ApoptomiRs expression modulated by BCR–ABL is linked to CML progression and imatinib resistance

Blood Cells, Molecules and Diseases xxx (2014) xxx–xxx

YBCMD-01803; No. of pages: 9; 4C:

Contents lists available at ScienceDirect

Blood Cells, Molecules and Diseases

j ourna l homepage: www.e lsev ie r .com/ locate /bcmd

ApoptomiRs expression modulated by BCR–ABL is linked to CMLprogression and imatinib resistance

A.F. Ferreira a,⁎, L.G. Moura a, I. Tojal b, L. Ambrósio a, B. Pinto-Simões c, N. Hamerschlak d, G.A. Calin e, C. Ivan f,D.T. Covas b,c, S. Kashima b, F.A. Castro a

a Departamento de Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências Farmacêuticas de Ribeirão Preto, Universidade de São Paulo, Brazilb Centro Regional de Hemoterapia de Ribeirão Preto, Brazilc Departamento de Clínica Médica, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Brazild Hospital Israelita Albert Einstein, São Paulo, Brazile Department of Experimental Therapeutics, The University of Texas MD Anderson Cancer Center, Houston, TX, USAf Center for RNA Interference and Non-Coding RNAs, The University of Texas MD Anderson Cancer Center, Houston, TX, USA

⁎ Corresponding author.E-mail address: [email protected] (A.F. Ferr

http://dx.doi.org/10.1016/j.bcmd.2014.02.0081079-9796/© 2014 Elsevier Inc. All rights reserved.

Please cite this article as: A.F. Ferreira, et al.,

a b s t r a c t
a r t i c l e i n f o
Article history:
Submitted 16 October 2013Available online xxxx
(Communicated by J. Rowley, M.D., 04 February 2014)

Keywords:MicroRNAChronic myeloid leukemiaApoptosisImatinib response

Background: Chronic myeloid leukemia (CML) is a myeloproliferative disease characterized by the presence ofPhiladelphia chromosome (Ph) leading to expression of a BCR–ABL1 fusion oncogene. The BCR–ABL proteinhas a constitutive tyrosine kinase activity which is responsible for CML pathogenesis by promoting cell apoptosisresistance; however, the cellular andmolecular mechanisms associated with BCR–ABL expression and apoptosisimpairment in CML leukemic cells have not been fully elucidated.Methods: This study evaluated apoptomiRs and their predicted apoptotic genes in BCR–ABL+ cells from patientsin different phases of CML treated with tyrosine kinase inhibitor (TKI) according to their imatinib (IM) responseby qPCR. Phosphotyrosine and c-ABL expressions in HL-60.BCR–ABL cells treatedwith TKI were done byWesternblot.Results: We found that dasatinib (DAS) modulated miR-let-7d, miR-let-7e, miR-15a, miR-16, miR-21, miR-130a
andmiR-142-3p expressionswhile IMmodulatedmiR-15a andmiR-130a levels. miR-16,miR-130a andmiR-145expressionsweremodulated by nilotinib (NIL).Weobserved highermiR-15a,miR-130b andmiR-145; and lowermiR-16, miR-26a and miR-146a expressions in CML-CP in comparison with controls. CML-AP patients showedlow miR-let-7d, miR-15a, miR-16, miR-29c, miR-142-3p, miR-145, and miR-146a levels in comparison withCML-CP. We noted that the miR-26a, miR-29c, miR-130b and miR-146a expressions were downregulated inIM resistant patients in comparison with IM responsive patients.Conclusions: This study showed the modulation of apoptomiRs by BCR–ABL kinase activity and the deregulationof apoptomiRs and their predicted apoptotic target genes in different CML phases and after treatment with TKinhibitors. ApoptomiRs may be involved in the BCR–ABL+ cell apoptosis regulation.
© 2014 Elsevier Inc. All rights reserved.

Introduction

Chronic myeloid leukemia (CML) is a myeloproliferative diseasecharacterized by the presence of Philadelphia chromosome (Ph) leadingto expression of a BCR–ABL1 fusion oncogene. The BCR–ABL fusionprotein has a constitutive tyrosine kinase activity [1,2] which is res-ponsible for CML pathogenesis by promoting cell apoptosis resistance,intense granulocytic proliferation, and lack of adhesion to the bonemarrow [2]. It has been described that the resistance to apoptosis inBCR–ABL+ cells is linked to BCL-XL and MCL-1 overexpressions but not

eira).

