2Castilho Et Al

8/12/2019 2Castilho Et Al

http://slidepdf.com/reader/full/2castilho-et-al 1/11

A Real-Time Polymerase Chain Reaction Assay for the Identification and

Quantification of American Leishmania Species on the Basis of

Glucose-6-Phosphate Dehydrogenase

Tiago Moreno Castilho, Luís Marcelo Aranha Camargo, Diane McMahon-Pratt, Jeffrey Jon Shaw, and

Lucile Maria Floeter-Winter*Department of Epidemiology and Public Health, Yale University School of Medicine, New Haven, Connecticut; Departamento de

Fisiologia, Instituto de Biociências, Universidade de São Paulo, São Paulo, São Paulo, Brazil; Departamento de Parasitologia, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, São Paulo, Brazil

Abstract. A real-time polymerase chain reaction (PCR) test was developed on the basis of the Leishmania glucose-6-phosphate dehydrogenase locus that enables identification and quantification of parasites. Using two independentpairs of primers in SYBR-Green assays, the test identified etiologic agents of cutaneous leishmaniasis belonging to bothsubgenera, Leishmania (Viannia) and Leishmania (Leishmania) in the Americas. Furthermore, use of TaqMan probesenables distinction between L. (V.) braziliensis or L. (V.) peruviania from the other L. (Viannia) species. All assays werenegative with DNA of related trypanosomatids, humans, and mice. The parasite burden was estimated by normalizingthe number of organisms per total amount of DNA in the sample or per host glyceraldehyde-3-phosphate dehydrogenasecopies. The real-time PCR assay for L. (Leishmania) subgenus showed a good linear correlation with quantification onthe basis of a limiting dilution assay in experimentally infected mice. The test successfully identifies and quantifiesLeishmania in human biopsy specimens and represents a new tool to study leishmaniasis.

INTRODUCTION

Protozoan parasites of the genus Leishmania1–3 have twohosts in their life cycle. In phlebotomine sand flies, promas-tigote forms develop in the intestinal lumen, and in the ver-tebrate host, amastigote forms are found in macrophages. In-fection is acquired through the bite of the sand fly and inhumans (who are normally accidental hosts in Americas) theinfection can result in diseases known as leishmaniases. Clini-cal forms of leishmaniasis are numerous, depending on thespecies of Leishmania and the genetic background of the pa-tient. These forms are broadly classified as cutaneous, bor-derline disseminated cutaneous, diffuse cutaneous, mucocu-

taneous, and visceral or post-kala-zar dermal. Twenty-twospecies of Leishmania have been reported in human infec-tions.4–6 These parasites are found in more than 80 countriesin tropical, subtropical, and temperate regions. They are im-portant emerging/re-emerging zoonoses,7 and according tothe World Health Organization,8 an estimated 1.5–2 millionnew cases occur annually.

In South America, these organisms are grouped into twosubgenera, Leishmania (Leishmania) and L. (Viannia), a clas-sification initially based on the mode of development of pro-mastigotes in the sand fly gut3 but recently confirmed by mo-lecular methods.9,10 Although there is no direct correlationbetween a specific clinical form and the causative species,6

some associations are found. For example, Leishmania (V.)braziliensis is responsible for the most morbid and disfiguringform of the disease known as espundia or mucocutaneousleishmaniasis.6,11 This species is found between latitudes 19°Nand 29°S.7 Other L. (Viannia) species, such as L. (V.) pana-

mensis, L. (V.) guyanensis, and L. (V.) shawi are the commoncauses of cutaneous leishmaniasis in the rain forests of Cen-tral America and Amazonia.

Quantification of viable Leishmania in host tissues hasbeen generally evaluated by methods that rely on the capacity

of tissue amastigotes to differentiate into promastigotes in

culture media.12–15 There is one quantification protocol basedon a polymerase chain reaction (PCR),16 but it has not been

compared with other methods, such as a competitive PCR

method that was used to evaluate parasite burden.17 The most

commonly used protocol for parasite quantification is the lim-iting dilution assay (LDA).13,14 This assay is arduous, time-

consuming, and depends on sterile conditions and highly

trained personnel. These characteristics nearly exclude the

possibility of it being used for routine examinations of biopsy

specimens collected under field conditions from sylvatic ani-mals and patients.

With the advances in PCR technology during the past de-cade, specifically real-time PCR and analysis of kinetics of

amplicon formation, it is now possible to quantify the initial

number of template molecules.18–21 Real-time PCR assays

are being successfully used for diagnosis of viral infections22

and toxoplasmosis.23

Real-time PCR assays have been described for Leishmania

detection24 based on the DNA polymerase gene of L. (L.)

infantum,25 the glucose phosphate isomerase (GPI) gene,26

kinetoplast DNA (kDNA),27,28 and ribosomal DNA(rDNA).29 However, most of these tests are not species spe-cific. Some real-time PCR assays differentiate between

groups of Leishmania,26,30 such as parasites of the L. dono-vani complex, and the subgenus L. (Viannia) and other spe-cies of the subgenus L. (Leishmania). More recently, one of these assays was used to diagnose human cases but the indi-vidual species were identified by sequencing of the cyto-chrome b gene.31 These methods are already being used inclinical studies32,33 and with experimental infections.25,34,35

To our knowledge, there are no publications describing areal-time PCR assay that can distinguish Leishmania (Vian-

nia) organisms at species level. The existing literature pointsto an urgent need for new probes that either alone or inassociation with those already described will identify differentLeishmania (Viannia) species and quantify the parasites.

* Address correspondence to Lucile M. Floeter-Winter, Departa-mento de Fisiologia, Instituto de Biociências, Universidade de SãoPaulo; Rua do Matão, Travessa 14, no. 101, Cidade Universitária, SãoPaulo, São Paulo, Brazil, CEP 05508-900. E-mail: [email protected]

Am. J. Trop. Med. Hyg., 78(1), 2008, pp. 122–132Copyright © 2008 by The American Society of Tropical Medicine and Hygiene

122



In this report, we describe real-time PCR assays based onthe glucose-6-phosphate dehydrogenase (G6PD) gene thatdetect and quantify Leishmania species associated with cuta-neous and mucocutaneous leishmaniases in the Americas. Us-ing either non-specific sequence methodology (SYBR-Green)or sequence-specific amplicon detection (TaqMan probes),assays detected and quantified Leishmania DNA. Further-

more, they differentiated L. (V.) braziliensis from other L.(Viannia) species and from those of L. (Leishmania). In ad-dition, an assay based on mammalian glyceraldehyde-3-phosphate dehydrogenase (GAPD) was developed to quan-tify mammalian DNA, which enabled the number of parasitesto be expressed per host GAPD copies.

MATERIALS AND METHODS

Organisms and cell culture. Promastigotes of all Leishma-

nia species listed in Table 1 were grown at 25°C in M199medium (GIBCO-BRL, Gaithersburg, MD) containing 10%fetal bovine serum.36 Trypanosoma cruzi and Crithidia fas-

ciculata were grown at 28°C in liver infusion medium.37

C1A.R2 cells were grown in RPMI 1640 medium (GIBCO-BRL) at 37°C in an atmosphere of 5% CO2.

