.doi.org/10.3389/fpls.2015.00342.

Yamauchi, Y., Kunishima, M., Mizutani, M., Sugimoto, Y., 2015. Reactive short-chainleaf volatiles act as powerful inducers of abiotic stress-related gene expression.Sci. Rep. 5, 1–8.

Velikova, V., La Mantia, T., Lauteri, M., Michelozzi, M., Nogues, I., Loreto, F., 2012. Theimpact of winter flooding with saline water on foliar carbon uptake and thevolatile fraction of leaves and fruits of lemon (Citrus x limon L. Burm. f.) trees.Funct. Plant Biol. 39, 199–213.

Zhang, X.Y., Hu, C.G., Yao, J.L., 2010. Tetraploidization of diploid Dioscorea results inactivation of the antioxidant defense system and increased heat tolerance. J.Plant Physiol. 167, 88–94.

D.D.S.S. Vieira et al. / Environmental and Experimental Botany 126 (2016) 1–9 9

39

Supplementary material

Metabolomic analysis reveals involvement of 2-hexenal in the response to water deficit of diploid Citrus volkameriana but not in the

respective doubled diploid plants.

Fig. S1. Water deficit experimental strategy for 2xVL and 4xVL. (A): Each plant is one biological replicate. The experiment consisted of

two treatments, control and water-stress and two genotypes (2xVL and 4xVL). (B): The physiological parameters were collected every two

40

days from 12 different plants (3 - 6 for each experimental condition and genotype). Volatile organic compounds were extracted from 3 plants at

T0- 100% FTSW T1- (about 51% FTSW), T2- (0% FTSW) and R- 24 hours after rehydration .

Fig.S2. GC-MS analysis of volatile compounds extracted by pentane from leaves of Volkamer lemon.

41

Table S1. Name, primer sequence of the SSR markers and size of amplified DNA fragments in Volkamer lemon with these markers

Forward primer (5'-3') Reverse primer (5'-3') cDNA ID

Allele size

(in bases)

MEST 308 CCTCTTCATTTTTCTCTGAAACTAA TTGCAACATCGTTCCTCTTG FC883472.1 253 - 262

MEST 356 CAAAATTCCATGGCTTGCTT GGCTTGGGAATTTGATTTGA FC909938.1 129 - 153

MEST 391 TGAAGTCCCTCCAAGAAAGC AGTCAGAGCCAGAGCCAGAG FC897601.1 160 - 166

MEST 502 TCAGCAGAAGAAGGAGACTCG CGGACATGGATGTAATCAGG FC893337.1 180 - 189

MEST 775 AGCTCCGTCTCCAGCATAAA CCACACACCCTTTTAACGAGA FC885563.1 148 - 150

MEST 910 TCCAAAACGACTCCCTTAACA GAAGCTGTGAGAGGCTTTGG FC913597.1 132 - 136

MEST 914 CAGCCTCCTCTCCCTTTCTT CAGCAATTCCGAGTGAGTGA FC896872.1 166 - 176

MEST 1047 AAACAAAATCAATGGCCGAG TGGGTTTATTGTTGGGCTGT FC881048.1 176 - 188

MEST 1344 GAAGCCAAGAAATGCATCGT AAAGGAGGGATGGTATTGCC FC896899.1 204 - 210

MEST 1361 GGAGATGTGCCATGGAAGTAA AAGATTACCAACAGGAGTTTATATGAG FC887186.1 140 - 156

MEST 1047 AAACAAAATCAATGGCCGAG TGGGTTTATTGTTGGGCTGT FC881048.1 176 - 188

MEST 1344 GAAGCCAAGAAATGCATCGT AAAGGAGGGATGGTATTGCC FC896899.1 204 - 210

MEST 1361 GGAGATGTGCCATGGAAGTAA AAGATTACCAACAGGAGTTTATATGAG FC887186.1 140 - 156

42

Table S2. Primers used for semi-quantitative gene expression analyses in Volkamer lemon. Primers were designed using the web-based

Primer3 software (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi). Constitutivelyexpressed cyclophilin (CYP) was amplified

as a reference gene; HPL, hydroperoxidelyase; DREB2a, dehydration-responsive element-binding protein 2A

Genename PCR product

size Forward primer sequence (5’–3’) Reverse primersequence (5’–3’)

DREB2A 239 GAAGAGTTCCGGCCAAGG ATTAAGCCGTGCACAAGGAC

HPL 204 TTCTCCATGCTCGACAAGTG TGTTAGCCCAAACTCGTCCT

CYP 111 CGGATCTCAGTTCTTCGTCTG ACTTTCTCGATGGCCTTGAC

43

AY063972.1_A.thaliana_putative_DREB2A_protein ATGGCAGTTTATGATCAGAGTGGAGATAGAAACAGAACACAAATTGATACATCGAGGAA-

XM006486183.1_C.sinensis_dehydration-responsive_element ATGGCTATT------CAAAGCAAAGATTCTTCTCCGTCTCTTA-TGATGCCACTGAGTAG

C.volkameriana_sequenced_amplicon ------------------------------------------------------------

AY063972.1_A.thaliana_putative_DREB2A_protein ---AAGGAAATCTAGAAGTAGAGGTGACGGTACTACTGTGGCTGAGAGATTAAAGAGATG

XM006486183.1_C.sinensis_dehydration-responsive_element TGACAGGAAAAGGAAACGAAGAGATGGCGT---TAATGTTGCTGAGACTCTTGAACGGTG

C.volkameriana_sequenced_amplicon ------------------------------------------------------------

AY063972.1_A.thaliana_putative_DREB2A_protein GAAAG-------AGTATAAC--GAGACCG---TAGAAGAAGTTTCTACCAAGAAGAGGAA

XM006486183.1_C.sinensis_dehydration-responsive_element GAGGCGATATAATGAATCGCTTGAATCTGGCAATGGCGAG-GATAAACCA--ATGAGAAG

C.volkameriana_sequenced_amplicon --------------------------------------------------------GAAG

*.*.

AY063972.1_A.thaliana_putative_DREB2A_protein AGTACCTGCGAAAGGGTCGAAGAAGGGTTGTATGAAAGGTAAAGGAGGACCAGAGAATAG

XM006486183.1_C.sinensis_dehydration-responsive_element AGTTCCGGCCAAGGGTTCGAAAAAGGGTTGTATGAAAGGTAAAGGAGGACCGGAGAATGG

C.volkameriana_sequenced_ampliconAGTTCCGGCCAAGGGTTCGAAAAAGGGTTGTATGAAAGGTAAAGGAGGACCGGAGAATGG

***:** ** **.** *****.*****************************.******.*

AY063972.1_A.thaliana_putative_DREB2A_protein CCGATGTAGTTTCAGAGGAGTTAGGCAAAGGATTTGGGGTAAATGGGTTGCTGAGATCAG

XM006486183.1_C.sinensis_dehydration-responsive_element ACGGTGTGATTATCGAGGTGTGAGGCAGAGGACCTGGGGTAAGTGGGTTGCGGAGATAAG

C.volkameriana_sequenced_ampliconACGGTGTGATTATCGAGGTGTGAGGCAGAGGACCTGGGGTAAGTGGGTTGCGGAGATAAG

.**.***..**: .****:** *****.**** ********.******** *****.**

AY063972.1_A.thaliana_putative_DREB2A_protein AGAGCCTAATCGAGGTAGCAGGCTTTGGCTTGGTACTTTCCCTACTGCTCAAGAAGCTGC

XM006486183.1_C.sinensis_dehydration-responsive_element GGAGCCAAACAGGGGAAATAGGCTATGGCTTGGTACTTTTCCAAGTGCTGTTGAGGCTGC

C.volkameriana_sequenced_ampliconGGAGCCAAACAGGGGAAATAGGCTATGGCTTGGTACTTTTCCAAGTGCTGTTGAGGCTGC

.*****:** .*.**:*. *****:************** **:* **** ::**.*****

AY063972.1_A.thaliana_putative_DREB2A_protein TTCTGCTTATGATGAGGCTGCTAAAGCTATGTATGGTCCTTTGGCTCGTCTTAATTTCCC

44

XM006486183.1_C.sinensis_dehydration-responsive_element CCTTGCTTATGATCATGCTGCTAGGGCTATGTATGGTCCTTGTGCACGGCTTAATTTGCC

C.volkameriana_sequenced_ampliconCCTTGCTTATGATCATGCTGCTAGGGCTATGTATGGTCCTTGTGCACGGCTTAAT-----

********** * *******..**************** **:** ******

AY063972.1_A.thaliana_putative_DREB2A_protein T-CGGTC-----------TGATGCGTCTGAGG---------TTACGAGTACCTCAAGTCA

XM006486183.1_C.sinensis_dehydration-responsive_element CGATGTTTCAAGATTGAATGAGTCTTCGAAGGATTCTGATTCAACGACGTCATCAAACCA

C.volkameriana_sequenced_amplicon------------------------------------------------------------

AY063972.1_A.thaliana_putative_DREB2A_protein GTCTGAGGTGTG---TACTGTTGAGACTCCTGGTTGTGTTCATGTGAAAACAGAGGATCC

XM006486183.1_C.sinensis_dehydration-responsive_element GTCTGAGATTGAGGATGCTAAAGTGAAGA--------------ATGACGCAAGAGAAGCC

C.volkameriana_sequenced_amplicon------------------------------------------------------------

AY063972.1_A.thaliana_putative_DREB2A_protein AGATTGTGAATCTAAACCCTTCTCCGGTGGAGTGGAGCCGAT---GTATTGTCTGG----

XM006486183.1_C.sinensis_dehydration-responsive_element GAATCTAAAATAATTGCCCAAC--CTGAGGCCGAGTTACTAAGTAGTCCAGTCAAACCAA

C.volkameriana_sequenced_amplicon ------------------------------------------------------------

AY063972.1_A.thaliana_putative_DREB2A_protein ---AGAATGGTGCGGAAGAGATGAAGAGAGGTGTTAAAGCGGATAAGCATTGGCTGAGCG

XM006486183.1_C.sinensis_dehydration-responsive_element AAGCTAAAGATGAGGCTGAGGA--------------------------------------

C.volkameriana_sequenced_amplicon ------------------------------------------------------------

AY063972.1_A.thaliana_putative_DREB2A_protein AGTTTGAACATAACTATTGGAGTGATATTCTGAAAGAGAAAGAGAAACAGAAGGAGCAAG

XM006486183.1_C.sinensis_dehydration-responsive_element -TAATGAAAAGTACTACTGGGGTGAACAGCTAGAT-----TGCAAGCCGG---AAGCAAG

C.volkameriana_sequenced_amplicon ------------------------------------------------------------

Fig. S3. Alignment of Arabidopsis thaliana DREB2A gene mRNA, Citrus sinensis dehydration responsive element, and Citrus x

volkameriana DREB2 fragment sequenced in this work (green) and used for mRNA accumulation analyses. Specific DREB2A motif, bold;

EREB/AP2 domain, underline; primer annealing regions (red).

45

DQ866816_C_aurantium_HPL GACACACTGTTCGACACCGTCGAGAAGGAACTCTCCGAAAAGAACAGCATAAGCTACATG

NM_001288924_C_sinensis_HPL GACACACTGTTCGACACCGTCGAGAAAGAGCTCTCCGAAAAGAACAGCATAAGCTACATG

C.volkameriana_sequenced_amplicon ------------------------------------------------------------

DQ866816_C_aurantium_HPL GTCCCTTTACAAAAATGCGTCTTTAACTTCCTCTCAAAATCGATCGTGGGAGCCGACCCA

NM_001288924_C_sinensis_HPL GTCCCTTTACAAAAATGCGTCTTTAACTTCCTCTCAAAATCGATCGTGGGAGCCGACCCA

C.volkameriana_sequenced_amplicon ------------------------------------------------------------

DQ866816_C_aurantium_HPL AAAGCCGACGCCGAAATCGCCGAGAACGGCTTCTCCATGCTCGACAAGTGGCTGGCCTTG

NM_001288924_C_sinensis_HPL AAAGCCGACGCCGAAATCGCCGAGAACGGCTTCTCCATGCTCGACAAGTGGCTGGCCTTG

C.volkameriana_sequenced_amplicon ------------------------------TTCTCCATGCTCGACAAGTGGCTGGCCTTG

******************************

DQ866816_C_aurantium_HPL CAGATCCTGCCCACAGTCAGCATAAACATCTTGCAGCCCCTTGAAGAGATCTTTCTTCAC

NM_001288924_C_sinensis_HPL CAGATCCTGCCCACAGTCAGCATAAACATCTTGCAGCCCCTTGAAGAGATCTTTCTTCAC

C.volkameriana_sequenced_ampliconCAGATCCTGCCCACAGTcaGCATAAACATCTTGCAGCCCCTTGAAGAGATCTTTCTTCAC

************************************************************

DQ866816_C_aurantium_HPL TCTTTTGCTTACCCTTTTGCCCTTGTCAGTGGAGACTACAACAAGCTCCACAACTTCGTT

NM_001288924_C_sinensis_HPL TCTTTTGCTTACCCTTTTGCCCTTGTCAGTGGAGACTACAACAAGCTCCACAACTTCGTT

C.volkameriana_sequenced_ampliconTCTTTTGCTTACCCTTTTGCCCTTGTCAGTGGAGACTACAACAAGCTCCACAACTTCGTT