Blood Cells Mol. Diseases (20

to BCL-2 levels [3–5]. CML leukemic cells present high levels of BCL-XLand an increase of BCL-2 levels is observed only at disease progression[3,4]. The cellular and molecular mechanisms associated with BCR–ABL expression and apoptosis impairment in CML leukemic cells havenot been fully elucidated.

The CML current treatments are hydroxyurea, bone marrowtransplantation or tyrosine kinase inhibitors (TKIs) [6]. The TKIs arehighly effective in CML treatment, however, they do lead to cure ofCML patients and cases of TK inhibitor resistance have already beendescribed [7]. Thus, to efficiently treat the patients and destroy leukemicstem cells the identification of new genes and pathways that playcritical roles in survival and self renewal of CML leukemic stem cells isrequired [7]. In this context, microRNAs may be an interesting newtherapeutic target in CML.

14), http://dx.doi.org/10.1016/j.bcmd.2014.02.008

http://dx.doi.org/10.1016/j.bcmd.2014.02.008

mailto:[email protected]


http://www.sciencedirect.com/science/journal/10799796


Table 1CML patient demographic features, disease phase and IM response.

Sample Gender Age CML phase IM response

1 F 77 AP R2 F 59 BC R3 F 40 CP CCR4 F 42 CP CCR5 F 30 CP CCR6 M 45 CP CCR7 M 45 CP CCR8 M 65 CP CCR9 F 25 CP CCR10 M 54 CP CCR11 M 68 AP R12 M 35 CP R13 F 30 BC R14 M 57 CP CCR15 M 44 AP R16 M 30 BC R17 M 51 CP CCR18 F 54 CP CCR19 F 30 CP R20 F 31 CP CCR21 F 77 CP R22 F 36 BC R23 M 59 CP R24 M 57 CP R25 M 63 AP R26 M 65 CP R27 F 66 CP R28 M 68 CP R29 F 52 CP R30 M 52 CP R31 F 34 CP R32 M 53 BC R33 M 45 CP R34 M 27 CP CCR35 M 48 CP R36 F 39 CP CCR37 F 33 CP CCR38 F 64 AP R39 M 26 AP R40 F 18 CP CCR41 F 21 CP R42 M 48 CP CCR43 M 26 BC R44 M 48 CP CCR45 F 57 CP CCR46 F 35 CP CCR47 M 45 CP CCR48 F 56 AP R49 M 29 BC R50 F 27 CP CCR51 F 58 AP CCR52 M 55 AP R53 M 52 CP CCR54 M 53 CP CCR55 M 23 CP CCR56 F 53 CP R57 M 38 CP CCR58 M 50 CP CCR59 M 21 CP CCR60 F 32 CP R61 F 50 AP R62 M 35 BC R63 M 50 CP R64 M 36 CP CCR65 F 31 CP R66 M 31 BC R67 M 57 CP CCR68 M 28 AP R69 M 36 AP R70 M 48 AP CCR71 M 52 BC R72 M 39 BC R73 F 30 BC R

Table 1 (continued)

Sample Gender Age CML phase IM response

74 F 39 BC R75 M 65 BC R

CP: chronic phase; AP: accelerated phase; BC: blastic crisis; CCR: complete cytogeneticresponse; R: IM resistant; F: female; M: male; IM: imatinib mesylate.

2 A.F. Ferreira et al. / Blood Cells, Molecules and Diseases xxx (2014) xxx–xxx

Please cite this article as: A.F. Ferreira, et al., Blood Cells Mol. Diseases (20

MicroRNAs (miRNAs) are a class of endogenous, small, noncodingRNAs that regulate gene expression. These molecules display aberrantexpression patterns and functional abnormalities in cancer [8]. ThemiRNA altered expression has been described in many hematopoieticmalignancies [9,10] such as chronic lymphoid leukemia (CLL), acutemyeloid leukemia (AML) and myeloproliferative neoplasm (MPN).miRNA-15a and miR-16-1 are downregulated in 70% of the CLLpatients and their overexpressions induce cell death by targeting BCL2[9]. miR-128b, miR-204, miR-218, miR-331 and miR-181b-1 are highlyexpressed in acute lymphoid leukemia (ALL) samples [10]. Acutemyeloidleukemia (AML) patients also present differential miRNA expression.AMLwith t(15;17) shows high levels ofmiR-382 andmiR-125-bwhereasmiR-196a and let-7c are downregulated [11]. Polycythemia verapatients present high levels ofmiR-575 andmiR-887 anddownregulationof miR-196b and miR-551b. In CLL the upregulation of c-FLIPwas associ-ated with miR-96, miR-183 and miR-20 low levels. The authors suggestthat miRNAmodulates c-FLIP expression interfering in leukemic lympho-cyte apoptosis and cell proliferation in CLL patients [12].