Mice and experimental infection. Six BALB/c mice wereinfected in the hind footpad with 2 × 106 stationary growthphase promastigotes of L. (L.) amazonensis (MHOM/BR/1973/M2269). The parasite burdens were determined bymethods using the ELIDA program.13,14,38 Mice were killedby overexposure to CO2, which complied with the currentrecommendations for animal use of the Colégio Brasileiro deExperimentação Animal of Brazil and the Comissão de Ética

em Experimentação Animal of the Instituto de CiênciasBiomédicas (Universidade de São Paulo).

Patient biopsies. Biopsies were taken with a punch from

patients from Rondônia State in the northwestern region of

Brazil and preserved in NET buffer (0.15 M NaCl, 50 mMEDTA, 0.1 M Tris-HCl, pH 7.5) at room temperature during

transportation to the city of São Paulo. The material was

washed three times with 1× phosphate-buffered saline (PBS)(7 mM Na2HPO4, 26 mM NaH2PO4, 130 mM NaCl) and thenprocessed as described for total DNA. The Institutional Ethi-

cal Commission reviewed and approved the study.Purification and analysis of nucleic acids. DNA from cul-

tured cells, control human DNA, or biopsy specimens waspurified using the sodium dodecyl sulfate/proteinase K/phe-nol extraction method.39 Mouse tissue DNA was extracted bya modified protocol. Each tissue homogenate was preparedusing surgical instruments extensively washed with soap,treated with bleach, extensively washed, and baked at 200°Cfor 2 hours prior to use. The homogenates were suspended in1× PBS and incubated with two volumes of erythrocyte lysisbuffer (0.15 M ammonium chloride, 0.1 mM EDTA, 10 mM

potassium bicarbonate, pH 7.3) for five minutes. After adding3.3 volumes of 1× PBS, the homogenate was centrifuged andthe DNA was extracted as described above from the pellet.The extracted DNA was precipitated with ethanol and dis-solved in 10–50 L of TE buffer (10 mM Tris-HCl, 1 mMEDTA), quantified by measuring absorbance at 260 nm, andadjusted to a concentration of 10 ng/L (this solution wasthen diluted to perform the reactions). The nucleic acids werefractionated by agarose gel electrophoresis 1× TAE buffer(40 mM Tris-acetate, 2 mM EDTA).

TABLE 1

Organisms used and reactions in the glucose-6-phosphate dehydrogenase (G6PD) real-time polymerase chain reaction assay

Organism* Reference†

G6PD real-time polymerase chain reaction assay‡

L V Nbra bra

L. (V.) braziliensis MHOM/BR/1975/M2903§ – + – +L. (V.) braziliensis MHOM/BR/1994/631¶ – + – +L .(V.) braziliensis MHOM/BR/1984/648¶ – ND – +L. (V.) braziliensis MHOM/BR/1994/M15140¶ – ND – +L. (V.) braziliensis MHOM/BR/1994/M15176¶ – + – +L. (V.) peruviania MHOM/PE/1984/Lc39§ – + – +L. (V.) guyanensis MHOM/BR/1975/M4147¶ – + + –L. (V.) panamensis MHOM/PA/1971/LS94¶ – + + –L. (V.) lainsoni MHOM/BR/1981/M6426§ – + + –L. (V.) utingensis ITUB/BR/1977/M4964¶ – + + –L. (L.) amazonensis MHOM/BR/1973/M2269§ + – – –L. (L.) amazonensis MHOM/BR/1977/LBT0016# + ND ND NDL. (L.) mexicana MNYC/BZ/1962/M379# + ND – –L. (L.) pifanoi MHOM/VE/1960/Ltrod# + ND – –

L. (L.) infantum MHOM/SP/XXXX/QQ#** – – – –L. (S.) adleri RLAT/KE/1954/Heisch146§ – – – –C. fasciculata ATCC 30267§ – – – –T. cruzi Y strain§ – – – –Human C1A.R2 cells# – – – –Male human DNA†† – – – –BALB/c mice# – ND – –C57B/6 mice# – – ND ND

* L. Leishmani; V . Viannia; S. Sauroleishmania; C . Crithidia; T . Trypanosoma.† Isolates are indicated as described by the World Health Organization (1984).‡ L and VS are the reactivity on SYBR-Green assays for cutaneous L. (Leishmania) species and for L. (Viannia) species, respectively; and nbra and bra are the reactivity of G6PD-VIC-nbra

and G6PD-FAM-bra probes, respectively, on the L. (Viannia) TaqMan assay (see Table 2 for more details about the primers and Materials and Methods for details about the probes). ND not determined.

§ Department of Parasitology, Institute of Biomedical Sciences, University of São Paulo, São Paulo, Brazil.¶ Instituto Evandro Chagas, Belém, Pará, Brazil.# Department of Epidemiology and Public Health, Yale School of Medicine, Yale University, New Haven, CT, USA.** The year that this strain was isolated is not known.†† Applied Biosystems, Foster City, CA.

IDENTIFICATION AND QUANTIFICATION OF LEISHMANIA 123



Quantified DNA standards. The quantified standards arePCR products, containing the respective amplicon, cloned inPCR2.1-TOPO (Invitrogen, Carlsbad, CA) with the TOPOTA Cloning Kit (Invitrogen) according to the manufactur-er’s instructions. For the Leishmania G6PD assays, the prod-uct was the 5 end of G6PD mRNA obtained by reversetranscription–PCR as previously described.40 For the mam-

malian GAPD assay, the amplicon was amplified with theexternal primers GAPD-EF (5-CCA GAA CAT CAT CCCTGC-3) and GAPD-ER (5-GGT GCT CAG TGT AGCCCA-3) as adapted40 from the original description41 withannealing at 55°C and extension for 30 seconds.

Real-time PCR. The real time PCR was conducted in anABI PRISM 7000 Sequence Detection System (AppliedBiosystems, Foster City, CA) in a volume of 50 L. EitherSYBR-Green PCR Master Mix or TaqMan Universal Mas-ter Mix (both from Applied Biosystems) were used. Oligo-nucleotides were used at concentrations of 50 nM for bothreactions, and probes were used at concentrations of 200 nMfor the TaqMan assays. The thermal profile was an initialactivation of DNA polymerase at 95°C for 10 minutes, fol-

lowed by cycles of 95°C for 15 seconds. Annealing tempera-tures and extension times are specified for each assay in Table2. The LDA method was compared with the L SYBR-Greenassay (normalized by the M SYBR-Green assay) that wasconducted in an iCycler iQ Real-Time PCR Detection System(Bio-Rad Laboratories, Hercules, CA) using iQ SYBR GreenSupermix (Bio-Rad Laboratories) with oligonucleotides atconcentrations of 500 nM. The thermal profile was an initialactivation of DNA polymerase 95°C for 3 minutes, followedby cycles of 95°C for 30 seconds and extension for 30 secondsat 60°C or 63°C for the L and M assays, respectively. Theefficiency of each assay was calculated by the formula E

10−1/slope − 1, where the slope is the linear coefficient obtainedfrom the linear regression of the standard curve.