************************************************************

DQ866816_C_aurantium_HPL GAAAAGGAAGGCAAAGAAGTTGTGCAGCGGGGGCAGGACGAGTTTGGGCTAACAAAAGAA

NM_001288924_C_sinensis_HPL GAAAAGGAAGGCAAAGAAGTTGTGCAGCGGGGGCAGGACGAGTTTGGGCTAACAAAAGAA

C.volkameriana_sequenced_amplicon GAAAAGGAAGGCAAAGAAGTTGTGCAGCGGGGGCAGGACGAGTTTGGGCTAACA------

******************************************************

46

DQ866816_C_aurantium_HPL GAAGCCATTCACAACTTGCTGTTCATTCTAGGGTTTAATGCTTTCGGTGGGTTCTCTATT

NM_001288924_C_sinensis_HPL GAGGCCATTCACAACTTGCTGTTCATTCTAGGGTTTAATGCTTTCGGTGGGTTCTCTATT

C.volkameriana_sequenced_amplicon ------------------------------------------------------------

DQ866816_C_aurantium_HPL TTTTTGCCAAAGCTGATTAATGCAATTGCTAGTGACACAACTGGGTTGCAGGCAGAGTTA

NM_001288924_C_sinensis_HPL TTGTTGCCAAAGCTGATTAATGCAATTGCTAGTGACACAACTGGGTTGCAGGCAAAGTTA

C.volkameriana_sequenced_amplicon ------------------------------------------------------------

DQ866816_C_aurantium_HPL AGAAGTGAAGTGAAAGAGAAATGTGGGACATCCGCCTTGACTTTTGAGTCAGTCAAGAGT

NM_001288924_C_sinensis_HPL AGAAGTGAAGTGAAAGAGAAATGTGGGACATCCGCCTTGACTTTTGAGTCAGTCAAGAGT

C.volkameriana_sequenced_amplicon ------------------------------------------------------------

DQ866816_C_aurantium_HPL CTAGAGTTGGTTCAGTCTGTGGTTTGCGAAACTCTGAGACTTAACCCACCGGTTCCTCTC

NM_001288924_C_sinensis_HPL CTAGAGTTGGTTCAGTCTGTGGTTTACGAAACTCTGAGACTTAACCCACCGGTTCCTCTC

C.volkameriana_sequenced_amplicon ------------------------------------------------------------

Fig.S4. Alignment of Citrus sinensis and Citrus aurantium, hydroperoxidelyase (HPL) gene mRNA and Citrus volkameriana fragment

sequenced in this work (green) and used for mRNA accumulation analyses. Primer annealing regions are highlighted (red).

47

CAPÍTULO 2:

Survival strategies of citrus rootstocks subjected to drought

(Artigo submetido à Plant & Cell Physiology em 15/01/2016)

48

Survival strategies of citrus rootstocks subjected to drought

Dayse Drielly Souza Santana-Vieira1, Luciano Freschi2, Lucas Aragão da

Hora Almeida1, Diana Matos Neves1, Diogo Henrique Santos de Moraes1, Liziane

Marques dos Santos3,5, Fabiana Zanelato Bertolde4, Walter dos Santos Soares

Filho5, Maurício Antônio Coelho Filho5, Abelmon da Silva Gesteira1,5

1 – Departamento de Biologia, Centro de Genética and Biologia Molecular,

Universidade Estadual de Santa Cruz, Ilhéus – Bahia, 45662-900, Brazil 2 – Departamento de Botânica, Instituto de Biociências, Universidade de

São Paulo, São Paulo 05508-090, Brazil 3 – Departamento de Ciências Agrárias, Universidade Federal do

Recôncavo da Bahia, Cruz das Almas - Bahia, 44380-000, Brazil 4 – Departamento de Ensino, Instituto Federal da Bahia – Campus

Eunápolis, Eunápolis - Bahia, 45823-431, Brazil 5 – Embrapa – Mandioca e Fruticultura, Cruz das Almas - Bahia, 44380-

000, Brazil

Corresponding author:

Abelmon da Silva Gesteira - abelmon.gesteira@embrapa.br

Telephone: +55(75)3312-8046 / Fax: +55(75)3312-8097

Abbreviations: Sunki Maravilha mandarin - SM

Rangpur lime - RL

Valencia orange - VO

Tahiti acid lime - TAL

reactive oxygen species - ROS

systemic acquired acclimation - SAA

leaf water potential - ΨL

49

leaf osmotic potential - Ψπ

soil matric potentials - soil Ψ

photosynthetic rate - A

stomatal conductance - Gs

transpiration rate - E

intrinsic water use efficiency - A/Gs

water use efficiency - A/E

salicylic acid – SA

50

MANUSCRIPT TITLE: Survival strategies of citrus rootstocks subjected to

drought

Abstract

In the present study, Citrus limonia Osb. (Rangpur lime - RL) and Citrus sunki

(Sunki Maravilha mandarin - SM) rootstocks were tested, either ungrafted or

grafted with their reciprocal graft combinations (SM/RL and RL/SM) or with

shoot scions of two commercial citrus varieties: Citrus sinensis (L.) Osb.

(Valencia orange - VO) and Citrus latifolia Tanaka (Tahiti acid lime - TAL). All

the combinations were subjected to drought through gradual decreases in soil

water content. RL adopted a dehydration avoidance strategy and maintained

growth, whereas SM adopted a dehydration tolerance strategy focused on plant

survival. Compared with RL, the leaves and roots of SM exhibited higher

concentrations of abscisic acid (ABA) and salicylic acid (SA), which induce

drought tolerance, and of carbohydrates such as trehalose and raffinose, which are

reported to be important reactive oxygen species (ROS) scavengers. SM

rootstocks adopted a dehydration tolerance strategy in response to drought when

ungrafted, and the same strategy was induced in RL, VO and TAL shoot scions.

RL rootstocks are widely used by Brazilian citrus producers, and SM and its

derivatives may be an alternative for genetic diversification. However, because of

their different survival strategies, RL reaches the permanent wilting point more

quickly than SM, and SM may recover from prolonged droughts, such as those

predicted for upcoming years, more efficiently than RL. The present study is one

of the most complete studies of drought tolerance mechanisms in citrus crops and

is the first to use reciprocal grafting to clarify scion/rootstock interactions.

51

Keywords: Citrus plants, drought stress, interaction scion/rootstock, reciprocal

grafting, rootstock, survival strategy.

Introduction

Citrus crops are widespread and have great importance worldwide (Wu et

al., 2013). Because they are perennial crops grown in orchards with long

production periods (Molinari et al., 2004), citrus crops are subjected to several

biotic and abiotic stresses. Drought is one of the most threatening abiotic factors

for citrus cultivation, causing decreased plant growth, development and

productivity (Osakabe et al., 2014). In addition, drought severity and/or intensity

is increasing worldwide (Shukla et al., 2012).

Rootstock selection and improvement with the goal of increasing plant

water use efficiency is an efficient strategy to minimize the effects of climate

changes on plant production (Berdeja et. al, 2015). Grafting is a millenary

technique widely used in several different cultures (Mudge et al., 2009). A recent

study showed the importance of rootstocks for food security by increasing the

efficiency of natural (water and soil) resource utilization and decreasing the use of

chemical inputs (Albacete et al., 2015). Rootstocks increase the resistance of

citrus crops to biotic and abiotic factors (Garcia-Sanchez et al., 2007; Rodrígues-

Gamir et al., 2010; Machado et al., 2013). In the case of drought, this resistance is

due to physiological changes that lead to changes in leaf water potential, stomatal

conductance and hydraulic conductance (Romero el al., 2006; Garcia-Sanchez et

al., 2007; Rodrígues-Gamir et al., 2011).

Drought-associated dehydration results from an imbalance between root

water uptake and water loss via transpiration; the result is a decrease in gas

52

exchange and, consequently, in photosynthetic rates (Arbona et al., 2005; Garcia-

Sanchez et al., 2007; Aroca et al., 2012; Mittler and Blumwald, 2015). Perception

and signal transduction of abiotic stresses, including drought, is initiated by a

signaling cascade termed systemic acquired acclimation (SAA) (Mittler and

Blumwald, 2015). SAA results from plant physiological responses that may

include changes at the transcriptional, proteomic and post-transcriptional

modification levels, as well as metabolic changes and/or metabolite accumulation

(Verslues et al., 2006). These responses to abiotic stresses may be, for example,

hormonal changes (Koshita and Takahara, 2004; Arbona et al., 2008; Pérez-

Clemente et al., 2012; Ollas et al., 2012) or the accumulation of solutes and/or

carbohydrates (Verslues et al., 2006; Peters et al., 2007; Tardieu et al., 2011).

Depending on their intrinsic characteristics, plants may adopt different

strategies to cope with drought periods. These different strategies can be divided

into two major categories, dehydration avoidance and dehydration tolerance,

which involve different physiological processes (Levit, 1972; Verslues et al.,

2006; Lawlor, 2013). Dehydration avoidance comprises multiple strategies to

prevent water loss, such as solute accumulation and cell wall hardening.

Dehydration tolerance involves mechanisms to avoid cell damage caused by water

loss, such as synthesis of osmoprotectant proteins and solutes, metabolic changes,

and detoxification of reactive oxygen species (ROS) (McDowell et al., 2008;

Claeys and Inzé, 2013). Whereas dehydration avoidance is focused on the

maintenance of plant growth and productivity, dehydration tolerance is focused on

plant survival, especially during prolonged drought (Verslues et al., 2006). Zhoa

et al. (2015) evaluated different cassava cultivars under drought conditions and

reported that the plants that adopted survival strategies exhibited stomatal closure,

53

decreased shoot growth, the diversion of carbon and energy to the storage and

biosynthesis of protective compounds. Plants that adopted growth maintenance

strategies showed reprogramming of energy metabolism, osmotic adjustment, and

maintenance of cell wall flexibility (Claeys and Inzé, 2013).

Rangpur lime (RL) and Sunki Maravilha mandarin (SM) rootstocks

exhibit different patterns of soil water uptake and protein profiles under drought

conditions (Neves et al., 2013; Oliveira et al., 2015), indicating different drought

survival strategies. This discrepancy prompted us to investigate the influence of

scions on rootstocks, and vice versa. These interactions were investigated using

reciprocal grafting between these two citrus crops (SM/RL and RL/SM). In

addition, the behavior of the reciprocal grafts was compared with that of the

commercial scions Valencia orange (VO) and Tahiti acid lime (TAL) grafted onto

RL and SM rootstocks.

The gas exchange measurements and hormonal and carbohydrate profiles

obtained in the present study confirmed that RL and SM rootstocks adopt different

strategies to cope with drought stress. Whereas RL tried to maintain growth and

productivity by adopting a dehydration avoidance strategy, SM exhibited

dehydration tolerance mechanisms, which help plants to survive, especially during

longer drought periods. To our knowledge, the present study is the first to use

reciprocal grafting to clarify scion/rootstock interactions. Furthermore, the present

results showed that the rootstocks tested, especially SM, influenced the VO, TAL,

and reciprocal scions, which exhibited similar behavior to the ungrafted

rootstocks. The present study is one of the most complete studies of drought

tolerance mechanisms in citrus crops.

54

Results

Morphological and physiological responses of eight different

scion/rootstock combinations subjected to drought

Drought was induced by withholding water supply to plants. Plants

reached severe stress, as indicated by the leaf water potential (ΨL ≤ -2.0 MPa), on

different days. During the experiment, the air relative humidity decreased slightly;

however, no sudden changes in climate conditions were observed (Fig. 1).

Leaf area values of drought-exposed plants before and after drought

application, for all the scion/rootstock combinations tested, indicated no

significant interactions between plant combination and water availability

conditions, except for comparison group 2 (Fig. 2). In comparison group 2, the

RL/SM combination exhibited a 54.5% decrease in leaf area following drought

compared to the control, which was significantly different from SM/RL under the

same conditions (Fig. 2B). Significant differences in leaf area between the

beginning and end of the experiment were observed for the TAL/RL combination

only, with a 31.5% decrease (Fig. 2D).

All plants were harvested at soil Ψ values lower than -1.5 MPa (theoretical

wilting point) and at leaf water potential (ΨL) values ≤ -2.0 MPa (Figs. 3A-D and

4), which indicates severe drought stress and was adopted as the threshold ΨL

value for plant harvest in the present study (Fig. 3A-D). All control plants,

independent of the combination, exhibited ΨL ≥ -0.5 MPa. Similar values were

observed following 48-h rehydration.

A significant interaction between plant combination and drought treatment

was observed for leaf osmotic potential (Ψπ) exclusively in comparison groups 1

(Fig. 3E) and 2 (Fig. 3F). Ψπ was significantly lower for SM than for RL

55

following rehydration. RL exhibited significantly different Ψπ values under severe

drought, under control conditions, and following rehydration. For SM, the Ψπ

values under control conditions were significantly different from the Ψπ values

under the remaining water availability conditions. Regarding the reciprocal graft

combinations (group 2), SM/RL exhibited significantly lower Ψπ under severe

drought than under control conditions and following rehydration, whereas no

significant differences were observed for RL/SM. Except for ungrafted SM, no

significant differences between different water availability conditions were

observed for plants with SM roots (RL/SM, VO/SM and TAL/SM) for any of the

tested genotypes. This result indicates that SM roots can determined plant

behavior during severe drought stress. All the combinations with RL roots,

including ungrafted RL, exhibited significantly lower Ψπ under severe drought

than under control conditions or following rehydration. This finding indicates that

plants with RL roots exhibited osmotic adjustment compared to plants with SM

roots.