The present study evaluated the apoptomiRs, whose targets areapoptosis-regulated genes, expression in CML patients. We also ana-lyzed the relation between the apoptosis impairment and response toimatinib mesylate with apoptomiRs expression.

Subjects and material

Patients and controls

CML patients were diagnosed by Ph chromosome and BCR–ABL1detection. The research was approved by the Ethical Committee of theClinical Hospital of Ribeirão Preto (process number: 6421/2008).

Peripheral blood samples were obtained from 75 CML patients.Thirty-one patients were male and forty-four were female with amedi-an age 45 years old, range 18 to 77 years. Forty-eight were in chronicphase and twenty-seven in advanced phases (thirteen in acceleratedphase and fourteen in blast crisis). Thirty-two patients achievedcomplete cytogenetic remission (CCR) and forty-three showed resis-tance to IM (Table 1). The control group was composed of 58 blooddonors from the Regional Blood Center of Ribeirão Preto. Thirty-onewere female and twenty-seven were male with being the median age41 years old, range 17 to 77 years.

Results

MicroRNA expression in HL-60.BCR–ABL treated with tyrosine kinaseinhibitors

The results showed that let-7d expression decreased after 4 and 8 hof treatment with dasatinib (DAS) (0.26 and 0.01 fold, respectively)(Fig. 1A). An increase of let-7e expression was seen when cells weretreated with DAS (2.74 fold) and NIL (2.89 fold) (Fig. 1B). Eight hoursafter imatinib (IM) treatment miR-15a expression increased 3.13 foldand 4 h after DAS treatment its expression was 4.18 fold higher. miR-15a showed an increase in its expression when cells were treated withnilotinib (NIL) after 4 h (3.97 fold) and 8 h (2.91 fold) (Fig. 1C). DASand NIL seem to have changed miR-16 levels after 4 h of treatment(2.72 and 2.5 fold, respectively) (Fig. 1D). miR-21 expression increasedafter 8 h of DAS administration (11.7 fold) (Fig. 1E).miR-130amay havebeen modulated by IM, DAS and NIL (Figs. 1F and G). miR-130a



Fig. 1.miRNA expression in HL-60.BCR–ABL treated with TKI. (A) miR-let-7d levels in BCR–ABL+ cells after IM, DAS and NIL treatments. (B) miR-let-7e levels in BCR–ABL+ cells after IM,DAS andNIL treatments. (C)miR-15a levels in BCR–ABL+ cells after IM, DAS andNIL treatments. (D)miR-16 levels in BCR–ABL+ cells after IM, DAS andNIL treatments. (E)miR-21 levels inBCR–ABL+ cells after IM, DAS and NIL treatments. (F) miR-26a levels in BCR–ABL+ cells after IM, DAS and NIL treatments. (G) miR-30e levels in BCR–ABL+ cells after IM, DAS and NILtreatments. (H) miR-130a levels in BCR–ABL+ cells after IM, DAS and NIL treatments. (I) miR-142-3p levels in BCR–ABL+ cells after IM, DAS and NIL treatments. (J) miR-145 levels inBCR–ABL+ cells after IM, DAS and NIL treatments. TKI: tyrosine kinase inhibitors, IM: imatinib mesylate, DAS: dasatinib, NIL: nilotinib.

3A.F. Ferreira et al. / Blood Cells, Molecules and Diseases xxx (2014) xxx–xxx

expression increased seven fold IM administration. DAS and NIL alsomodulated miR-130a expression as 6.93 and 2.69 fold higher than con-trol cells, respectively (Fig. 1H). miR-142-3p levels increased after DAStreatment (7.12 fold) (Fig. 1I). NIL modulated the miR-145 expressionafter 4 h (11.97 fold) (Fig. 1J).

Phosphotyrosine and c-ABL expressions in HL-60.BCR–ABL cells treatedwith TKI

BCR–ABL phosphorylation reduced activity was observed in BCR–ABL+ cells after IM, DAS and NIL treatments. It seems that DAS


presented a more potent effect in inhibiting HL-60.BCR–ABL phospho-tyrosine in comparison to IM and NIL (lanes 5 and 6) (Figs. 2A and B).