Sequence analysis. The BLASTx program42 was used tocheck the nucleotide sequence similarity with other proteinsin GenBank. Sequences were aligned with BioEdit,43 Clustal-W,44 or Esee Eye Ball.45 The primers were designed withPrimer Express Software version 2.0 (Applied Biosystems)and OligoTech version 1.0 (Oligos Etc. Incand and OligoTherapeutics Inc., Wilsonville, OR). Real-time PCR datawere acquired and analyzed in the ABI Prism 7000 SDS (Ap-plied Biosystems).

RESULTS

Nucleotide sequence of G6PD in the genus Leishmania.

We isolated a fragment of the 5 end of G6PD mRNA se-quence of L. (L.) infantum and L. (L.) chagasi (Figure 1A)using the same strategy previously used to characterize theG6PD sequence of Leishmania40 (nucleotide sequence is

available in GenBank database under accession numbersDQ212793 and DQ212794). By comparing the G6PD se-quence of L. (L.) amazonensis, L. (L.) mexicana, L. (L.)chagasi, L. (L.) infantum, L. (V.) braziliensis, L. (V.) guyan-

ensis, L. (V.) panamensis, L. (V.) lainsoni, L. (V.) shawi, andL. (V.) naiffi, we designed oligonucleotides that in SYBR-Green assays selectively amplify L. (Viannia) parasite DNA(G6PD-LVF and G6PD-LVR, V assay) or cutaneous L.

(Leishmania) DNA (G6PD-LLF and G6PD-LLR, L assay).We also designed two labeled probes to be used together inthe V assay to distinguish L. (V.) braziliensis (G6PD-FAM-bra) from the other L. (Viannia) species (G6PD-VIC-nbra) ina TaqMan assay (VT assay). The position of each oligonucle-otide and probe is shown in Figure 1A and their sequences

are shown in Table 2.Subgenus specific assays. The L SYBR-Green assay (an-

nealing at 58°C and extension for 1 minute; Table 2) success-fully generated amplification products from L. (L.) amazon-

ensis, L. (L.) mexicana, and L. (L.) pifanoi. Results of theassay were negative for DNA from phylogenetically relatedL. (L.) infantum, all L. (Viannia) species tested, L. (Sau-

roleishmania) adleri, C. fasciculata, T. cruzi, humans, andmice (Table 1).

DNA templates from all L. (Viannia) subgenus speciestested produced amplification products in the V SYBR-Green assay (annealing at 65°C and extension for 30 seconds;Table 2). Results of the same assay were negative with DNAfrom L. (L.) amazonensis, L. (L.) mexicana, L. (L.) pifanoi,

L. (L.) infantum, L. (S.) adleri, C. fasciculata, T. cruzi, hu-mans, and mice (Table 1).

For the L and V SYBR-Green assays, melting curve analy-sis showed a single peak indicating its specificity, which wasconfirmed by fractionation in an agarose gel. The meltingtemperature (Tm) for the L SYBR-Green assay was 79.8°C ±0.2°C, and although the Tm for L. (V.) braziliensis and L. (V.)

peruviania in the V assay was slightly lower than for other L.

(Viannia) species, it cannot be used in their distinction be-

TABLE 2

Oligonucleotides used in this study, specific polymerase chain reaction (PCR) conditions for each pair of primers, fragment length of products,and labeled probes*

Name Sequence (5→3) Tm, °C Ori Assay† A/C‡ E§ L¶

G6PD-LLF CTTGTTGCCTCCGGCTAC 55.5 For L 58°C 1 m 101G6PD-LLR GGCCATGTAAGCATCCTCAT 56.2 Rev 45G6PD-LVF TTGATCACTGGTACATGCATTAAG 55.7 For VS 65°C 30 s 101G6PD-LVR CTCGTCCAGAATGCAGCAC 56.5 Rev 50GAPD-F GTGGGCAAGGTCATC 55.6 For M 63°C 30 s 144GAPD-R CTGCTTCACCACCTTCTTGAT 55.6 Rev 40G6PD-FAM-bra TCGCCATGTCGGAGGATTCCAGT 67.6 For VT# 63°C 30 s 101G6PD-VIC-nbra TCGCCATGTCGTCGGAGCATTC 68.2 For 50

* Tm melting temperature; Ori orientation of primer; G6PD glucose-6-phosphate dehydrogenase; GAPD glyceraldehydes-3-phosphate dehydrogenase; For forward; Rev reverse.

† Assay name.‡ Assay annealing temperature (°C) and number of cycles.§ Assay extension time in minutes (m) or seconds (s).¶ Length of the PCR product in basepairs.# Used with oligonucleotides from pair VS.

CASTILHO AND OTHERS124



cause inter-assays variations were detected (80.15°C ± 0.06°Cfor L.(V.) braziliensis M2903, 80.05°C ± 0.06°C for L.(V.)

peruviania, 80.3°C ± 0.14°C for L.(V.) guyanensis, 80.55°C ±0.06°C for L. (V.) panamensis, 80.3°C ± 0.12°C for L.(V.)lainsoni, and 81°C ± 0.12°C for L. (V.) utingensis).

Identfication of L.(V.) braziliensis in L.(Viannia) subge-

nus. In the VT TaqMan assay (annealing at 63°C and exten-sion for 30 seconds; Table 2), the G6PD-FAM-bra probeshowed a positive reaction with DNA of all L. (V.) brazilien-

sis strains tested and with L. (V.) peruviania and a negative

FIGURE 1. Sequence alignment of Leishmania glucose-6-phosphate dehydrogenase (G6PD) and mammalian glyceraldehyde-3-phosphatedehydrogenase (GAPD) indicating probes and oligonucleotides positions. A, Sequence alignment of the Leishmania G6PD from nucleotides -58to 68 for L. (Leishmania) species and -59 to 66 or 69 for L. (Viannia) braziliensis and L. (V.) non-braziliensis species, respectively. The start codonis highlighted in gray (the A is the nucleotide +1). The sequences of Leishmania G6PD were described previously,40 except by L. (L.) infantumand L. (L.) chagasi (MCER/BR/1981/M6445) sequences that were obtained by the same strategy (GenBank accession numbers DQ212793 andDQ212794, respectively). The underlined sequences indicate positions of the oligonucleotides g6pd-LLF and g6pd-LLR (in cutaneous L. (L.)species sequence for the L assay) and g6pd-LVF and g6pd-LVR (in L. (V.) species sequence for the V assay). The underlined and italic sequencesare probes for L. (V.) braziliensis - g6pd-Fam-bra (in L. (V.) braziliensis sequence) and for L. (V.) non-braziliensis - g6pd-Vic-nbra (in the otherL. (V.) species). B, Corresponding sequences of the oligonucleotides gapd-F and gapd-R are underlined. The sequences were numbered accordingto GenBank designations (accession numbers NM_002046, AF017079, NM_008084, X02231X00972, AF512009, AF157626, AB038241, andU85042, respectively). An asterisk indicates a conserved nucleotide for the sequence groups of cutaneous L. (L.) subgenus, L. (V.) subgenus,Leishmania genus, or for all sequences on G6PD alignment, or for all mammalian sequences on GAPD alignment. For details on primers,amplicons length, and assay conditions, see Table 2.




reaction with DNA of all other L. (Viannia) species. Con-versely, the G6PD-VIC-nbra probe showed a negative reac-tion with DNA of all L. (V.) braziliensis strains tested andwith L. (V.) peruviania, and a positive reaction with all otherL. (Viannia) species. Both probes showed negative reactionswith DNA from L. (L.) amazonensis, L. (L.) mexicana, L.