Net photosynthetic rate (A), stomatal conductance (Gs), transpiration rate

(E) decreased under severe drought compared to control plants or following 24-h

rehydration for all tested plant combinations (Table 1). Significant differences in

A were observed only for the comparison between RL and SM (Table 1), with SM

exhibiting higher A following 24-h rehydration. Significant differences in A

between different water availability conditions were observed for all plant

combinations tested, except for the comparison between TAL/RL and TAL/SM,

which revealed significant differences between severe drought and following

rehydration, with A being higher for TAL/SM. It should be noted that no

significant differences in A were observed between plants with RL and SM roots

56

under control conditions; however, plants with RL or SM roots exhibited

pronounced decreases (78-100%) in A under severe drought compared to control

conditions. Following rehydration, A increased 30.2- (RL), 71.6- (SM/RL), 6.9-

(VO/RL) and 299.8-fold (TAL/RL) compared to plants under severe drought

stress for plants with RL roots, and 4.6- (SM), 6.1- (RL/SM), 4.0- (VO/SM) and

2.6-fold (TAL/SM) for plants with SM roots.

SM exhibited Gs values almost twice as high as RL following 24-h

rehydration and no significant differences were observed among the remaining

genotypes (Table 1). However, significant differences between different water

availability conditions were observed for all plant combinations. Significant

differences in E between different water availability conditions were observed for

each plant combination (Table 1). For groups 1 (RL and SM), 2 (SM/RL and

RL/SM), and 4 (TAL/RL and TAL/SM), the highest E values were observed

under control conditions, followed by rehydration and then severe drought. For

group 3 (VO/RL and VO/SM), E under severe drought was significantly different

from the control treatment and following 24-h rehydration, but not between the

latter two treatments. Two observations regarding transpiration rates should be

highlighted. First, plants with RL roots exhibited a stronger recovery of

transpiration rates following 24-h rehydration than plants with SM roots, with E

values 7.4- (RL), 7.2- (SM/RL), 4.1- (VO/RL) and 4.9-fold (TAL/RL) higher than

under severe drought stress. Plants with SM roots exhibited E values 2.8- (SM),

3.6- (RL/SM), 3.4- (VO/SM) and 1.9-fold (TAL/SM) higher following

rehydration than under severe drought stress. Second, the TAL/SM combinations

exhibited the highest transpiration rates during severe drought, which were

significantly different from those of TAL/RL. This finding is consistent with the

57

photosynthetic rates and stomatal conductance results for these plant combinations

(Table 1).

Significant interactions for intrinsic water use efficiency (A/Gs) were

observed for all the comparison groups (Table 1). It should be noted that A and Gs

were markedly higher for plants with SM roots than for plants with RL roots

under severe drought. No significant differences were observed between plants

with RL and SM roots under control conditions or following 24-h rehydration. For

instant efficiency of water use (A/E), significant differences were observed

between RL and SM only, with higher levels for SM following rehydration and

under severe drought. For group 2 (SM/RL and RL/SM), only SM/RL exhibited

significant differences in A/E between severe drought stress and under control

conditions or following rehydration. For groups 3 (VO/RL and VO/SM) and 4

(TAL/RL and TAL/SM), and also for VO/RL and TAL/RL significant differences

between all the tested water availability conditions were observed for, whereas

VO/SM and TAL/SM exhibited significant differences between the control

treatment and severe drought or following rehydration, but not between the latter

two conditions.

Drought-induced changes in hormone levels

Plant hormones are regulated by environmental changes and by simulated

stress conditions, such as drought. Overall, drought, especially severe drought,

affected hormone concentrations in all the plant combinations, resulting in

decreased or increased concentrations, depending on the hormone (Fig. 5). In

addition, hormone concentrations were observed to be higher in leaves than in

roots, especially under control conditions, in all plant combinations. Except for

the leaf IAA and SA concentrations in SM/RL, plants with SM roots (ungrafted or

58

grafted) exhibited significantly higher or similar concentrations of all tested

hormones compared to plants with RL roots (ungrafted or grafted) under control

conditions. In addition, rootstocks were observed to influence scion behavior, and

vice versa. This finding was particularly evident for the comparisons between the

reciprocal graft combinations SM/RL and RL/SM (Fig. 5B, F, J, N, R and V),

confirming the importance of scion/rootstock interactions for plant development

and survival in different environments and/or stress conditions.

Both leaf and root ABA concentrations increased under severe drought for

all plant combinations (Fig. 5A-H). This result is in agreement with the decreased

stomatal conductance observed under the same conditions. The only exception

was RL, which exhibited no significant differences in leaf ABA content between

the different water availability conditions. Notably, plants with SM roots

(ungrafted or grafted) exhibited higher ABA concentration than plants with RL

roots (ungrafted or grafted) under both severe drought stress and control

conditions, which may indicate an influence of rootstocks on scion behavior.

Furthermore, the influence of scions on rootstock behavior was confirmed by the

finding that the reciprocal graft combination SM/RL exhibited pronouncedly

higher ABA levels than RL (ungrafted); the difference was not as pronounced for

the remaining tested scions grafted onto RL. Similar ABA levels were observed

for RL/SM and the ungrafted SM.

Overall, IAA content decreased under severe drought stress compared to

control conditions (Fig. 5I-P). This finding is in agreement with the increases

observed in ABA concentrations (Fig. 5A-H) because ABA and IAA have been

demonstrated to antagonistically interact during drought-induced responses

(Dunlap and Binzel, 1996; Niculcea et al., 2013). It should be noted that under

59

control conditions, plants with SM roots (ungrafted or grafted) exhibited higher

leaf and/or root IAA levels than plants with RL roots. However, SM/RL exhibited

higher leaf IAA content under control conditions than the reciprocal graft

combination RL/SM (Fig. 5J), demonstrating the influence of scions on rootstock

behavior.

SA levels increased under severe drought in all plant combinations (Fig.

5Q-Z), except for RL (Fig. 5Q) and RL/SM (Fig. 5R) in leaves, and SM/RL (Fig.

5V), VO/RL (Fig. 5X) and TAL/RL (Fig. 5Z) in roots. It should be highlighted

that the plants with SM roots (ungrafted or grafted) exhibited higher root SA

concentrations than those with RL roots (ungrafted or grafted) under severe

drought stress (Fig. 5U-Z). Higher leaf SA under severe drought were also

observed for SM (Fig. 5Q) and TAL/SM (Fig. 5T) compared to RL (Fig. 5Q) and

TAL/RL (Fig. 5T), respectively. This finding is interesting because SA is very

important for plant defense signaling in response to biotic and abiotic stresses,

such as drought (Horváth et al., 2007; Miura et al., 2013; Okuma et al., 2014).

Drought-induced changes in carbohydrate profile

Osmoprotection is essential to the maintenance of cell activity during

drought stress. Carbohydrates play an important role as osmoprotectants in the

maintenance of cell turgor (Salerno and Curatti, 2003; Peshev and Van den Ende,

2013). The leaf and root concentrations of raffinose, trehalose, galactose, fructose,

glucose and sucrose for the eight plant combinations and three water availability

conditions evaluated are presented in Table 2. Overall, drought resulted in

increased carbohydrate concentrations. Raffinose, trehalose and galactose

concentrations were higher in roots than in leaves, whereas fructose, glucose and

sucrose concentrations were similar in leaves and roots.

60

Except for RL, SM/RL and TAL/RL, all plant combinations exhibited

increased leaf raffinose under severe drought, which was particularly evident in

plants with SM roots (Table 2). Except for TAL/SM, all plant combinations with

SM roots exhibited significantly higher raffinose content under severe drought;

these concentrations decreased to levels similar to the control treatment following

48-h rehydration.

Fluctuations in trehalose levels resembled those observed for raffinose

levels. In all plants with SM roots (ungrafted or grafted), leaf and root trehalose

levels increased under severe drought and then decreased following 48-h

rehydration (Table 2). No significant differences in leaf trehalose content between

the three water availability conditions were observed for plants with RL roots

(ungrafted or grafted). Root trehalose content under different water availability

conditions was significantly higher following 48-h rehydration for SM/RL, and

under severe drought stress for VO/RL.

For leaf galactose, significant differences were observed only between RL

and SM and between their reciprocal grafts, SM/RL and RL/SM, whereas

significant differences in root galactose were observed between VO/RL and

VO/SM and between TAL/RL and TAL/SM (Table 2). Sucrose is formed by the

combination of fructose and glucose, and overall, the concentrations of these three

carbohydrates followed similar tendencies. Interestingly, in plants with SM roots,

the leaf concentrations of fructose, glucose and sucrose increased under severe

stress and decreased again following 48-h rehydration (Table 2). Root fructose

and sucrose levels exhibited a tendency similar to that observed for leaves, with

increased concentrations under severe drought stress. However, root glucose

increased following 48-h rehydration in plants with SM roots.

61

Discussion

In the present work, drought caused marked changes in leaf water

potential, leaf osmotic potential, gas exchange, and hormone and carbohydrate

profiles in the tested plant combinations. RL and SM rootstocks were selected

based on previous studies indicating their different behaviors when subjected to

drought stress (Neves et al., 2013; Oliveira et al., 2015). In the present study,

reciprocal graft combinations (SM/RL and RL/SM) were used to further

investigate scion/rootstock interactions. In addition, two commercial scions were

used, Valencia orange (VO) and Tahiti acid lime (TAL), which were grafted onto

SM and RL rootstocks to compare the behavior of the two rootstocks under the

same scion.

Changes and interactions between gas exchange and hormone and

carbohydrate profiles under drought

Among the first drought-induced responses in plants, stomatal closure (to

avoid water loss) and an increased root:shoot ratio (Claeys and Inzé, 2013) are

considered critically important for plant survival. However, during longer periods

of drought, plants lose the ability to balance water uptake and loss, and leaf water

potential (ΨW) decreases. Two strategies may then be adopted: (i) dehydration

avoidance or (ii) dehydration tolerance. Dehydration avoidance is characterized

by solute accumulation and cell wall hardening to decrease water loss.

Dehydration tolerance involves the production of protective solutes and proteins,

metabolic changes and ROS detoxification to avoid damages caused by cellular

water loss (Verslues et al., 2006). In the present study, the tested rootstocks, RL

and SM, were observed to exhibit different strategies to tolerate/survive drought.

62

Both tested rootstocks, RL and SM, and their different graft combinations

exhibited decreased leaf water potential (ΨW; Fig. 3A-D) and soil matric potential

(Fig. 4A-D), indicating that they were affected by the severe drought treatment. In

addition, A, Gs and E were observed to decrease under severe drought in all plant

combinations (Table 1). Similar findings have been previously reported for

different citrus plants under drought conditions (Romero et al., 2006; Allario et

al., 2011). It should be highlighted that no significant differences in A, Gs or E

were observed between RL and SM rootstocks (grafted or ungrafted) under

control conditions, indicating that RL and SM possess similar capacities for CO2

absorption and control of water loss by transpiration under high soil water

availability conditions. Significant differences were observed between the

ungrafted rootstocks (RL and SM) following 24-h rehydration; SM exhibited

higher A and Gs, indicating that SM has a greater capacity to recover from severe

drought. In addition, plants with SM roots exhibited higher A and Gs levels under

severe drought than plants with RL roots, indicating that even under field

conditions, where RL was observed to maintain production levels (data not

shown), SM decreases production and uses the available water more efficiently to

maintain metabolic processes and survive prolonged drought periods. A/Gs is

very important for plant development under water limited conditions, such as in

semi-arid regions. Studies have identified citrus plants with high A/Gs, such as

those exhibited by SM, as suitable for semi-arid regions and/or regions with

partial irrigation methods (García-Sánchez et al., 2007; Tejero et al., 2011; Hutton

and Loveys, 2011; Pérez-Péres et al., 2012).

ABA is considered the primary hormone involved in regulation of plant

responses to abiotic stresses, especially drought (Fang et al., 2010; Gómez-

63

Cadenas et al., 2015). ABA levels were observed to increase in both roots (all

tested plant combinations) and leaves (except for RL) (Fig. 5A-H). One of the

main functions of ABA is the induction of stomatal closure, which occurs through

the inhibition of the flow of potassium ions into guard cells to control water loss

due to transpiration (Shinozaki and Shinozaki, 2006; Peleg and Blumwald, 2011).

This phenomenon also results in decreased photosynthetic rates. An interaction

between increased leaf and root ABA contents and decreased gas exchange was

observed under severe drought stress for all combinations tested.

Except for the reciprocal grafts SM/RL and RL/SM, plants with SM roots

exhibited significantly higher ABA content than plants with RL roots under

control conditions. It was long believed that endogenous ABA under high water

availability could decrease shoot growth. However, normal levels of endogenous

ABA have been reported to be required to maintain shoot growth (Sharp and

LeNobel, 2002). It should be highlighted that no significant differences in Gs, A

or E were observed under control conditions between plants with SM roots, which

exhibited higher ABA levels, and plants with RL roots. However, under optimal

environmental conditions, SM exhibited slower growth than RL but eventually

reached the same growth and production pattern (data not shown). In addition, in

TAL/RL, the TAL scions, which are tall and exhibit vigorous growth and

abundant foliage, induced the RL rootstocks to produce ABA levels under control

and severe drought conditions (Fig. 5H) that were at least twice the levels of the

remaining combinations with RL rootstocks (RL, SM/RL and VO/RL; Fig. 5E-G).

This finding indicates that due to their characteristics, TAL scions demanded

more ABA from rootstocks, which resulted in higher production of ABA by RL

roots in an attempt to control water loss by TAL shoots.