MicroRNA expression in CML patients and controls

miR-15a, miR-130b and miR-145 expression levels were higher inCML patients at CP (median = 2238; 1588 and 5101, respectively) ascompared to control group (1397; 993.4 and 578.6, respectively)(Figs. 3B, F and H). The analyses of miRNA expression between CMLpatients at CP and AP showed lower expression of let-7d (m = 506),miR-15a (m = 1069), miR-16 (m = 26759), miR29c (m = 2864),



Fig. 1 (continued.)


miR-142-3p (m= 73703), miR0145 (m= 241.4) andmiR-146a (m=5611) in advanced phases than in chronic phase (m = 1791; 2238;43169; 6261; 234323; 5101; 16536, respectively) (Figs. 3A to D, Gto I). Control group presented higher levels of let-7d (m = 2229),miR-16 (m = 87285), miR-142-3p (m = 174074), miR-145 (m =578.6) and miR-146a (23609) as compared to the expression levelsin AP patient cells (m = 506; 26759, 73703, 241.4, 5611, respective-ly) (Figs. 3A, C, G to I). CML patients at CP presented higher levelsof let-7d, miR-15a, miR-16, miR-29c, miR-142-3p, miR-145 andmiR-146a than those patients who were included in AP group.


Apoptotic target-gene expression in CML

High levels of A1 (m = 71.89), BCL-2 (m = 2.78), c-FLIP (m = 55.24), c-IAP-1 (m = 10.79) and c-IAP-2 (m = 118.4) transcripts wereobserved in CML patients at CP in comparison to control group (m =20.50; 1.05; 9.28; 3.44 and 23.30, respectively) (Figs. 4A to E). The anal-ysis of these anti-apoptotic gene expressions between CP and APshowed low levels of c-FLIP and c-IAP-2 transcripts in patients whowere in advanced phases (m = 4.76; and 32.98) whereas CP groupdisplayed elevated levels (m = 55.24 and 118.4) (Figs. 4C and E).



Fig. 2. The Western blot of phosphotyrosine and c-ABL in BCR–ABL+ cells.(A) Phosphotyrosine levels in HL-60.BCR–ABL without IM (lane 1) and after 4 and 8 h ofIM treatment (lanes 2 and 3). Phosphotyrosine levels in HL-60.BCR–ABL without DAS(lane 4) and after 4 and 8 h of DAS treatment (lanes 5 and 6). Phosphotyrosine levels inHL-60.BCR–ABL without NIL (lane 7) and after 4 and 8 h of NIL treatment (lanes 8 and9). (B) c-ABL levels in HL-60.BCR–ABL without IM (lane 1) and after 4 and 8 h of IMtreatment (lanes 2 and 3). c-ABL levels in HL-60.BCR–ABL without DAS (lane 4) andafter 4 and 8 h of DAS treatment (lanes 5 and 6). c-ABL levels in HL-60.BCR–ABL withoutNIL (lane 7) and after 4 and 8 h of NIL treatment (lanes 8 and 9). The tubulin expressionrepresents the endogenous control for the same samples. IM: imatinib mesylate, DAS:dasatinib, NIL: nilotinib.


MCL-1 expression was also different among the CML phases, itslevels were higher in AP (m = 1162) when compared to CP (m =60.11) (Fig. 4F). A1 (m = 92.91), c-IAP-1 (m = 36.76) and MCL-1(m = 1162) presented higher levels in AP as compared to controlgroup (m = 20.50; 3.44 and 525.5, respectively) (Fig. 4A, 4D and4F). Among the anti-apoptotic genes which presented different ex-pressions between control group and advanced phase group, onlyc-FLIP (m = 4.76) showed low levels of mRNA in the late phasewhereas its expression was higher in control group (m = 9.28)(Fig. 4C).

ApoptomiRs and target gene expressions according to imatinib response

To verify if apoptomiRs expression in CML patients is associatedto IM response, samples from patients who achieved completecytogenetic response (CCR) following IM treatment as well assamples from IM-resistant (R) patients. Low expression of miR-26a(median = 22483); miR-29c (m = 4105); miR-130b (1320) andmiR-146a (7671) was observed in CCR patients in comparison toIM-resistant patients (m =86939; 12226; 2535 and 17898, respec-tively) (Figs. 5A to D).

Regarding apoptomiRs and target gene expressions, we analyzedthe expression of A1, BCL-2, c-IAP-1, c-IAP-2 and MCL-1 genes.Among thesemolecules, just c-IAP-1 andMCL-1 levels were differen-tially expressed between CCR patients and IM-resistant patients. Pa-tients who presented IM resistance showed a high expression ofthese molecules (m = 53.55 and 1397, respectively) whereasthose who achieved CCR showed low levels of c-IAP-1 and MCL-1(m = 7.84 and 700.4, respectively) (Figs. 6A and B).