(L.) pifanoi, L. (L.) infantum, L. (S.) adleri, C. fasciculata, T.

cruzi, humans, and mice (Table 1). Leishmania quantification assays. Plasmids carrying the 5

end of the G6PD gene of L. (V.) braziliensis and L. (V.)

guyanensis were used in serial dilutions as standards in theVT TaqMan assay (Figure 2A and B) or in the V SYBR-Green Assay (Figure 2C). Plasmids with the 5 end of theG6PD gene from L. (L.) amazonensis were used as astandard in L SYBR-Green assay (Figure 2D). The standardcurves for the assays (threshold cycle versus logarithm of the initial amplicon copy number) showed a good linear

correlation in the range of 2 × 105

to 2 × 101

G6PD copies.The efficiencies for the VT TaqMan assay were 0.886and 0.957 for L. (V.) braziliensis and L. (V.) guyanensis, re-

FIGURE 2. Sensitivity of the VT, L, V, and M assays. Standard curves (threshold cycle versus logarithmic of template copy number) of the VTTaqMan assay for glucose-6-phosphate dehydrogenase ( g6pd)-FAM-bra probe (A) or for g6pd-VIC-nbra probe (B), and of the V (C), L (D), andM (F) SYBR-Green assays were obtained by using dilution of plasmids containing the respective amplicons. The G6PD assays used as a template10-fold serial dilutions representing 2 × 105 to 2 × 101 plasmid copies per reaction (in duplicate), and the GAPD assay used as a template 10-foldserial dilutions from 2 × 106 to 2 × 102 plasmids copies per reaction. The amplicons were cloned from Leishmania (Viannia) braziliensis M2903,L. (V.) guyanensis M4147 and L. (Leishmania) amazonensis M2269 DNA for the G6PD assays and from human male DNA (Applied Biosystems,Foster City, CA) for the GAPD assay, respectively (see Materials and Methods for details). Determination of the interference of human DNA(200 ng extracted from C1A.R2 cells) on the V SYBR-Green assay (C) used as template 2 × 105 to 2 × 101 plasmids copies (containing the L. (V.)braziliensis and L. (V.) guyanensis amplicons; the average of both assays is shown). Determination of interference of different amounts of humanDNA (extracted from C1A.R2 cells) on the V SYBR-Green assay (E) used as template 2 × 103 plasmid copies (containing the L. (V.) braziliensisamplicon).




spectively, and the efficiency for the L SYBR-Green assaywas 0.504.

A small level of interference was observed that was pro-portional to the amount of non-specific DNA (Figure 2E).This interference was probably caused by changes in the base-line fluorescence generated by the addition of more DNA.However, the presence of up to 200 ng of non-specific human

DNA (extracted from C1A.R2 cells) did not significantly in-terfere in the quantification of the copy number per reactionin the range of 2 × 105 to 2 × 101G6PD copies (Figure 2C).

We also designed two primers in conserved regions theGAPD gene from different mammals (Figure 1B) that wereused together in a SYBR-Green assay (GAPD-F and GAPD-R, M assay; Table 2). The M SYBR-Green assay (annealing at63°C and extension for 30 seconds) showed a positive resultwith human and mouse DNA and a negative result with L.(L.) amazonensis orL. (V.) guyanensisDNA. It is noteworthythat pseudogenes were also amplified. This was evaluatedfrom the melting curve analysis and also from the sequence of the PCR products. This is a common problem with oligo-nucleotides that target this gene. Recently, a set of oligonucle-

otides were designed that is specific for human GAPD46

byexploiting sequences outside of the open reading frame in anintron-exon boundary. Unfortunately, because our goal wasto have an assay to amplify mammalian DNA from differentpotential reservoirs as well as humans, these oligonucleotidescannot be used. However, as long as the number of pseudo-genes is relatively constant in the population being studied, itshould not interfere in the analysis.

We amplified and cloned the GAPD amplicon obtainedwith external primers GAPD-EF and GAPD-ER from hu-man DNA (Applied Biosystems). The M SYBR-Green assaycontaining between 2 × 107 and 2 × 102 plasmid copies showeda good linear correlation (Figure 2F). This assay enables nor-malization of the number of parasites in each sample by the

number of mammalian host GAPD copies.Initial attempts to detect Leishmania DNA in tissue homo-

genates of BALB/c mice were unsuccessful. We verified thepresence of DNA polymerase inhibitors by adding plasmidscontaining the cloned amplicon to the samples. Such effectswere not observed previously with DNA extracted from cul-tured human cells. To circumvent this problem, we performedthe reactions with a maximum of 20 ng of total DNA per well,

and at least three serial dilutions (1:4) were analyzed (i.e., 2,0.4 and 0.08 ng/reaction). We evaluated the efficiency of para-site quantification assay by comparing it to the LDAmethod.13,14 Six mice infected with L. (L.) amazonensis werekilled at different time points after infection. The parasiteburden was determined by both LDA and G6PD-based real-time PCR assays. In the latter assay, DNA was extracted from

undiluted tissue homogenate and then tested with the LSYBR-Green assay.

Some samples showed amplification patterns, which indi-cated DNA inhibitors (concentrated solutions appeared tohave fewer or about the same number of parasites and mam-malian DNA as diluted samples). Also, in some samples, thelevel of parasite DNA seemed to be diluted below our detec-tion limit. To guide the analyses, we defined two objectiveparameters, namely, the empirically dilution factor (ODF),which is the copy number in a concentrated solution dividedby the copy number in its diluted solution, and the theoreticaldilution factor (TDF), which is the theoretical dilution (i.e., ina 1:4 dilution the theoretical dilution factor is 5). To analyzeinhibition in concentrated samples, we used three require-

ments: 1) a sample should be excluded if the ODF:TDF ratiois less than 0.5; 2) in a dilution series after the first dilutionsatisfies the first requirement, subsequent dilutions are in-cluded in the analysis; and 3) samples with no parasites areexcluded.

We normalized the parasite number by the amount of DNA used (Figure 3A) or by the mammalian GAPD copynumber obtained by the M SYBR-Green assay (Figure 3B).Both curves showed a good linear correlation when plottedagainst the LDA quantification (R2

0.975 and 0.938, re-spectively). This re-enforces the use of real-time PCR tech-nology to estimate parasite burden in tissues, as previouslyconducted by targeting the DNA polymerase gene.25 How-ever, it is essential to determine the presence of DNA poly-

merase inhibitors for an accurate quantification. In this re-spect, a secondary GAPD M assay functions as control for thepresence of inhibitors in the amplification reactions.