64

Interestingly, under severe drought, all plants with SM roots (grafted and

ungrafted) exhibited higher leaf ABA (Fig. 5A-D) than plants with RL roots

(grafted or ungrafted). It should also be noted that under severe drought, SM

scions grafted onto RL exhibited leaf ABA levels approximately 2.5-fold higher

than ungrafted RL. ABA has been frequently reported to be produced in roots and

to translocate into leaves, especially under drought conditions (Ollas et al., 2012;

Neves et al., 2013). However, other studies have shown that ABA can also be

produced in shoots and/or guard cells, protecting plants from water loss by

inducing stomatal closure (Zeevaart, 1977; Holbrook et al., 2002; Christmann et

al., 2007; Ikegami et al., 2009; Bauer et al., 2013; Hu et al., 2013; Boursiac et al.,

2013). Therefore, these data indicate that ABA production can be stimulated in

SM leaves under severe drought conditions, which, in turn, leads to increased

ABA production in grafted scions as well.

Auxins, particularly IAA, play critical roles in numerous plant growth and

development responses (Wang et al., 2001). IAA is mainly produced in young

shoot regions and is redistributed via both cell-to-cell polar transport an non-polar

transport in phloem to other plants regions, such as the the roots, whose growth

and development is strongly modulated by this hormone (Aloni et al., 2010).

Although IAA is not a significant component of the xylem sap, it controls xylem

morphological changes under stress conditions (Pérez-Alfocea et al., 2011).

Except for RL/SM, leaf IAA levels under control conditions were higher for

plants with SM roots than with RL roots (Fig. 5M-P). It should also be noted that

SM/RL exhibited higher IAA content than the reciprocal combination under

control conditions, with shoots exhibiting a prevalence of SM characteristics

(ungrafted), whereas the root IAA concentration was more similar to those

65

observed for ungrafted RL. The decreased IAA levels observed under severe

drought may result from the effect of water deficit on IAA polar transportation

(Wang et al., 2009). Studies with different crops have shown increased ABA and

decreased IAA levels under osmotic stress due to drought or salinity stress

(Niculcea et al., 2013; Dunlap and Binzel, 1996). In the present study, increased

ABA and decreased IAA concentrations were observed under severe drought for

all plant combinations. This change may have caused the decreased leaf and root

growth rates observed during drought for both genotypes. It should also be

highlighted that IAA affects the stomatal aperture (Peleg and Blumwald, 2011),

therefore, the reductions in IAA content observed in drought-exposed plants may

facilitate the promotive action of ABA on stomatal closure and, consequently, on

the minimization of water loss due to transpiration.

SA has generally been reported to be critical for tolerance to biotic

stresses, usually being produced at sites of infection (Halim et al., 2006; Dempsey

et al., 2011). However, SA has also been observed to play significant roles in

tolerance to abiotic stresses (Horváth et al., 2007), plant growth and development,

and stomatal movements (Raskin, 1992; Miura and Tada, 2014). Recent studies

based on exogenous applications of SA (Horváth et al., 2007; Kang et al., 2012)

or using SA-deficient or overproducer mutants (Miura et al., 2013; Okuma et al.,

2014) have also shown that SA increases drought tolerance in plants. This

increased tolerance is directly related to the induction of ROS production

mediated by peroxidases and the promotion of stomatal closure (Okuma et al.,

2014). Stomatal closure induced by SA is also related to defense against

pathogens by preventing pathogen entry through the stomata (Lee et al., 2007). In

the present study, except for leaf SA content in RL, SM/RL and RL/SM (Fig. 5Q

66

and R) and root SA levels in SM/RL VO/RL and TAL/RL (Fig. 5V, X and Z),

plants exhibited increased SA concentrations during severe drought (Fig. 5Q-Z).

Therefore, these increased levels of SA in drought-exposed citrus plants may also

have facilitated stomatal closure under these environmental circumstances (Table

1), very likely acting in conjunction with the increased ABA levels also detected

under drought conditions (Fig. 5A-H). It should be highlighted that all plant

combinations that did not exhibit increased SA under severe drought had RL roots

and/or shoots, and this hormone can be very important for inducing an increased

tolerance to stress. During drought, RL adopts a strategy of maintenance of plant

growth/production, whereas SM adopts a strategy focused on plant survival, i.e.,

ensuring that plants survive the stress period.

Interestingly, SA supplementation before stress was observed to increase

ABA contents (Bandurska and Stroinski, 2005) and both hormones are known to

induce ROS production and stomatal closure. An SA increase can directly result

in higher drought tolerance for both analyzed genotypes and for the different plant

combinations. However, the increase in SA was more pronounced in plants with

SM roots or scions (SM/RL) than in those with RL roots. Induction of SA

accumulation may play a protective role during water stress (Miura and Tada,

2014). SM may therefore possess a more efficient system to protect against

damages caused by drought than RL, i.e., a protective mechanism to ensure plant

survival under drought conditions.

A large proportion of the evaluated plant combinations exhibited increased

carbohydrate concentrations under severe drought stress in both leaves and roots,

with only a few plant combinations exhibiting decreased carbohydrate

concentrations (Table 2). Carbohydrates, especially sucrose, the main product of

67

photosynthesis, play a central role in plant life by affecting plant development,

growth, storage, signaling, and acclimatization to biotic and abiotic stresses

(Salerno and Curatti, 2003). In general, drought increases the concentrations of

soluble carbohydrates, which are synthesized in response to osmotic stress and act

as osmoprotectants by stabilizing cell membranes and maintaining plant turgor

(Peshev and Van den Ende, 2013). Some of the main functions of carbohydrates,

such as sucrose, raffinose and trehalose, are replacing the water lost under drought

conditions, binding to the polar ends of membrane phospholipids and maintaining

cell turgor. In addition, carbohydrate accumulation during osmotic stress affects

ROS production. ROS are mainly produced in chloroplasts through excitation or

partial reduction of molecular O2, mitochondria and peroxisomes (Keunen et al.,

2013). This relation between carbohydrates and ROS may be mediated by both

increases and decreases in carbohydrate cell contents (Couée et al., 2006). It

should be highlighted that excess ROS causes oxidative damage to cells (Blokhina

et al., 2003); therefore, the production of ROS scavengers is of great importance.

Soluble carbohydrates produced during stress were previously thought to

be direct or indirect signals for the production of ROS scavengers and/or repair

enzymes. However, recent studies have suggested that soluble carbohydrates,

namely raffinose and trehalose, may act as true ROS scavengers (Keunen et al.,

2013; Lunn et al., 2014). In addition to being osmoprotectants, the raffinose

family of oligosaccharides (RFOs) has been recently described to have antioxidant

action by acting as ROS scavengers and inducing higher tolerance in plants under

osmotic stress (Nishizawa et al., 2008; ElSayed et al., 2014). Raffinose levels

were observed to increase in leaves and roots under severe drought stress,

especially in plants with SM roots, with more pronounced increases in root tissues

68

(Table 2). Roots are the first plant organs to perceive water stress, initiating a

series of reactions that help plants prevent or tolerate stress. The pronounced

increase in raffinose in leaves of drought-exposed citrus plants may be associated

with its roles both in signaling and as ROS scavengers. The finding that this

increase was more pronounced in plants with SM roots again indicates that SM

has more efficient protective mechanisms than RL under severe drought stress to

ensure plant survival to the stress.

Trehalose can be maintained at high levels without damaging cell

metabolism because of its high solubility and non-reducing nature (Lunn et al.,

2014). In addition, recent studies using Arabidopsis thaliana mutants have shown

that trehalose metabolism plays an important role in the response of guard cells to

ABA by controlling stomatal conductance (Avonce et al., 2004; Houttle et al.,

2013; Lunn et al., 2014). This finding is in agreement with the present study, in

which high levels of ABA (Fig. 5A-H) and trehalose (Table 2) were observed to

coincide with low stomatal conductance (Table 1). This is the first report of

increased trehalose and raffinose concentrations in citrus plants during drought.

This finding is of great importance for the understanding of drought stress

tolerance in citrus plants, and it suggests that further, more specific, studies of

these carbohydrates would be valuable.

The evaluated citrus plants exhibit different survival strategies to drought

Drought causes several physiological, morphological and

metabolic/biochemical changes in plants, namely decreased gas exchange,

resulting in decreased growth (Readdy et al., 2004; Arbona et al., 2013), leaf

abscission (Gómez-Cadenas et al., 1996), and changes in hormone (Sharp and

LeNoble, 2002; Argamassila et al., 2014) and/or carbohydrate profiles (Peters et

69

al., 2007; Keunem et al., 2013). In addition, plants may develop different

strategies for surviving and/or coping with drought period, greatly depending on

its intensity and duration (Zhao et al., 2015). These strategies may focus on

maintaining plant growth and competitiveness or on plant survival (Claeys and

Inzé, 2013). However, plants may develop characteristics to cope with drought

that are not advantageous for the maintenance of plant production (Lopes et al.,

2011).

Neves et al. (2013) and Oliveira et al. (2015) measured physiological

parameters, ABA concentrations, gene expression of proteins associated with the

ABA biosynthetic pathway, and protein profiles of RL and SM rootstocks grown

in pots under drought conditions, and they observed that RL and SM exhibited

different responses to drought stress. SM, compared with RL, exhibited higher

ABA concentrations and greater numbers of differentially expressed proteins in

response to drought. In addition, proteins found exclusively in SM were involved

with DNA repair and processing (Oliveira et al., 2015), whereas RL exhibited up-

regulation of proteins responsible for transportation, protein metabolism, stress

response and proteolysis. These studies, together with the field trials (Muriti

Farm, São Paulo), are in agreement with the present results. Overall, plants with

SM roots exhibited high levels of hormones important for the induction of drought

tolerance, such as ABA and SA (Fig. 5A-H and 5Q-Z), and high levels of

carbohydrates, such as sucrose, raffinose and trehalose (Table 2), that help prevent

the cell damage caused by drought stress and maintain cell metabolism and turgor.

It should be highlighted that decreased water availability under field

conditions is intensified by evaporation; when these decreases are systematic and

continuous, even genotypes such as SM, which possess drought survival

70

mechanisms based on water saving, will also suffer from drought due to

evaporation. It is therefore believed that under severe and long periods of drought,

RL will reach the permanent wilting point sooner than SM because the drought

survival mechanism of SM is more effective under prolonged drought stress.

In addition, a detailed analysis of the behavior of RL and SM, especially

their hormone and carbohydrate profiles, indicates that the two exhibit different

survival strategies (Fig. 6). This conclusion was mainly based on the lower or

similar hormone and carbohydrate concentrations observed for RL, ungrafted or

grafted with SM, VO and TAL scions, than for SM. SM generally exhibited

higher hormone and carbohydrate concentrations than RL. This finding indicates

that even under control conditions, SM has stronger protective mechanisms than

RL, which may confer an advantage to this rootstock under conditions of

prolonged drought. In addition, the lower concentrations observed for RL than for

SM indicate that the main focus of RL is maintaining plant growth and, therefore,

plant production. This finding was confirmed in the field (data not shown),

indicating that RL adopts a strategy of dehydration avoidance. Because SM has

more robust mechanisms of stress protection, it develops a strategy of dehydration

tolerance, which may decrease plant production. It’s important to highlight that a

selection of rootstocks that guarantee plant survival and maintain plant growth and

production rates under prolonged drought conditions is essential for sustainable

citrus production. Hybridization between genotypes with these characteristics may

therefore be the key to obtaining these varieties.

The present study is, to our knowledge, the first study conducted in citrus

plants using reciprocal grafting to clarify scion/rootstock interactions. It is

therefore one of the most complete studies of drought tolerance in citrus plants

71

performed to date. The results show that the rootstocks tested, especially SM, tend

to modify scion behavior (VO, TAL, and reciprocal grafts) into behavior similar

to that exhibited by the ungrafted rootstock.

Materials and methods

Plant material and drought treatment

Two rootstocks, Citrus limonia Osb. (Rangpur lime) and Citrus sunki

(Sunki Maravilha mandarin), which exhibit different responses to drought (Neves

et al., 2013; Oliveria et al., 2015), and two commercial scions, Citrus sinensis (L.)

Osb. (Valencia orange) and Citrus latifolia Tanaka (Tahiti acid lime), which are

economically important worldwide and locally, respectively, were used.

Rootstocks were obtained by seed germination, and scions were obtained from

buds of healthy mother plants from the Citrus Germplasm Bank (Banco de

Germoplasma de Citros) of Embrapa Cassava and Fruit Crops (Embrapa

Mandioca e Fruticultura). Bud grafting was performed when the rootstocks were 6

months old. Eight different combinations were tested: Rangpur lime (RL) and

Sunki Maravilha mandarin (SM) ungrafted rootstocks and RL and SM rootstocks

grafted with different scions – Sunki Maravilha mandarin/Rangpur lime (SM/RL),

Rangpur lime/Sunki Maravilha mandarin (RL/SM), Valencia orange/Rangpur

lime (VO/RL), Valencia orange/Sunki Maravilha mandarin (VO/SM), Tahiti acid

lime/Rangpur lime (TAL/RL), and Tahiti acid lime/Sunki Maravilha mandarin

(TAL/SM). Following grafting, plants were transferred into 45-L pots containing

Plantmax®, washed sand and clay (2:1:1). The plants were maintained under an

anti-aphid screen with daily irrigation. NPK and micronutrient fertilizers were

applied every two weeks until the plants were 2 years old.

72

Following this period, plants were homogenized by pruning the scions.

After one month, the plants were divided into two groups: (i) control treatment:

plants grown in soil kept at field capacity with constant irrigation and (ii) drought

treatment: plants grown without irrigation. The pots were covered with transparent

plastic and aluminum foil to avoid water loss due to evaporation. The experiment

lasted 17 days, with drought developing gradually as the soil water content

decreased. Soil moisture was monitored daily using a time domain reflectometry

(TDR) probe. When the leaf water potential of the plants became lower than -2.0

MPa, they were harvested, and rehydration of these plants was started. The plants

reached water deficit on different days. Plants subjected to rehydrationwere

harvested 48-h after rewatering.