The results of normalizing the copy number of Leishmaniaby either the total amount of DNA or by the copy number of the mammalian GAPD gene were similar (Figure 3). From 2to 21,100 parasites in 2 ng of total DNA could be detected.The M assay is not necessary for quantification, but when

FIGURE 3. Correlation between parasite burden estimated by limiting dilution assay and glucose-6-phosphate dehydrogenase ( g6pd)–basedreal time polymerase chain reaction assay in BALB/c mice infected with Leishmania (Leishmania) amazonensis. The log of the parasite burdenper footpad determined by limiting dilution assay is plotted against the log of the number of Leishmania normalized by A, 10 ng of DNA extractedfrom the footpad or by B, 2 × 106 copies of mammalian GAPD. The number of parasites and the mammalian GAPD copies was determinedthrough the L and M assay (see Table 2), respectively. Each sample was quantified in quadruplicate for both assays in different concentrationsof template DNA (20, 2, 0.4, and 0.08 ng). Error bars indicate the standard deviation.




there is a restriction on the amount of DNA, it becomesextremely useful to confirm that the sample is negative. TheM assay adds precision to the assay because total DNA in thedilutions cannot be readily verified for accuracy because of the low concentrations involved. Furthermore, because theselected region in the GAPD gene for the M assay is highlyconserved, it can be used with any sylvatic Leishmania reser-

voir DNA. However, we strongly recommend that the ratio of GAPD amplicons per nanogram of DNA be evaluated. Evenin areas where both L. (V.) braziliensis and other L. (Viannia)species are sympatric, it will be possible to study the incidenceand distribution without having to isolate the parasite.

Use of G6PD-based real-time PCR with DNA of human

biopsy samples. As expected, normalization by GAPD copynumber for the BALB/c mice was linear for an isogenic popu-lation. However, this is not the case in a human population.Consequently, we determined the ratio of GAPD copies pernanogram of total DNA from 3 different healthy donors withdifferences less than 25% (Figure 4A).

We used the V TaqMan and M SYBR-Green assays inDNA samples from 12 patients. Eleven of these patients were

positive for Leishmania by G6PD-based PCR40

; one patientwas negative by PCR, although positively diagnosed for leish-maniasis on clinical grounds (Table 3). The DNA polymeraseinhibition was an issue in human biopsy specimens becausesome samples had to be diluted to 8 pg per reaction to enableamplification. Samples that are positive for L. (V.) braziliensis by the G6PD-based PCR are also positive for the G6PD-FAM-bra probe. Furthermore, samples that are positive forL. (Viannia) non-braziliensis species are positive with theG6PD-VIC-nbra probe (Figure 4B). The number of parasites

varied from 51 to 8.36 × 103 per 105 mammalian GAPD cop-ies. The sample from the patient initially negative by PCR waspositive using the G6PD-FAM-bra probe, with a level of 88.7parasites detected per 105 mammalian GAPD copies. Thus,the TaqMan assay is more sensitive than the previously de-scribed G6PD PCR-based method40 and also can generate anestimate of parasite load that could be useful for monitor-

ing or assessing the course of disease and response to treat-ment.

DISCUSSION

Identification of species of Leishmania using classic meth-ods, such as zymodemes10,47 or monoclonal antibodies,48 gen-erally requires isolation of the parasite. The only exception tothis is in the case of sand fly infections, where parasites havebeen successfully identified49 in smears made directly fromthe fly. Isolation procedures are especially difficult underfield conditions or in laboratories in disease-endemic areaswhere technical resources are poor. Cultures are liable to becontaminated and some strains grow poorly in axenic me-

dium.50

During the past two decades, methods based on DNAtechnology have been developed that enable parasite identi-fication in DNA extracted from host tissues, thus eliminatingthe necessity of isolation. Distinct loci of kinetoplast (mito-chondrion genome) and nuclear DNA have been used as tar-gets for their identification. Among these loci are kDNA,rDNA, mini-exon, -tubulin, gp63, randomly amplified poly-morphic DNA fragments, repetitive sequences, microsatel-lites, and subtelomeric sequences.51–54 Methods with theseloci were initially restricted to the use of kDNA hybridization

FIGURE 4. Number of mammalian glyceraldehys-3-phosphate dehydrogenase (GAPD) copies per nanogram of total human DNA from threesubjects (A) and ratio of Leishmania per number of mammalian GAPDH copies in human biopsy samples of patients from Rondônia (B). In thelatter, the number of parasites normalized by the mammalian GAPD copies was obtained through the VT and M assay, respectively. Each samplewas quantified in triplicate for both assays in different concentrations of template DNA (5, 1, and 0.2 ng, but some samples had to be diluted to40 and 8 pg). Samples positive for g6pd-FAM-bra are shown in the hatched bars and samples positive for g6pd-VIC-nbra are shown in the filledbars. The negative sample for Leishmania using the G6PD–polymerase chain reaction test40 gave a positive result in the VT TaqMan assay(indicated by an asterisk), this sample and the ones indicated by ** had the parasite burden estimated from just one dilution. Error bars indicatethe standard deviation.




probes.55–57 After development of PCR41 assays, they weredeveloped using kDNA58–60 and rDNA39,61–63 as targets. ThePCR methods have been shown to have high levels of sensi-tivity but their specificity varies according to the target se-quence.64,65 The ability to distinguish among members of theL. (Viannia) subgenus has been elusive.

We describe a real-time PCR assay that focuses on identi-fication and quantification of different L. (Viannia) species.On the basis of G6PD sequences, we designed two pairs of primers that can be used in SYBR-Green assays to specifi-cally identify parasites in the Americas belonging to either thesubgenera L. (Viannia) or L. (Leishmania). The specificity of the assays was tested with human and mouse DNA and with

DNA of organisms that are phylogenetically close to Leish-mania, such as T. cruzi (sympatric in many areas) and Leish-

mania (S.) adleri (not pathogenic to humans and belongs tothe same genus but a different subgenera).

The real-time PCR showed that L. (V.) peruviania was rec-ognized by the G6PD-FAM-bra probe. This result is not sur-prising because both species are phylogenetically similar andonly a few differences have been reported between L. (V.)

peruviania and L. (V.) braziliensis. However, because thegeographic distribution of L. (V.) peruviania is restricted, thisshould not represent a serious problem overall in terms of parasite identification. The TaqMan assay probes G6PD-

FAM-bra and G6PD-VIC-nbra were designed using our pre-viously described nucleotide differences.40 These probes re-

tained their specificities within the real-time PCR assay, andthis is more sensitive than the former assay, detecting evenone parasite in a reaction.

The presently reported assays have several advantages overother PCR-based assays. The time needed to analyze a givensample is shorter because there is no need to electrophoret-ically separate the products. Apart from this, the assay detectsthe amplicon, in a closed vial, thus minimizing the risk of laboratory contamination with the amplified products. There-fore, there is little training and overall technical expertiserequired to perform the assay and interpret the results. Themethodology is thus more suitable for routine diagnosticlaboratories because the risk of false-positive results is mini-

mized. Furthermore, these systems are constantly being im-proved and have been coupled to robotic DNA extraction66,67

that would make analysis easier.The present work and that of others that target DNA pol25

or GPI26 have single copy genes as targets. This allows forquantification because two copies of the target will corre-spond to one parasite. When kDNA is the target sequence,28

the assay detected a difference in the threshold cycle for thesame number of parasites of different species, a result consis-tent with the known variation in the number of copies of specific kDNA sequences per cell in different species.33

Although any amplification assay based on a single-copytarget is less sensitive than the one based on multi-copy tar-

gets, the method presented in this report was effective foridentification and quantification of parasites in human biopsysamples. The assay identified and estimated as few as 10 para-sites in 0.2 ng of total DNA from a human biopsy sample.Although there was no obvious relationship between estima-tion of parasite numbers and the specific Leishmania speciesfound in tissues from human lesions, the number of L. (V.)braziliensis parasites varied significantly. This observationdoes not support the general accepted idea that this species isalways present in small numbers in lesions. Further studiesusing a larger number of samples will provide important in-formation on the relationship between clinical symptoms andparasite load. The test will also be useful in analyzing re-sponses to treatment68,69 and was done recently for cases of

visceral leishmaniasis.32,33 However, for cutaneous and mu-cocutaneous diseases, other clinical samples would be needed(peripheral blood mononuclear cells or lesion aspirates). Inaddition, the assay can be used to guide therapeutic progno-sis. This aspect is important because different L. (Viannia)species show different responses to treatments (miltefosineversus pentavalent antimonials).70–73 Quantification andidentification of parasites in immunologic studies will help inunderstanding the mosaic of clinical manifestations.

The ability to identify L. (V.) braziliensis in material col-lected in disease-endemic areas using simple methods of pres-ervation is important for both clinical and epidemiologic stud-ies. The new assay described in this report can detect, quan-

TABLE 3

Clinical data of patients whose biopsy specimens were included in the first trial with the glucose-6-phosphate dehydrogenase (G6PD)–basedreal-time polymerase chain reaction assay

Patient Leishmania infecting species*

Lesions

Previous Leishmania infection§ MN¶ Direct microscopy# Anatomic pathology**Days† No.‡

MN89 Non-braz. 30 2 Yes ND ND ATLMN76 Non-braz. 30 2 No – ND ATL

MN75 Non-braz. 30 5 No – ND ATLMN95 Non-braz. 60 2 Yes ND + ATLMN29 Non-braz. 60 1 No + ND ATLMN21 Non-braz. 120 4 No – ND ATLMN34 Non-braz. 180 1 No – ND ATLMN20 braz. 20 1 Yes ND ND ATLMN17 braz. 40 1 No + – ATLMN16 braz. 40 1 No + – ATLMN32 braz. 60 1 No + ND ATLMN86 braz. 90 2 NK – ND –

* As identified by the reactivity with G6PD-VIC-nbra or G6PD-FAM-bra probes in the L. (Viannia) TaqMan assay. braz. braziliensis.† Days of lesion progression as reported by the patient.‡ Number of lesions at the time of the visit to the doctor.§ NK not known.¶ Montenegro skin test result.# ND not determined.** ATL American tegumentary leishmaniasis.




tify, and distinguish parasites of the subgenera L. (Viannia)and L. (V.) braziliensis that are the principal causes of cuta-neous and mucocutaneous leishmaniases in humans through-out the Americas. Besides its clinical applications, the test willhelp resolve many of the crucial questions related to reservoirhosts. For instance, determining the numbers of parasites inthe skin and blood of different hosts will help to assess their

relative importance as reservoirs. Also, determining levels of infection in naturally infected sand flies might shed light onthe importance of different species in transmission. Similarly,studying seasonal variations in the availability of Leishmania

in hosts from different habits74 throughout the year will pro-vide important insights into the epidemiology and feasibilityof control measures.

Received June 21, 2007. Accepted for publication October 17, 2007.

Acknowledgments: We thank Professor L. Alexander for use of theABI PRISM 7000 Sequence Detection System, Professor A. M.Castrucci and M. A. Visconti for use of the iCycler iQ Real-TimePCR Detection System, Professor R. Bucala for providing humanDNA from healthy donors, and Ricardo A. Zampieri and Karen J.Goldsmith-Pestana for technical assistance.

Financial support: This work was supported by Coordenação deAperfeiçoamento de Pessoal de Ní vel Superior, Conselho Nacionalde Desenvolvimento Cientifico e Tecnológico, Fundaçao de Amparoà Pesquisa do Estado de São Paulo, and National Institutes of Healthgrants AI-27811 and U19 AI065866.

Authors’ addresses: Tiago M. Castilho and Diane McMahon-Pratt,Department of Epidemiology and Public Health, Yale UniversitySchool of Medicine, New Haven, CT 06510-8034, E-mail :[email protected]. Luí s Marcelo Aranha Camargo and JeffreyJon Shaw, Departamento de Parasitologia, Instituto de CiênciasBiomédicas, Universidade de São Paulo, Av.Professor Lineu Prestes1374, 005508-000 São P a u l o , São Pa ulo, B ra zi l , E - ma i ls :[email protected] and [email protected]. Lucile M. Floeter-Winter, Departamento de Fisiologia, Instituto de Biociências, Uni-versidade de São Paulo; Rua do Matão, Travessa 14, no. 101, CidadeUniversitária, São Paulo, São Paulo, Brazil, CEP 05508-900. Tele-phone and Fax: 55-11-3091-7503, E-mail: [email protected].

REFERENCES

1. Ross R, 1903. Further notes on Leishman’s bodies. BMJ 2: 1401.2. Ross R, 1903. Note on the bodies recently described by Leishman

and Donovan. BMJ 2: 1261.3. Lainson R, Shaw JJ, 1987. Evolution, classification and geo-

graphical distribution. Peters W, Killick-Kendrick R, eds. TheLeishmaniases in Biology and Medicine. London: AcademicPress Inc., 1–120.

4. World Health Organization, 1990. Control of the leishmaniasis.World Health Organ Tech Rep Ser 793: 1–158.

5. Cupolillo E, Medina-Acosta E, Noyes H, Momen H, Grimaldi GJr, 2000. A revised classification for Leishmania and Endotry- panum. Parasitol Today 16: 142–144.

6. Lainson R, Shaw JJ, 1998. New World leishmaniasis: the neotrop-ical Leishmania species. Cox FE, Kreier JP, Wakelin D, eds.Topley and Wilson’ s Microbiology and Microbial Infections.London: Auckland: Arnold, 241–266.

7. Ashford RW, 2000. The leishmaniases as emerging and reemerg-ing zoonoses. Int J Parasitol 30: 1269–1281.

8. WHO, 2000. The leishmaniases and Leishmania/HIV co-infections. Fact sheet no. 116. Available from http://wwwwhoint/mediacentre/factsheets/fs116/en/>.

9. Thomaz-Soccol V, Lanotte G, Rioux JA, Pratlong F, Martini-Dumas A, Serres E, 1993. Monophyletic origin of the genusLeishmania Ross, 1903. Ann Parasitol Hum Comp 68: 107–108.

10. Cupolillo E, Grimaldi G Jr, Momen H, 1994. A general classifi-cation of New World Leishmania using numerical zymotax-onomy. Am J Trop Med Hyg 50: 296–311.

11. Lainson R, Shaw JJ, 1978. Epidemiology and ecology of leishma-niasis in Latin-America. Nature 273: 595–600.

12. Poulter LW, 1979. The quantification of viable Leishmania enri-ettii from infected guinea-pig tissues. Clin Exp Immunol 36:24–29.

13. Lima HC, Bleyenberg JA, Titus RG, 1997. A simple method forquantifying Leishmania in tissues of infected animals. Parasitol Today 13: 80–82.