Leaf water potential, leaf osmotic potential and matric potential

Leaf water potential (ΨL) was determined before dawn using a Scholander

pressure chamber (m670, PMS Instrument Co., Albany, OR, USA). ΨL was

measured every other day after confirming that photosynthetic parameters were

decreasing via measurements using an infrared gas analyzer (IRGA). Leaves were

detached from the plants using a stylus and were immediately used for ΨL

measurements. Leaves and roots of plants under severe drought were harvested

when they reached ΨL ≤ -2.0 MPa. ΨL was also measured for control plants and

following 48-h rehydration, after which roots and leaves were harvested.

Leaf osmotic potential (Ψπ) was measured using a Vapro 5520 vapor

pressure osmometer (Wescor, Inc., Logan, USA) calibrated using NaCl standards

with known concentrations (mmol kg-1). Fresh leaves were collected from the

middle third of the plants and were macerated, pressed, and filtered to extract the

sap. A 10-µL aliquot was used to determine tissue osmolarity. Ψπ values were

73

obtained in mmol kg-1 and converted into osmotic potential using the Van’t Hoff

equation:

Ψπ=R×T×C

where R is the ideal gas constant (0.00813), T is temperature (K),

and C is the leaf extract concentration (mmol kg-1, converted to moles).

Soil matric potential (soil Ψ) was determined using the soil moisture

values (measured daily with a TDR probe) and the matric potential (measured

with a WP4 Dewpoint PotentiaMeter dew-point mirror psychrometer).

Leaf area

The leaf area of drought-exposed plants was measured at the beginning

and end (following stress application) of the experiment. The total leaf area was

obtained by measuring the length and width once every five leaf of each plant.

The leaves were measured from the stem to the branches, starting at the mark

made during the previous measurement. Leaf area was determined by multiplying

the leaf length by the leaf width with a correction factor of 0.72 (Neves et al.,

2013). The total leaf area was determined by summing all the leaf areas obtained

for each plant and multiplying the total by five. The total leaf area was obtained in

cm2 and converted into m2.

Photosynthetic parameters

The net photosynthetic rate (A), stomatal conductance (Gs) and

transpiration (E) were measured every other day in fully expanded mature leaves

that had previously been selected and marked. Gas exchange measurements (A,

Gs and E) were performed using an LCpro-SD portable IRGA (ADC

BioScientific Limited, UK) at 1000 µmol photons m-2 s-1 photosynthetically active

radiation (PAR) and ambient leaf temperature, air humidity and CO2

74

concentration. Measurements were performed between 8 AM and 11 AM in two

leaves of each plant once the readings had stabilized, i.e., exhibited similar values.

Gas exchange measurements in rehydrated plants were performed following 24-h

rehydration.

Hormonal measurements

Endogenous indoleacetic acid (IAA), salicylic acid (SA) and abscisic acid

(ABA) levels were determined by gas chromatography tandem mass

spectrometry-selected ion monitoring (GC-MS-SIM). Leaf and root samples (50-

100 mg FW) were extracted as described in Rigui et al. (2015). Approximately

0.25 μg of the labeled standards [2H6]ABA (OlChemIm Ltd.), [13C6]IAA

(Cambridge Isotopes, Inc.) and [2H6]SA (Cambridge Isotopes, Inc.) was added to

each sample as internal standards. For ABA quantification, aliquots of the extract

were methylated as described in Rigui et al. (2015). For IAA and SA

quantifications, aliquots were evaporated and resuspended in 50 mL of pyridine,

followed by a 60-min derivatization at 92°C using 50 mL of N-tert-

butyldimethylsilyl-N-methyltrifluoroacetamide (with 1% tert-

butyldimethylchlorosilane). Analysis was performed on a gas chromatograph

coupled to a mass spectrometer (model GCMS-QP2010 SE, Shimadzu) in

selected ion monitoring mode. The chromatograph was equipped with a fused-

silica capillary column (30 m, 0.25 mm ID, 0.50-mm-thick internal film) DB-5 MS

stationary phase using helium as the carrier gas at a flow rate of 4.5 mL min–1 in

the following program: 2 min at 100°C, followed by gradients of 10°C min–1 to

140°C, 25°C min–1 to 160°C, 35°C min–1 to 250°C, 20°C min–1 to 270°C and

30°C min–1 to 300°C. The injector temperature was 250°C, and the following MS

operating parameters were used: ionization voltage, 70 eV (electron impact

75

ionization); ion source temperature, 230°C; and interface temperature, 260°C.

Ions with a mass ratio/charge (m/z) of 244, 202 and 130 (corresponding to

endogenous IAA); 250, 208 and 136 (corresponding to [13C6]-IAA); 309, 195 and

209 (corresponding to endogenous SA); 315, 201 and 215 (corresponding to

[2H6]SA); 190, 162 and 134 (corresponding to endogenous ABA); and 194, 166

and 138 (corresponding to [2H6]ABA) were monitored. Endogenous

concentrations were calculated based on extracted chromatograms at m/z 244 and

250 for IAA, 309 and 315 for SA, and 190 and 194 for ABA.

Sugar profiling

For soluble carbohydrate profiling, leaf and root samples (50-100 mg FW)

were extracted as described in Freschi et al. (2010). The supernatant residue was

resuspended in 50 μL of pyridine and derivatized for 40 min at 60°C with 20 µL

of N,O-bis(trimethylsilyl)trifluoroacetamide with 1% of trimethylchlorosilane.

The trimethylsilylated extracts were analyzed by GC-MS (model GCMS-QP2010

SE, Shimadzu), and the total ion current spectra were recorded in the mass range

of 50–700 atomic mass units in scanning mode. The chromatograph was equipped

with a fused-silica capillary column DB-5 MS stationary phase using helium as

the carrier gas at a flow rate of 4.5 mL min–1. The initial running conditions were

100°C for 5 min, followed by a gradient up to 320°C at 8°C min-1. Endogenous

metabolite concentrations were obtained by comparing the peak areas of the

chromatograms against commercial standards.

Statistical analysis

A completely randomized experimental design (CRD) was used, with 3

replicates for the control group and 3 replicates for the groups subjected to

drought (for each of the eight tested combinations), for a total of 48 plants. The

76

eight combinations were divided into four comparison groups, each with two

combinations, according to the similarity between them. Comparison group 1

consisted of the two ungrafted rootstocks (RL and SM), group 2 was the

reciprocal grafts of the two rootstocks (SM/RL and RL/SM), group 3 was

Valencia orange scions grafted onto the two rootstocks (VO/RL and VO/SM), and

group 4 was Tahiti acid lime scions grafted onto the two rootstocks (TAL/RL and

TAL/SM). Analysis of variance (ANOVA) followed by the Scott-Knott test was

performed for each comparison group to test for significant differences between

combinations within each comparison group, significant differences between

different water availability treatments for each combination, and significant

interactions between plant combination and drought treatment, with significance

defined as p≤0.05. Six replicates were performed for the photosynthetic

parameters (n=6), three each for leaf water potential, leaf osmotic potential, soil

matric potential, and leaf area (n=3) and five for hormone contents and

carbohydrate profiles (n=5).

Funding information: National Council for Scientific and Technological

Development - CNPq (grant: 301356/2012-2 and 472733/2013-3). Scholarship of

Dayse Drielly Souza Santana Vieira financed by CAPES in Brazil and also by

CAPES/Ciências Sem Fronteiras (grant: CSF SDW-0268/13-5) of a doctorate

sandwich.

Acknowledgements: The trainee Victor Pereira Brito for the illustration of figure

6.

77

References

Albacete, A., Martínez-Andújar, C., Martínez-Pérez, A., Thompson,

A. J., Dodd, I. C., Pérez-Alfocea, F. (2015) Unravelling rootstock× scion

interactions to improve food security. Journal of experimental botany, 66(8),

2211-2226.

Allario, T., Brumos, J., Colmenero-Flores, J. M., Tadeo, F.,

Froelicher, Y., Talon, M., ... & Morillon, R. (2011) Large changes in anatomy

and physiology between diploid Rangpur lime (Citrus limonia) and its

autotetraploid are not associated with large changes in leaf gene

expression.Journal of experimental botany, erq467.

Aloni, B., Cohenb, R., Karnia, L., Aktasc, H., Edelsteinb, M. (2010)

Hormonal signaling in rootstock–scion interactions. Scientia Horticulturae, 127.

119–126.

Arbona, V., Iglesias, D.J., Jacas, J., Primo-Millo, E., Talon, M. (2005)

Hydrogel substrate amendment alleviates drought effects on young citrus plants.

Plant Soil. 270, 73–82.

Arbona, V.; Gómez-Cadenas, A. (2008) Hormonal modulation of citrus

responses to flooding. J. Plant Growth Regul. 27, 241–250.

Aroca, R., Porcel, R., Ruiz-Lozano, J.M. (2012) Regulation of root

water uptake under abiotic stress conditions. Journal of Experimental Botany 63,

43–57.

Avonce, N., Leyman, B., Mascorro-Gallardo, J. O., Van Dijck, P.,

Thevelein, J. M., & Iturriaga, G. (2004) The Arabidopsis trehalose-6-P synthase

AtTPS1 gene is a regulator of glucose, abscisic acid, and stress signaling.Plant

Physiology, 136(3), 3649-3659.

78

Bandurska and Stroinski, A. (2005) The effect of salicylic acid on barley

response to water deficit. ActaPhysiol.Plant. 27, 379–386.doi:10.1007/s11738-

005-0015-5

Bauer, H., Ache, P., Lautner, S., Fromm, J., Hartung, W., Al-Rasheid,

K. A., Sonnewald, S. Sonnewald, U., Kneitz, S. Lachmann, N., Mendel, R. R.,

Bittner, F., Hetherington, A. M., Hedrich, R. (2013) The stomatal response to

reduced relative humidity requires guard cell-autonomous ABA

synthesis. Current Biology, 23(1), 53-57.

Berdeja, M., Nicolas, P., Kappel, C., Dai1, Z. W., Hilbert, G., Peccoux,

A., Lafontaine, M., Ollat, N., Gomès, E., Delrot, S. (2015) Water limitation and

rootstock genotype interact to alter grape berry metabolism through transcriptome

reprogramming. Horticulture Research, 2, 15012; doi:10.1038/hortres.2015.12

Blokhina O., Virolainen E., Fagerstedt K.V. (2003) Antioxidants,

oxidative damage and oxygen deprivation stress: a review. Annals of Botany, 91,

179–194.

Boursiac, Y., Léran, S., Corratgé-Faillie, C., Gojon, A., Krouk, G., &

Lacombe, B. (2013) ABA transport and transporters. Trends in plant

science,18(6), 325-333.

Christmann A., Weiler E.W., Steudle E., Grill E. (2007) A hydraulic

signal in root-to-shoot signalling of water shortage. Plant J 52:167–174

Claeys H. and Inze D. (2013) The agony of choice: how plants balance

growth and survival under water-limiting conditions. Plant Physiology 162, 1768–

1779.

79

Couée I., Sulmon C., Gouesbet G. & El Amrani A. (2006) Involvement

of soluble sugars in reactive oxygen species balance and responses to oxidative

stress in plants. Journal of Experimental Botany 57, 449–459.

Dempsey, D. A., Vlot, A. C., Wildermuth, M. C., Klessig, D. F. (2011).

Salicylic acid biosynthesis and metabolism. ArabidopsisBook 9, e0156.doi:

10.1199/tab.0156

Dunlap, J. R., and Binzel, M. L. (1996) NaCl reduces indole-3-acetic

acid levels in the roots of tomato plants independent of stress-induced abscisic

acid. Plant Physiol. 112:379–384.

ElSayed, A. I., Rafudeen, M. S., Golldack, D. (2014) Physiological

aspects of raffinose family oligosaccharides in plants: protection against abiotic

stress. Plant Biology, 16. 1–8

Garcia-Sanchez, F., Syvertsen, J.P., Gimeno, V., Botia, P., Perez-

Perez, J.G. (2007) Responses to flooding and drought stress by two citrus

rootstocks seedlings with different water-use efficiency. Physiol. Plantarum 130,

532–542.

Gómez-Cadenas. A., Vives, V., Zandalinas, S. I., Manzi, M., Sánchez-

Pérez, A. M., Pérez-Clemente, R. M., Arbona, V. (2015) Abscisic Acid: A

Versatile Phytohormone in Plant Signaling and Beyond. Current Protein and

Peptide Science, 16. 413-434.

Halim V.A., Vess A., Scheel D., Rosahl S. (2006) The role of salicylic

acid and jasmonic acid in pathogen defence. Plant Biology, 8. 307–313

Holbrook N.M., Shashidhar V.R., James R.A., Munns R. (2002)

Stomatal control in tomato with ABA-deficient roots: response of grafted plants to

soil drying. J Exp Bot 53:1503–1514

80

Horváth, E., Pál, M., Szalai, G., Páldi, E., & Janda, T. (2007)

Exogenous 4-hydroxybenzoic acid and salicylic acid modulate the effect of short-

term drought and freezing stress on wheat plants. Biologia Plantarum, 51(3), 480-

487.

Houtte, H. V., Vandesteene, L., López-Galvis, L., Lemmens, L., Kissel,

E., Carpentier, S., Feil, R., Avonce, N., Beeckman, T., Lunn, J. E., Dijck, P.