14. Titus RG, Marchand M, Boon T, Louis JA, 1985. A limiting

dilution assay for quantifying Leishmania major in tissues of infected mice. Parasite Immunol 7: 545–555.

15. Hill JO, 1983. Quantitation of Leishmania tropica major by itsability to form distinct colonies on agar-based media. J Para- sitol 69: 1068–1071.

16. Nicolas L, Sidjanski S, Colle JH, Milon G, 2000. Leishmania major reaches distant cutaneous sites where it persists transientlywhile persisting durably in the primary dermal site and itsdraining lymph node: a study with laboratory mice. Infect Im-mun 68: 6561–6566.

17. Roberts LJ, Foote SJ, Handman E, 2000. A new standard for theassessment of disease progression in murine cutaneous leish-maniasis. Parasite Immunol 22: 231–237.

18. Higuchi R, Dollinger G, Walsh PS, Griffith R, 1992. Simulta-neous amplification and detection of specific DNA sequences.Biotechnology (N Y) 10: 413–417.

19. Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP, 1997.

Continuous fluorescence monitoring of rapid cycle DNA am-plification. Biotechniques 22: 130–131, 134–138.

20. Gibson UE, Heid CA, Williams PM, 1996. A novel method forreal time quantitative RT-PCR. Genome Res 6: 995–1001.

21. Heid CA, Stevens J, Livak KJ, Williams PM, 1996. Real timequantitative PCR. Genome Res 6: 986–994.

22. Vet JA, Majithia AR, Marras SA, Tyagi S, Dube S, Poiesz BJ,Kramer FR, 1999. Multiplex detection of four pathogenic ret-roviruses using molecular beacons. Proc Natl Acad Sci U S A96: 6394–6399.

23. Costa JM, Pautas C, Ernault P, Foulet F, Cordonnier C, BretagneS, 2000. Real-time PCR for diagnosis and follow-up of Toxo- plasma reactivation after allogeneic stem cell transplantationusing fluorescence resonance energy transfer hybridizationprobes. J Clin Microbiol 38: 2929–2932.

24. Reithinger R, Dujardin JC, 2007. Molecular diagnosis of leish-maniasis: current status and future applications. J Clin Micro-

biol 45: 21–25.25. Bretagne S, Durand R, Olivi M, Garin JF, Sulahian A, Rivollet

D, Vidaud M, Deniau M, 2001. Real-time PCR as a new toolfor quantifying Leishmania infantum in liver in infected mice.Clin Diagn Lab Immunol 8: 828–831.

26. Wortmann G, Hochberg L, Houng HH, Sweeney C, Zapor M,Aronson N, Weina P, Ockenhouse CF, 2005. Rapid identifica-tion of Leishmania complexes by a real-time PCR assay. Am J Trop Med Hyg 73: 999–1004.

27. Nicolas L, Milon G, Prina E, 2002. Rapid differentiation of OldWorld Leishmania species by LightCycler polymerase chainreaction and melting curve analysis. J Microbiol Methods 51:295–299.

28. Nicolas L, Prina E, Lang T, Milon G, 2002. Real-time PCR fordetection and quantitation of Leishmania in mouse tissues. J Clin Microbiol 40: 1666–1669.

29. Wortmann G, Sweeney C, Houng HS, Aronson N, Stiteler J,

Jackson J, Ockenhouse C, 2001. Rapid diagnosis of leishma-niasis by fluorogenic polymerase chain reaction. Am J TropMed Hyg 65: 583–587.

30. Schulz A, Mellenthin K, Schonian G, Fleischer B, Drosten C,2003. Detection, differentiation, and quantitation of patho-genic Leishmania organisms by a fluorescence resonance en-ergy transfer-based real-time PCR assay. J Clin Microbiol 41:1529–1535.

31. Foulet F, Botterel F, Buffet P, Morizot G, Rivollet D, Deniau M,Pratlong F, Costa JM, Bretagne S, 2007. Detection and iden-tification of Leishmania species from clinical specimens usingreal-time PCR assay and sequencing of the cytochrome b gene. J Clin Microbiol 45: 2110–2115.

32. Bossolasco S, Gaiera G, Olchini D, Gulletta M, Martello L,Bestetti A, Bossi L, Germagnoli L, Lazzarin A, Uberti-Foppa




C, Cinque P, 2003. Real-time PCR assay for clinical man-agement of human immunodeficiency virus-infected pa-tients with visceral leishmaniasis. J Clin Microbiol 41: 5080–5084.

33. Mary C, Faraut F, Lascombe L, Dumon H, 2004. Quantificationof Leishmania infantum DNA by a real-time PCR assay withhigh sensitivity. J Clin Microbiol 42: 5249–5255.

34. Svobodová M, Votypka J, Nicolas L, Volf P, 2003. Leishmaniatropica in the black rat (Rattus rattus): persistence and trans-

mission from asymptomatic host to sand fly vector Phleboto-mus sergenti. Microbes Infect 5: 361–364.

35. Rolão N, Cortes S, Rodrigues OR, Campino L, 2004. Quantifi-cation of Leishmania infantum parasites in tissue biopsies byreal-time polymerase chain reaction and polymerase chain re-action-enzyme-linked immunosorbent assay. J Parasitol 90:1150–1154.

36. Hendricks LD, Wood DE, Hajduk ME, 1978. Haemoflagellates:commercially available liquid media for rapid cultivation.Parasitology 76: 309–316.

37. Camargo EP, 1964. Growth and differentiation in Trypanosomacruzi. I. Origin of metacyclic trypanosomes in liquid media.Rev Inst Med Trop Sao Paulo 12: 93–100.

38. Soong L, Duboise SM, Kima P, McMahon-Pratt D, 1995. Leish-mania pifanoi amastigote antigens protect mice against cuta-neous leishmaniasis. Infect Immun 63: 3559–3566.

39. Uliana SR, Affonso MH, Camargo EP, Floeter-Winter LM, 1991.

Leishmania: genus identification based on a specific sequenceof the 18S ribosomal RNA sequence. Exp Parasitol 72: 157–163.

40. Castilho TM, Shaw JJ, Floeter-Winter LM, 2003. New PCR assayusing glucose-6-phosphate dehydrogenase for identification of Leishmania species. J Clin Microbiol 41: 540–546.

41. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA,Arnheim N, 1985. Enzymatic amplification of beta-globin ge-nomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230: 1350–1354.

42. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, MillerW, Lipman DJ, 1997. Gapped BLAST and PSI-BLAST: a newgeneration of protein database search programs. Nucleic AcidsRes 25: 3389–3402.

43. Hall TA, 1999. BioEdit: a user-friendly biological sequence align-ment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41: 95–98.

44. Thompson JD, Higgins DG, Gibson TJ, 1994. CLUSTAL W:improving the sensitivity of progressive multiple sequencealignment through sequence weighting, position-specific gappenalties and weight matrix choice. Nucleic Acids Res 22:4673–4680.

45. Cabot EL, Beckenbach AT, 1989. Simultaneous editing of mul-tiple nucleic acid and protein sequences with ESEE. Comput Appl Biosci 5: 233–234.

46. Carraro G, Albertin G, Forneris M, Nussdorfer GG, 2005. Simi-lar sequence-free amplification of human glyceraldehyde-3-phosphate dehydrogenase for real time RT-PCR applications.Mol Cell Probes 19: 181–186.

47. Cupolillo E, Grimaldi G Jr, Momen H, 1995. Discrimination of Leishmania isolates using a limited set of enzymatic loci. AnnTrop Med Parasitol 89: 17–23.

48. McMahon-Pratt D, David JR, 1981. Monoclonal antibodies thatdistinguish between New World species of Leishmania. Nature

291: 581–583.49. Shaw JJ, Ishikawa EA, Lainson R, 1989. A rapid and sensitive

method for the identification of Leishmania with monoclonalantibodies using fluorescein-labelled avidin. Trans R Soc TropMed Hyg 83: 783–784.

50. Bray RS, Munford F, 1967. On the maintenance of strains of Leishmania from the Guianas. J Trop Med Hyg 70: 23–24.

51. Schallig HD, Oskam L, 2002. Molecular biological applications inthe diagnosis and control of leishmaniasis and parasite identi-fication. Trop Med Int Health 7: 641–651.

52. Barker DC, 1987. DNA diagnosis of human leishmaniasis. Para- sitol Today 3: 177–184.

53. de Oliveira CI, Bafica A, Oliveira F, Favali CB, Correa T, FreitasLA, Nascimento E, Costa JM, Barral A, 2003. Clinical utility of polymerase chain reaction-based detection of Leishmania in

the diagnosis of American cutaneous leishmaniasis. Clin Infect Dis 37: e149–e153.

54. Floeter-Winter LM, Shaw JJ, 2004. New horizons in the identifi-cation and taxonomy of the Leishmania and the diagnoses of the leishmaniasis: the expansion of molecular techniques. Res Adv in Microbiology 4: 63–79.

55. Wirth DF, McMahon-Pratt D, 1982. Rapid identification of Leishmania species by specific hybridization of kinetoplastDNA in cutaneous lesions. Proc Natl Acad Sci U S A 79:

6999–7003.56. Barker DC, Butcher J, 1983. The use of DNA probes in the

identification of leishmanias: discrimination between isolatesof the Leishmania mexicana and L. braziliensis complexes.Trans R Soc Trop Med Hyg 77: 285–297.

57. Rogers WO, Wirth DF, 1987. Kinetoplast DNA minicircles: re-gions of extensive sequence divergence. Proc Natl Acad Sci U S A 84: 565–569.

58. Lopez M, Inga R, Cangalaya M, Echevarria J, Llanos-Cuentas A,Orrego C, Arevalo J, 1993. Diagnosis of Leishmania using thepolymerase chain reaction: a simplified procedure for fieldwork. Am J Trop Med Hyg 49: 348–356.

59. de Bruijn MH, Barker DC, 1992. Diagnosis of New World leish-maniasis: specific detection of species of the Leishmania bra-ziliensis complex by amplification of kinetoplast DNA. ActaTrop 52: 45–58.

60. Rodgers MR, Popper SJ, Wirth DF, 1990. Amplification of kine-

toplast DNA as a tool in the detection and diagnosis of Leish-mania. Exp Parasitol 71: 267–275.

61. Uliana SR, Nelson K, Beverley SM, Camargo EP, Floeter-WinterLM, 1994. Discrimination amongst Leishmania by polymerasechain reaction and hybridization with small subunit ribosomalDNA derived oligonucleotides. J Eukaryot Microbiol 41: 324–330.

62. van Eys GJ, Schoone GJ, Kroon NC, Ebeling SB, 1992. Sequenceanalysis of small subunit ribosomal RNA genes and its use fordetection and identification of Leishmania parasites. Mol Bio-chem Parasitol 51: 133–142.

63. Guevara P, Alonso G, da Silveira JF, de Mello M, Scorza JV,Anez N, Ramirez JL, 1992. Identification of new world Leish-mania using ribosomal gene spacer probes. Mol Biochem Para- sitol 56: 15–26.

64. Aviles H, Belli A, Armijos R, Monroy FP, Harris E, 1999. PCRdetection and identification of Leishmania parasites in clinical

specimens in Ecuador: a comparison with classical diagnosticmethods. J Parasitol 85: 181–187.

65. Weigle KA, Labrada LA, Lozano C, Santrich C, Barker DC,2002. PCR-based diagnosis of acute and chronic cutaneousleishmaniasis caused by Leishmania (Viannia). J Clin Micro-biol 40: 601–606.

66. Smit ML, Giesendorf BA, Heil SG, Vet JA, Trijbels FJ, BlomHJ, 2000. Automated extraction and amplification of DNAfrom whole blood using a robotic workstation and anintegrated thermocycler. Biotechnol Appl Biochem 32: 121–125.

67. Smit ML, Giesendorf BA, Vet JA, Trijbels FJ, Blom HJ, 2001.Semiautomated DNA mutation analysis using a robotic work-station and molecular beacons. Clin Chem 47: 739–744.

68. Amato VS, Rabello A, Rotondo-Silva A, Kono A, MaldonadoTP, Alves IC, Floeter-Winter LM, Neto VA, Shikanai-YasudaMA, 2004. Successful treatment of cutaneous leishmaniasis

with lipid formulations of amphotericin B in two immunocom-promised patients. Acta Trop 92: 127–132.

69. Blum J, Desjeux P, Schwartz E, Beck B, Hatz C, 2004. Treatmentof cutaneous leishmaniasis among travellers. J AntimicrobChemother 53: 158–166.

70. Navin TR, Arana BA, Arana FE, Berman JD, Chajon JF,1992. Placebo-controlled clinical trial of sodium stibogluco-nate (Pentostam) versus ketoconazole for treating cuta-neous leishmaniasis in Guatemala. J Infect Dis 165: 528–534.

71. Romero GA, Guerra MV, Paes MG, Macedo VO, 2001. Com-parison of cutaneous leishmaniasis due to Leishmania (Vian-nia) braziliensis and L. (V.) guyanensis in Brazil: therapeuticresponse to meglumine antimoniate. Am J Trop Med Hyg 65:456–465.




72. Soto J, Arana BA, Toledo J, Rizzo N, Vega JC, Diaz A, Luz M,Gutierrez P, Arboleda M, Berman JD, Junge K, Engel J, Sin-dermann H, 2004. Miltefosine for new world cutaneous leish-maniasis. Clin Infect Dis 38: 1266–1272.

73. Arevalo J, Ramirez L, Adaui V, Zimic M, Tulliano G, Miranda-Verastegui C, Lazo M, Loayza-Muro R, Doncker SD, MaurerA, Chappuis F, Dujardin JC, Llanos-Cuentas AA, 2007. Influ-ence of Leishmania (viannia) species on the response to anti-

monial treatment in patients with American tegumentaryleishmaniasis. J Infect Dis 195: 1846–1851.

74. Brandão-Filho SP, Brito ME, Carvalho FG, Ishikawa EA,Cupolillo E, Floeter-Winter L, Shaw JJ, 2003. Wild andsynanthropic hosts of Leishmania (Viannia) braziliensis inthe endemic cutaneous leishmaniasis locality of Amaraji, Per-nambuco State, Brazil. Trans R Soc Trop Med Hyg 97: 291–296.


Documents

2Castilho Et Al