V. (2013) Overexpression of the Trehalase Gene AtTRE1 Leads to Increased

Drought Stress Tolerance in Arabidopsis and Is Involved in Abscisic Acid-

Induced Stomatal Closure. Plant Physiology, 161. 1158-1171

Hu, B., Hong, L., Liu, X., Xiao, S. N., Lv, Y., & Li, L. (2013)

Identification of different ABA biosynthesis sites at seedling and fruiting stages in

Arachis hypogaea L. following water stress. Plant Growth Regulation, 70(2), 131-

140.

Hutton, R. J., and Loveys, B. R. (2011) A partial root zone drying

irrigation strategy for citrus—effects on water use efficiency and fruit

characteristics.Agricultural Water Management, 98(10), 1485-1496.

Ikegami K., Okamoto M., Seo M., Koshiba T. (2009) Activation of

abscisic acid biosynthesis in the leaves of Arabidopsis thaliana in response to

water deficit. J Plant Res 122:235–243

Kang, G., Li, G., Xu, W., Peng, X., Han, Q., Zhu, Y., Guo, T. (2012)

Proteomics Reveals the Effects of Salicylic Acid on Growth and Tolerance to

Subsequent Drought Stress in Wheat. Journal of Proteome Research, 11.

6066−6079

Keunen, E., Peshev, D., Vangronsveld, J., Ende, W. V. D., Cuypers, A.

(2013) Plant sugars are crucial players in the oxidative challenge during abiotic

81

stress: extending the traditional concept. Plant, Cell and Environment, 36, 1242–

1255

Koshita, Y., Takahara T. (2004). Effect of water stress on flower-bud

formation and plant hormone content of satsuma mandarin (Citrus unshiu

Marc.). Scientia horticulturae 99.3. 301-307.

Lawlor, D. W. (2013) Genetic engineering to improve plant performance

under drought: physiological evaluation of achievements, limitations, and

possibilities. Journal of experimental botany. 64.1 .83-108.

Lee J, Nam J, Park HC, Na G, Miura K, Jin JB, Yoo CY, Baek D,

Kim DH, Jeong JC, et al. (2007). Salicylic acid-mediated innate immunity in

Arabidopsis is regulated by SIZ1 SUMO E3 ligase. Plant J 49:79-90;

PMID:17163880; http://dx.doi. org/10.1111/j.1365-313X.2006.02947.x

Levitt, J. (1972) Responses of Plants to Environmental Stresses. New

York: Academic Press.

Lunn, J. E., Delorge, I., Figueroa, C. M., Dijck, P. V., Stitt, M. (2014)

Trehalose metabolism in plants. The Plant Journal 79, 544–567.

Machado, D.F.S.P., Ribeiro, R.V., Silveira, J.A.G., Magalhães Filho,

J.R., Machado, E.C. (2013). Rootstocks induce contrasting photosynthetic

responses of orange plantsto low night temperature without affecting the

antioxidant metabolism. Theor.Exp. Plant Physiol. 25, 26–35.

McDowell, N., Pockman, W. T., Allen, C. D., Breshears, D. D., Cobb,

N., Kolb, T., Plaut, J., Sperry, J., West, A., Williams, D. G., Yepez, A. E.

(2008) Mechanisms of plant survival and mortality during drought: why do some

plants survive while others succumb to drought? New Phytologist 178. 719–739.

82

Mittler, R. and Blumwald, E. (2015) The Roles of ROS and ABA in

Systemic Acquired Acclimation. The Plant Cell, 27. 64–70.

Miura, K., Okamoto, H., Okuma, E., Shiba, H., Kamada, H.,

Hasegawa, P. M., Murata, Y. (2013) SIZ1 deficiency causes reduced stomatal

aperture and enhanced drought tolerance via controlling salicylic acid-induced

accumulation of reactive oxygen species in Arabidopsis. The Plant Journal, 73.

91–104

Miura, K. and Tada, Y. (2014) Regulation of water, salinity, and cold

stress responses by salicylic acid. Frontiers in Plant Science, 5. 1-12.

Molinari, H.B.C., Marur, C.J., Filho, J.C.B., Kaboyashi, A.K., Pileggi,

M., Junior, R.P.L., Pereira, L.F.P., Vieira, L.G.E. (2004) Osmotic adjustment

in transgenic citrus rootstock Carrizo citrange (Citrus sinensis Osb. × Poncirus

trifoliata L. Raf.) over-producing proline. Plant Sci. 167, 1375–1381.

Mudge K., Janick J., Scofield S., Goldschmidt, E.E. (2009). A history

of grafting. Hortic Rev, 35. 437- 93.

Neves DM, Coelho Filho MA, Bellete BS, Silva MFGF, Souza DT,

Soares Filho WS, et al. (2013). Comparative study of putative 9-cis-

epoxycarotenoid dioxygenase and abscisic acid accumulation in the responses of

Sunki mandarin and Rangpur lime to water deficit. Mol Biol. 40. 5339–49.

Niculcea, M., Martinez-Lapuente, L., Guadalupe, Z., Sánchez-Díaz,

M., Morales, M., Ayestarán, B., Antolín, M. C. (2013) Effects of Water-Deficit

Irrigation on Hormonal Content and Nitrogen Compounds in Developing Berries

of Vitis vinifera L. cv. Tempranillo. J Plant Growth Regul, 32. 551–563

83

Nishizawa, A., Yabuta, Y. and Shigeoka, S. (2008) Galactinol and

raffinose constitute a novel function to protect plants from oxidative damage.

Plant Physiology, 147, 1251-1263.

Okuma, E., Nozawa, R., Murata, Y, Miura, K. (2014) Accumulation of

endogenous salicylic acid confers drought tolerance to Arabidopsis. Plant

Signaling & Behavior.

Oliveira, T. M., Silva, F. R. da, Bonatto, D., Neves, D. N., Morillon, R.,

Maserti, B. E., Filho, M. A. C., Costa, M. C. G., Pirovani, C. P., Gesteira, A.

S. (2015) Comparative study of the protein profiles of Sunki mandarin and

Rangpur lime plants in response to water deficit. BMC Plant Biology. 15:69.

Ollas, C. de, Hernando, B., Arbona, V., Gómez-Cadenas, A. (2012)

Jasmonic acid transient accumulation is needed for abscisic acid increase in citrus

roots under drought stress conditions. Physiologia Plantarum, 147 (3), 296-306.

Osakabe, Y., Yamaguchi-Shinozaki, K., Shinozaki, K. Tran, L.-S. P.

(2014) ABA control of plant macroelement membrane transport systems in

response to water deficit and high salinity. New Phytologist, 202. 35–49.

Peleg, Z. and Blumwald, E. (2011) Hormone balance and abiotic stress

tolerance in crop plants. Current Opinion in Plant Biology, 14. 290–295

Pérez-Alfocea, F., Ghanem, M. G., Gómez-Cadenas, A., Dodd, I. C.

(2011) Omics of Root-to-Shoot Signaling Under Salt Stress and Water Deficit.

Journal of Integrative Biology, 15 (12).

Pérez-Clemente, R. M., Montoliu, A., Zandalinas, S. I. (2012) Carlos de

Ollas, and Aurelio Gómez-Cadenas Carrizo citrange Plants Do Not Require the

Presence of Roots to Modulate the Response to Osmotic Stress. The Scientific

World Journal. DOI: 10.1100/2012/795396.

84

Pérez-Pérez, J. G., Dodd, I. C., and Botía, P. (2012) Partial rootzone

drying increases water-use efficiency of lemon Fino 49 trees independently of

root-to-shoot ABA signalling. Functional Plant Biology, 39(5), 366-378.

Peshev D. and Van den Ende. (2013) Sugars as antioxidants in plants. In

Crop Improvement under Adverse Conditions (eds N. Tuteja & S.S. Gill).

Springer-Verlag, Berlin, Heidelberg, Germany. 285–308.

Peters, S., Mundree, S. G., Thomson, J. A., Farrant, J. M., Keller, F.

(2007) Protection mechanisms in the resurrection plant Xerophyta viscosa

(Baker): both sucrose and raffinose family oligosaccharides (RFOs) accumulate in

leaves in response to water deficit. Journal of Experimental Botany, 58 (8), 1947–

1956.

Raskin I. (1992) Role of salicylic acid in plants. Annu Rev Plant Physiol

Plant Mol Biol 4:439–463

Rodríguez-Gamir, J., Ancillo, G., Aparicio, F., Bordas, M., Primo-

Millo, E., Forner-Giner,M.A. (2011) Water-deficit tolerance in citrus is

mediated by the down-regulation of PIP gene expression in the roots. Plant Soil

347, 91–104.

Rodriguez-Gamir, J., Primo-Millo, E., Forner, J.B., Angeles Forner-

Giner, M. (2010) Citrus rootstock responses to water stress. Sci. Hortic. 126, 95–

102.

Romero, P., Navarro, J.M., Pérez-Pérez, J., García-Sánchez, F.,

Gómez-Gómez, A., Por-ras, I., Martinez, V., Botía, P. (2006) Deficit irrigation

and rootstock: their effects on water relations, vegetative development, yield, fruit

quality and mineral nutrition of Clemenules mandarin. Tree Physiol. 26, 1537–

1548.

85

Salerno G.L. and Curatti L. (2003) Origin of sucrose metabolism in

higher plants: when, how and why? Trends in Plant Science 8, 63–69.

Sharp, R. E., LeNoble, M. E. (2002) ABA, ethylene and the control of

shoot and root growth under water stress. Journal of Experimental Botany, 53

(366), 33-37.

Yamaguchi-Shinozaki, K., and Shinozaki, K. (2006). Transcriptional

regulatory networks in cellular responses and tolerance to dehydration and cold

stresses. Annu. Rev. Plant Biol., 57, 781-803.

Shukla, N., Awasthi, R.P., Rawat, L., Kumar, J. (2012) Biochemical

and physiologicalresponses of rice (Oryza sativa L.) as influenced by Trichoderma

harzianum underdrought stress. Plant Physiol. Biochem. 54, 78–88.

Tardieu, F., Granier, C., Muller, B. (2011) Water deficit and growth.

Co-ordinating processes without an orchestrator? Current opinion in plant

biology 14.3. 283-289.

Tejero, I. G., Zuazo, V. H. D., Bocanegra, J. A. J., Fernández, J. L. M.

(2011). Improved water-use efficiency by deficit-irrigation programmes:

Implications for saving water in citrus orchards. Scientia Horticulturae,128(3),

274-282.

Verslues, P.E.; Agarwal, M.; Katiyar-Agarwal, S.; Zhu, J.; Zhu, J.-K.

(2006) Methods and concepts in quantifying resistance to drought, salt and

freezing, abiotic stresses that affect plant water status. Plant J. 45, 523–539.

Wang Y., Li K., Li X. (2009) Auxin redistribution modulates plastic

development of root system architecture under salt stress in Arabidopsis thaliana.

J Plant Physiol 166:1637–1645

86

Wang, Y., Mopper, S., Hasenstein, K. H. (2001) Effects of salinity on

endogenous ABA, IAA, JA, and SA in Iris hexagona. Journal of Chemical

Ecology, 27 (2). 327-342.

Wu, Q.S., Srivastava, A.K., Zou, Y.N. (2013) AMF-induced tolerance to

drought stress in citrus: A review. Scientia Horticulturae, 164. 77–87.

Zeevaart, J. A. (1977). Sites of abscisic acid synthesis and metabolism in

Ricinus communis L. Plant physiology, 59(5), 788-791.

87

Tables

Table 1 – Physiological parameters of eight different scion/rootstock combinations under three different water availability conditions:

Control: ΨL ≤ 0.5; severe drought stress: ΨL ≥ 2.0; and 48-h rehydration. Treatments were divided into four comparison groups. A:

photosynthetic rate (µmol m2 s-1); Gs: stomatal conductance (mol m2 s-1); E: transpiration rate (mmol m2 s-1); A/Gs: intrinsic water use

efficiency; A/E: water use efficiency. RL: Rangpur lime; SM: Sunki Maravilha mandarin; VO: Valencia orange; TAL: Tahiti acid lime. Values

are averages ± standard errors (n=6). Different uppercase letters indicate significant differences between combinations, and different lowercase

letters indicate significant differences within the same combination, according to the Scott-Knott test (p<0.05).

88

Comparison group

Combinations Condictions A

µmol m-2s-1 Gs

µmol m-2s-1 E

µmol m-2s-1

A/Gs A/E

1

RL C 8.28 ± 0.61 cA 0.17 ± 0.01 cA 2.16 ± 0.16 cA 48.45 ± 1.36 bA 3.84 ± 0.05 cA S 0.12 ± 0.13 aA 0.00 ± 0.00 aA 0.18 ± 0.09 aA 13.83 ± 8.91 aA 0.93 ± 0.37 aA R 3.57 ± 0.51 bA 0.04 ± 0.01 bA 1.35 ± 0.17 bA 82.19 ± 2.27 cA 2.65 ± 0.30 bA

SM C 7.71 ± 0.58 cA 0.15 ± 0.02 cA 1.98 ± 0.12 cA 51.97 ± 2.70 aA 3.90 ± 0.22 bA S 1.22 ± 0.18 aA 0.01 ± 0.00 aA 0.52 ± 0.06 aA 99.25 ± 14.04 bB 2.47 ± 0.34 aB R 5.59 ± 0.19 bB 0.08 ± 0.00 bB 1.42 ± 0.06 bA 72.00 ± 2.70 aA 3.94 ± 0.11 bB

2

SM/RL C 5.38 ± 0.98 cA 0.12 ± 0.02 cA 1.69 ± 0.19 cA 43.38 ± 2.56 bA 3.08 ± 0.31 aA S 0.05 ± 0.18 aA 0.00 ± 0.00 aA 0.19 ± 0.02 aA 0.00 ± 0.00 aA 1.29 ± 0.48 bA R 3.46 ± 0.31 bA 0.04 ± 0.00 bA 1.39 ± 0.11 bA 84.66 ± 10.63 cA 2.57 ± 0.29 aA

RL/SM C 6.60 ± 0.41 cA 0.16 ± 0.01 cB 1.97 ± 0.06 cA 41.69 ± 2.65 aA 3.36 ± 0.19 aA S 0.66 ± 0.27 aA 0.01 ± 0.00 aA 0.42 ± 0.08 aA 63.03 ± 11.20 bB 2.18 ± 0.62 aA R 4.03 ± 0.68 bA 0.06 ± 0.01 bA 1.49 ± 0.28 bA 66.06 ± 5.34 bA 2.89 ± 0.37 aA

3

VO/RL C 5.17 ± 0.38 cA 0.11 ± 0.01 cA 1.60 ± 0.10 bA 46.38 ± 2.00 aA 3.24 ± 0.14 cA S 0.54 ± 0.20 aA 0.01 ± 0.01 aA 0.39 ± 0.12 aA 31.97 ± 7.95 aA 1.10 ± 0.28 aA R 3.74 ± 0.54 bA 0.05 ± 0.00 bA 1.60 ± 0.24 bA 70.24 ± 8.71 aA 2.37 ± 0.11 bA

VO/SM C 5.62 ± 0.33 cA 0.12 ± 0.01 cA 1.67 ± 0.08 bA 48.44 ± 2.36 aA 3.40 ± 0.23 bA S 1.07 ± 0.23 aA 0.01 ± 0.00 aA 0.48 ± 0.03 aA 107.33 ± 23.37 bB 2.21 ± 0.46 aA R 4.26 ± 0.71 bA 0.06 ± 0.01 bA 1.62 ± 0.26 bA 75.56 ± 6.34 bA 2.62 ± 0.18 aA

4

TAL/RL C 7.34 ± 0.30 cA 0.17 ± 0.01 cA 2.02 ± 0.08 cA 44.81 ± 2.43 aA 3.65 ± 0.13 cA S 0.01 ± 0.11 aA 0.00 ± 0.00 aA 0.25 ± 0.05 aA 9.64 ± 4.00 aA 0.66 ± 0.43 aA R 2.50 ± 0.30 bA 0.03 ± 0.00 bA 1.22 ± 0.02 bA 84.35 ± 6.89 bA 2.06 ± 0.25 bA

TAL/SM C 7.69 ± 0.20 cA 0.17 ± 0.01 cA 2.11 ± 0.17 cA 47.30 ± 3.04 aA 3.75 ± 0.27 bA S 1.67 ± 0.30 aB 0.02 ± 0.00 aA 0.79 ± 0.13 aB 102.24 ± 35.55 aB 2.23 ± 0.42 aB R 4.32 ± 0.56 bB 0.06 ± 0.01 bB 1.54 ± 0.17 bA 69.62 ± 4.36 aA 2.79 ± 0.13 aA

89

Table 2 – Raffinose, trehalose, galactose, fructose, glucose and sucrose concentrations in the leaves and roots of eight different scion/rootstock

combinations under three different water availability conditions. Conditions: control: ΨL ≤ 0.5; severe drought stress: ΨL ≥ 2.0; and 48-h

rehydration. RL: Rangpur lime; SM: Sunki Maravilha mandarin; VO: Valencia orange; TAL: Tahiti acid lime. Values are averages ± standard

errors (n=5). Different uppercase letters indicate significant differences between combinations, and different lowercase letters indicate

significant differences within the same combination, according to the Scott-Knott test (p<0.05).

90

91

Figure legends

Figure 1 – Microclimate conditions under the screen where the experiment was

performed. The daily maximum and minimum temperatures (°C) and air relative humidity

(%) for the days of the experiment are represented as lines and bars, respectively.

Figure 2 – Plant leaf areas of eight scion/rootstock combinations before (control –

gray bars) and after drought stress (after stress – black bars). RL: Rangpur lime; SM: Sunki

Maravilha mandarin; VO: Valencia orange; TAL: Tahiti acid lime. Values are averages ±

standard errors (n=6). Different uppercase letters indicate significant differences between

combinations, and different lowercase letters indicate significant differences within the same

combination, according to the Scott-Knott test (p<0.05).

Figure 3 – Pre-dawn leaf water potential (A-D; ΨL; MPa), and leaf osmotic potential

(E-H; Ψπ; MPa) of eight scion/rootstock combinations (RL: Rangpur lime; SM: Sunki

Maravilha mandarin; VO: Valencia orange; TAL: Tahiti acid lime), under three different

water availability conditions: control: ΨL ≤ 0.5 (white bars); severe drought stress: ΨL ≥ 2.0

(black bars); and 48-h rehydration (gray bars). Values are averages ± standard errors (n=3).

Different uppercase letters indicate significant differences between combinations, and

different lowercase letters indicate significant differences within the same combination,

according to the Scott-Knott test (p<0.05).

Figure 4 – Soil matric potential (soil Ψ; MPa) under severe drought stress (ΨL ≥ 2.0

MPa – black bars) for eight scion/rootstock combinations. RL: Rangpur lime; SM: Sunki

Maravilha mandarin; VO: Valencia orange; TAL: Tahiti acid lime. Values are averages (n=3).

Error bars indicate standard errors.

Figure 5 – ABA, IAA and SA concentrations in the leaves (A-D, I-L, and Q-T,

respectively) and roots (E-H, M-P, and U-Z, respectively) of eight different scion/rootstock

combinations under three different water availability conditions: control: ΨL ≤ 0.5 (white

92

bars); severe drought stress: ΨL ≥ 2.0 (black bars); and 48-h rehydration (gray bars). RL:

Rangpur lime; SM: Sunki Maravilha mandarin; VO: Valencia orange; TAL: Tahiti acid lime.

Values are averages ± standard errors (n=5). Different uppercase letters indicate significant

differences between combinations, and different lowercase letters indicate significant

differences within the same combination, according to the Scott-Knott test (p<0.05).

Figure 6 – Strategies of RL and SM rootstocks during drought. The physiological

responses of drought avoidance (RL) and drought tolerance (SM) are described in the lateral

boxes.

Figures

Figure 1

Figure 2

93

Figure 3

Figure 4

Figure 5

94

Figure 6

95

3. CONCLUSÕES GERAIS

· A ploidia influência na emissão de VOCs;

· Plantas tetraploides de limão Volkameriano apresentaram membranas mais resistentes

ao déficit hídrico;

· Porta-enxertos de citros adotam diferentes estratégias de sobrevivência quando

submetidos ao déficit hídrico;

· O porta-enxerto tangerineira Sunki ‘Maravilha’ é capaz de induzir às copas enxertadas

sobre ele, a mesma estratégia de sobrevivência adotada quando em condição não enxertado;

96

4. REFERÊNCIAS

Allario, T., Brumos, J., Colmenero-Flores, J. M., Iglesias, D. J., Pina, J. A., Navarro,

L., Ollitrault, P., Morillon, R. (2013). Tetraploid Rangpur lime rootstock increases drought

tolerance via enhanced constitutive root abscisic acid production. Plant, cell &

environment, 36(4), 856-868.

Arbona, V., Manzi, M., Ollas, C. D., & Gómez-Cadenas, A. (2013). Metabolomics as

a tool to investigate abiotic stress tolerance in plants. International journal of molecular

sciences, 14(3), 4885-4911.

Argamasilla, R., Gómez-Cadenas, A., & Arbona, V. (2014). Metabolic and

regulatory responses in citrus rootstocks in response to adverse environmental

conditions. Journal of Plant Growth Regulation, 33(2), 169-180.

Arimura, G. I., Shiojiri, K., & Karban, R. (2010). Acquired immunity to herbivory

and allelopathy caused by airborne plant emissions. Phytochemistry, 71(14), 1642-1649.

Aroca, R., Porcel, R., Ruiz-Lozano, J.M., 2012. Regulation of root water uptake

under abiotic stress conditions. Journal of Experimental Botany 63, 43–57.

Barrett, H. C., & Hutchison, D. J. (1982). Occurrence of a spontaneous octoploid in

apomictic seedlings of a tetraploid citrus hybrid. In Proceedings of the International Society

of Citriculture/[International Citrus Congress, November 9-12, 1981, Tokyo, Japan; K.

Matsumoto, editor]. Shimizu, Japan: International Society of Citriculture, 1982-1983.

Barry, G. H., Castle, W. S., & Davies, F. S. (2004). Rootstocks and plant water

relations affect sugar accumulation of citrus fruit via osmotic adjustment. Journal of the

American Society for Horticultural Science, 129(6), 881-889.

Basu PS, Ali M, Chaturvedi SK. 2007. Osmotic adjustment increases water uptake,

remobilization of assimilates and maintains photosynthesis in chickpea under drought. Indian

Journal of Experimental Biology 45, 261–267.

Bauer, H., Ache, P., Lautner, S., Fromm, J., Hartung, W., Al-Rasheid, K. A.,

Sonnewald, S., Sonnewald, U. Kneitz, S., Lachmann, N., Mendel, R. R., Bittner, F.,

97

Hetherington, A.M., Hedrich, R.. (2013). The stomatal response to reduced relative humidity

requires guard cell-autonomous ABA synthesis. Current Biology,23(1), 53-57.

Bray E. A. (1997). Plant responses to water deficit. Trends in Plant Science 2: 48–54.

Brito, M. E. B., dos Anjos Soares, L. A., Fernandes, P. D., de Lima, G. S., da Silva

Sá, F. V., & de Melo, A. S. (2012). Comportamento fisiológico de combinações copa/porta-

enxerto de citros sob estresse hídrico-DOI: 10.5039/agraria. v7isa1941. Revista Brasileira de

Ciências Agrárias (Agrária) Brazilian Journal of Agricultural Sciences, 7, 857-865.

Canal Rural - http://www.canalrural.com.br/noticias/citrus/safra-brasileira-laranja-

2015-2016-crescera-milhoes-caixas-60312. Acesso em: 09/01/2016

Christmann, A., Weiler, E. W., Steudle, E., & Grill, E. (2007). A hydraulic signal in

root-to-shoot signalling of water shortage. The Plant Journal, 52(1), 167-174.

Claeys H. and Inze D. (2013) The agony of choice: how plants balance growth and survival under water-limiting conditions. Plant Physiology 162, 1768–1779.

Coelho, E. F.; Magalhães, A. F. de J.; Coelho Filho, M. A. (2004). Irrigação e

Fertirrigação em Citros. Circular Técnica. Ministério da Agricultura, Pecuária e

Abastecimento. Cruz das Almas. 2004.

Condon A. G., Richards R. A., Rebetzke G. J., Farquar G. D. (2004). Breeding for

high water use efficiency. Journal of Experimental of Botany 55: 2447–2460.

Copolovici, L. O., Filella, I., Llusià, J., Niinemets, Ü., & Peñuelas, J. (2005). The

capacity for thermal protection of photosynthetic electron transport varies for different

monoterpenes in Quercus ilex. Plant Physiology, 139(1), 485-496.

Couée, I., Sulmon, C., Gouesbet, G., & El Amrani, A. (2006). Involvement of

soluble sugars in reactive oxygen species balance and responses to oxidative stress in

plants. Journal of experimental botany, 57(3), 449-459.

da Cruz, M. D. C. M., de Siqueira, D. L., Salomão, L. C. C., Cecon, P. R., & dos

Santos, D. (2015). Teores de carboidratos em tangerineira ‘ponkan’e limeira ácida

‘tahiti’submetidas ao estresse hídrico. Ceres, 55(4).

Dempsey, D. M. A., Vlot, A. C., Wildermuth, M. C., & Klessig, D. F. (2011).

Salicylic acid biosynthesis and metabolism. The Arabidopsis Book, e0156.

Donadio, L.C.; Mourão Filho, F.A.A.; Moreira, C.S. (2005). Centros de origem,

distribuição geográfica das plantas cítricas e histórico da citricultura no Brasil. In: Mattos

Júnior, D.; De Negri, J.D.; Pio, R.M.; Pompeu Júnior, J. (Ed.). Citros. Campinas: Instituto

Agronômico e Fundag, pp.1-18.

98

Dos Reis, S. P., Lima, A. M., & de Souza, C. R. B. (2012). Recent molecular

advances on downstream plant responses to abiotic stress. International journal of molecular

sciences, 13(7), 8628-8647.

Embrapa Mandioca e Fruticultura - https://www.embrapa.br/mandioca-e-fruticultura

Acesso em: 10/01/2016

Fang, D. Q.; Roose, M. L. (1997). Identification of closely related citrus cultivars

with inter-simple sequence repeat markers. Theoretical and Applied Genetics, Amsterdam, v.

95, p 408-417. 1997.

Franck Curk, (2014). Citrus gene pool organization and nuclear genomic

interspecific admixture of cultivated citrus. Universite Montpellier 2. Tese de doutoraodo.

Friml, J. (2003). Auxin transport—shaping the plant. Current opinion in plant

biology, 6(1), 7-12.

Fundecitrus - http://www.fundecitrus.com.br/doencas/greening/10. Acesso em:

10/01/2016

García-Sánchez, F., Syvertsen, J., Gimeno, V., Botía, P., & Perez-Perez, J. G. (2007).

Responses to flooding and drought stress by two citrus rootstock seedlings with different

water-use efficiency. Physiologia Plantarum, 130(4), 532-542.

Hare, J. D. (2011). Ecological role of volatiles produced by plants in response to

damage by herbivorous insects. Annual review of entomology, 56, 161-180.

Horváth, E., Pál, M., Szalai, G., Páldi, E., & Janda, T. (2007). Exogenous 4-

hydroxybenzoic acid and salicylic acid modulate the effect of short-term drought and freezing

stress on wheat plants. Biologia Plantarum, 51(3), 480-487.

IBGE (2013) - Produção Agrícola Municipal. Disponível em:

https://www.embrapa.br/documents/1355135/1529009/Laranja_Brasil_2013.pdf/5c85ffa4-

f792-4db8-b1e7-2940d1cf07e5. Acesso em: 10/01/2016

Ikegami, K., Okamoto, M., Seo, M., & Koshiba, T. (2009). Activation of abscisic

acid biosynthesis in the leaves of Arabidopsis thaliana in response to water deficit. Journal of

plant research, 122(2), 235-243.

Johkan, M., Mitukuri, K., Yamasaki, S., Mori, G., & Oda, M. (2009). Causes of

defoliation and low survival rate of grafted sweet pepper plants. Scientia

Horticulturae, 119(2), 103-107.

Jones, H. G. (2012). How do rootstocks control shoot water relations?. New

Phytologist, 194(2), 301-303.

99

Kempa S, Krasensky J, Dal Santo S, Kopka J, Jonak C. 2008. A central role of

abscisic acid in stress-regulated carbohydrate metabolism. PLoS One 3, e3935.

Kesselmeier, J., & Staudt, M. (1999). Biogenic volatile organic compounds (VOC):

an overview on emission, physiology and ecology. Journal of atmospheric chemistry, 33(1),

23-88.

Keunen, E., Peshev, D., Vangronsveld, J., Van den Ende, W., & Cuypers, A. (2013).

Plant sugars are crucial players in the oxidative challenge during abiotic stress: extending the

traditional concept. Plant, cell & environment,36(7), 1242-1255.

Kramer, P.J. and Boyer, J.S. (1995) Water Relations of Plants and Soils. San Diego:

Academic Press.

Krasensky, J., & Jonak, C. (2012). Drought, salt, and temperature stress-induced

metabolic rearrangements and regulatory networks. Journal of experimental botany, 63(4),

1593-1608.

Lima, H. H. C. D. (2014). Estudo do efeito de adsorvente alternativo de casca de

laranja pera rio (citrus sinensis L. osbeck) na adsorção de corante têxtil vermelho reativo BF-

4G.

Liu, B., Li, M., Cheng, L., Liang, D., Zou, Y., & Ma, F. (2012). Influence of

rootstock on antioxidant system in leaves and roots of young apple trees in response to

drought stress. Plant Growth Regulation, 67(3), 247-256.

Lohbauer, C. (2011). O Panorama da Citricultura no Mundo. Associação Nacional

dos Exportadores de Sucos Citricos.

Loreto, F., & Schnitzler, J. P. (2010). Abiotic stresses and induced BVOCs.Trends in

plant science, 15(3), 154-166.

Lunn, J. E., Delorge, I., Figueroa, C. M., Dijck, P. V., Stitt, M. (2014) Trehalose metabolism in plants. The Plant Journal 79, 544–567.

Magalhaes Filho, J. R., Amaral, L. R., Machado, D. F. S. P., Medina, C. L., &

Machado, E. C. (2008). Deficiência hídrica, trocas gasosas e crescimento de raízes em

laranjeira ‘Valência’sobre dois tipos de porta-enxerto. Bragantia,67(01), 75-82.

MAPA - Ministério da agricultura e produção animal. Disponível em

http://www.agricultura.gov.br/vegetal/culturas/citrus. Acesso em: 08/01/2016

Marengo, J. A. (2014). O futuro clima do Brasil. Revista USP, (103), 25-32.

Marguerit, E., Brendel, O., Lebon, E., Van Leeuwen, C., & Ollat, N. (2012).

Rootstock control of scion transpiration and its acclimation to water deficit are controlled by

different genes. New Phytologist, 194(2), 416-429.

100

Martínez-Ballesta, M. C., Alcaraz-López, C., Muries, B., Mota-Cadenas, C., &

Carvajal, M. (2010). Physiological aspects of rootstock–scion interactions. Scientia

Horticulturae, 127(2), 112-118.

Mattos Junior, D.; Negri, J. D.; Figueiredo, J. O.; Pompeu Junior, J. (2005).

CITROS: principais informações e recomendações de cultivo. Versão eletrônica do Boletim

Técnico 200 (IAC).

McCallum, E. J., Cunningham, J. P., Lücker, J., Zalucki, M. P., De Voss, J. J., &

Botella, J. R. (2011). Increased plant volatile production affects oviposition, but not larval

development, in the moth Helicoverpa armigera.The Journal of experimental

biology, 214(21), 3672-3677.

McDowell, N., Pockman, W. T., Allen, C. D., Breshears, D. D., Cobb, N., Kolb, T., Plaut, J., Sperry, J., West, A., Williams, D. G., Yepez, A. E. (2008) Mechanisms of plant survival and mortality during drought: why do some plants survive while others succumb to drought? New Phytologist 178. 719–739.

Mittler, R. (2006). Abiotic stress, the field environment and stress combination.

Trends Plant Sci. 11, 15–19. doi:10.1016/j.tplants.2005.11.002

Miura, K., & Tada, Y. (2014). Regulation of water, salinity, and cold stress responses

by salicylic acid. Frontiers in Plant Science, 5(4).

Mudge, K., Janick, J., Scofield, S., & Goldschmidt, E. E. (2009). A history of

grafting. Horticultural Reviews, Volume 35, 437-493.

Neves, M. F., & Jank, M. S. (2006). Perspectivas da cadeia produtiva da laranja no

Brasil. São Paulo.

Neves, M. F.; Kalaki, R. B.; Trombin, V. G. (2010). O Retrato da Citricultura

Brasileira, CitrusBR.

Nicotra, A. B., Atkin, O. K., Bonser, S. P., Davidson, A. M., Finnegan, E. J.,

Mathesius, U., Poot, P., Purugganan, M.D., Richards C.L., Valladares, F., van Kleunen, M.

(2010). Plant phenotypic plasticity in a changing climate. Trends in plant science, 15(12),

684-692.

Oliveira, R. P.; Soares Filho, W. S.; Passos, O. S.; ScivittarO, W. B.; Rocha, P. S. G.

(2008). Porta-enxertos para citros. Embrapa Clima Temperado – Documento, 226. Pelotas –

Rio Grande do Sul.

Paré, P. W., & Tumlinson, J. H. (1999). Plant volatiles as a defense against insect

herbivores. Plant physiology, 121(2), 325-332.

101

Paulillo, L. F. (2006). Agroindústria e citricultura no Brasil: diferenças e

dominâncias. Editora E-papers.

Pedroso, F. K., Prudente, D. A., Bueno, A. C. R., Machado, E. C., & Ribeiro, R. V.

(2014). Drought tolerance in citrus trees is enhanced by rootstock-dependent changes in root

growth and carbohydrate availability.Environmental and Experimental Botany, 101, 26-35.

Pinto-Zevallos, D. M., Martins, C. B., Pellegrino, A. C., & Zarbin, P. H. (2013).

Compostos orgânicos voláteis na defesa induzida das plantas contra insetos herbívoros. Quim

Nova, 36, 1395-1405.

Pompeu JR., J. (1991). Porta-enxertos. In: Rodriguez, O.; Viégas, F.; Pompeu JR., J.;

Amaro, A. A. (Eds.) Citricultura Brasileira, v. 1. São Paulo: Fundação Cargil, 3ª Ed., pp.265-

280.

Reed, T. E., Waples, R. S., Schindler, D. E., Hard, J. J., & Kinnison, M. T. (2010).

Phenotypic plasticity and population viability: the importance of environmental

predictability. Proceedings of the Royal Society of London B: Biological Sciences, 277(1699),

3391-3400.

Revista Globo Rural -http://revistagloborural.globo.com/Noticias/Agricultura

/noticia/2016/01/safra-brasileira-de-laranja-201516-deve-crescer-10-milhoes-de-caixas-

02.html. Acesso em: 08/01/2016

Ribeiro, G. D.; Costa, J. N. M.; Vieira, A. H.; Santos, M. R. A. (2005). Enxertia em

fruteiras. Recomendações técnicas n° 92 – Embrapa, Porto Velho – RO.

Rodríguez-Gamir, J., Primo-Millo, E., Forner, J. B., & Forner-Giner, M. A. (2010).

Citrus rootstock responses to water stress. Scientia horticulturae,126(2), 95-102.

Rolland, F., Moore, B., & Sheen, J. (2002). Sugar sensing and signaling in

plants. The Plant Cell, 14(suppl 1), S185-S205.

Romero, P., Navarro, J. M., Pérez-Pérez, J., García-Sánchez, F., Gómez-Gómez, A.,

Porras, I., & Botía, P. (2006). Deficit irrigation and rootstock: their effects on water relations,

vegetative development, yield, fruit quality and mineral nutrition of Clemenules

mandarin. Tree Physiology, 26(12), 1537-1548.

Sachs, T. (2005). Auxin’s role as an example of the mechanisms of shoot/root

relations. Plant and Soil, 268(1), 13-19.

Saleh, B., Allario, T., Dambier, D., Ollitrault, P., & Morillon, R. (2008). Tetraploid

citrus rootstocks are more tolerant to salt stress than diploid.Comptes rendus

biologies, 331(9), 703-710.

102

Sánchez-Rodríguez, E., del Mar Rubio-Wilhelmi, M., Blasco, B., Leyva, R.,

Romero, L., & Ruiz, J. M. (2012). Antioxidant response resides in the shoot in reciprocal

grafts of drought-tolerant and drought-sensitive cultivars in tomato under water stress. Plant

science, 188, 89-96.

Santos, R. F., & Carlesso, R. (1998). Déficit hídrico e os processos morfológico e

fisiológico das plantas. Revista Brasileira de Engenharia Agrícola e Ambiental, 2(3), 287-

294.

Sentelhas, P. C. (2005) Agrometeorologia dos citros. In: Mattos Junior, D.; Negri, J.

D.; Pio, R. M.; Pompeu Junior, J (eds.) Citros. Instituto Agronômico e Fundag Campinas. p.

317-344.

Soar C. J., Dry P. R., Loveys B. R. (2006). Scion photosynthesis and leaf gas

exchange in Vitis vinifera L. cv. Shiraz: mediation of rootstock effects via xylem sap ABA.

Australian Journal of Agricultural Research 12: 82–96.

Soares-Filho, W. dos S., Vilarinhos, A. D., Alves, A. A. C., Sobrinho, A. P. C.,

Oliveira, A. A. R., Souza, A. S., Ledo, C.A.S., Cruz, J.L., Souza, L.D., Castro-Neto, M.T.,

Guerra-Filho, M.S., Passos, O.S., Meissner-Filho, P.E. (2003a) Citrus breeding at Embrapa

Cassava&Fruits: development of hybrids. Embrapa Cassava & Fruits, Cruz das Almas, 39 p.

Documentos, ISSN 1516-5728; n° 107

Soares-Filho, W. dos S., Vilarinhos, A. D., Alves, A. A. C., Sobrinho, A. P. C.,

Oliveira, A. A. R., Souza, A. S., Ledo, C.A.S., Cruz, J.L., Souza, L.D., Castro-Neto, M.T.,

Guerra-Filho, M.S., Passos, O.S., Meissner-Filho, P.E. (2003b) Programa de Melhoramento

Genético de Citros da Embrapa Mandioca e Fruticultura: obtenção de híbridos. Embrapa

Cassava & Fruits, Cruz das Almas, 37 p. Documentos, ISSN 1516-5728; n° 106

Taiz, L.; Zeiger, E.. (2013) Fisiologia Vegetal. Tradução: Arnaldo Molina Divan

Junior et al. 5ª edição. Artmed.

Tzarfati, R., Ben-Dor, S., Sela, I., & Goldschmidt, E. E. (2013). Graft-induced

changes in microRNA expression patterns in Citrus leaf petioles. Open Plant Sci. J, 7, 17-23.

Verslues, P. E., Agarwal, M., Katiyar-Agarwal, S., Zhu, J., & Zhu, J. K. (2006).

Methods and concepts in quantifying resistance to drought, salt and freezing, abiotic stresses

that affect plant water status. The Plant Journal,45(4), 523-539.

Viana, M. M.; Braga, D.. Cenário continua positivo em 2008. Hortifrutibrasil,

Piracicaba, dez. 2007. Disponível em: http://www.cepea.esalq.usp.br/hfbrasil/edicoes

/64/citros.pdf. Acesso em: 12 de julho de 2013.

103

Vieira, D. G.. (1991) Irrigação de citros. In: Rodriguez, O.; Viegas, F.; Pompeu

Júnior, J.; Amaro, A. A.. Citricultura Brasileira, 2 ed. Campinas: Fundação Cargill. p. 519-

541.

Warschefsky, E. J., Klein, L. L., Frank, M. H., Chitwood, D. H., Londo, J. P., von

Wettberg, E. J., & Miller, A. J. (2015). Rootstocks: Diversity, Domestication, and Impacts on

Shoot Phenotypes. Trends in plant science.

Yakushiji, H., Morinaga, K., & Nonami, H. (1998). Sugar accumulation and

partitioning in Satsuma mandarin tree tissues and fruit in response to drought stress. Journal

of the American Society for Horticultural Science, 123(4), 719-726.