Discussion

Modulation of miRNAs by BCR–ABL

The apoptomiRs differentially expressed in HL-60.BCR–ABL (let-7d,let-7e, miR-15a, miR-16, miR-21, miR-26a, miR-30e, miR-130a, miR-142-3p and miR-145) were also quantified after treatment with IM,DAS and NIL at 8 and 4 h. Our hypothesis was that BCR–ABL kinaseactivity may regulate the miRNA expression in CML patients, since wedetected difference in miRNA levels in HL-60.BCR–ABL after TKI treat-ment. Guo and collaborators [14] also verified the modulation ofoncomiRs after Interleukin-2-inducible T-cell kinase (Itk) inhibitionwith CTA056 inmalignant T cells. They also observed that the inhibitionof kinase activity upregulates miRNAs which are involved in suppress-ing survival factors as BCL-XL and BCL-2 and downmodulates miRNAtarget genes involved in growth and metastasis [14]. Based on thesedata, we postulate that the kinase activity inhibition by IM may beresponsible for the alteration in miRNA levels seen in our results. Thedifference inmiRNA expression after TKI treatment could in part collab-orate for its ability to induce apoptosis in BCR–ABL+ cells.We noted thatmiR-let-7d levels did not present alterations after NIL treatment; miR-let-7e andmiR-21 expressionswere the same before and after IM treat-ment andmiR-145 levelswere not altered by DAS. These results suggestthat, at least in part, those molecules may be modulate by BCR-ABL ty-rosine kinase.

Rokah and collaborators [15] also investigated the miRNA ex-pression in BCR–ABL+ cell lines and observed that miR-31, miR-34a,miR-155 and miR-564 levels are overexpressed in control group andin HL-60 and downregulated in K562 and inMeg-01, indicating a higherlikelihood of miRNAs involved in CML pathogenesis. Suresh and collab-orators [16] evaluated themiR-130a andmiR-130b expressions in K562treated with IM and observed a decrease of both molecules. In contrast,our results showed highermiR-130a expression after IM and DAS treat-ments. This difference can be explained by the fact that we used HL-60.BCR–ABL and 10 μM of IM whereas they evaluated K562 and 1 μMof IM.

These data indicate that miRNA expression may be regulated by theBCR–ABL tyrosine kinase activity in BCR–ABL+ cells and that theirexpression also depends on cellular context.

miRNA and target gene expressions in CML patients in different phases

The overexpression of miR-15a, miR-130b and miR-145 in CMLon CP in comparison to control group and low expression of let-7d,miR-16, miR-142-3p, miR-145 and miR-146a in CML on AP when com-pared with controls were observed in our investigation. It has beenknown that miR-15a and miR-16 may regulate BCL-2 expression inCLL promoting apoptosis by targeting BCL-2 [17]. In our results, BCL-2was upregulated in CML-CP in comparison to controls, and we mayspeculate that, at least in CML, BCL-2 may not be regulated by miR-15abut could be regulated by miR-16 which had its expression downregu-lated in CML samples. ReducedmicroRNA let-7 expression is associatedwith worse prognosis in various cancers, as well as increased cancerstem cell production [18]. We suggest that the low level of let-7d inAPmay be linked to CML progression once we noted that one of its pre-dicted target gene BCL-2 levels was higher in CML in comparison withcontrols.

Mott and collaborators also described themiR-29 family and its pre-dicted target geneMCL-1 and observed a downregulation of miR-29b incholangiocarcinoma cell lines which were consistent with MCL-1 pro-tein upregulation [19]. In our data, MCL-1 expression was increased inCML advanced phases whereas miR-29c was downregulated. Thus, wesuggest that miR-29 may regulate MCL-1 expression in BCR–ABL cellsin CML patients. miR-29b was described to target MCL-1 and sensitizecells to apoptosis associated with TNF (tumor necrosis factor) andmight initiate cell death through a mitochondrial pathway [20].



Fig. 3.miRNA expression in CML different phases and controls. (A)miR-let-7d expression in healthy individuals and in CML patients in chronic and advanced phases. (B)miR-15a expres-sion inhealthy individuals and inCMLpatients in chronic and advancedphases. (C)miR-16 expression inhealthy individuals and inCMLpatients in chronic and advancedphases. (D)miR-26a expression in healthy individuals and in CML patients in chronic and advanced phases. (E) miR-29c expression in healthy individuals and in CML patients in chronic and advancedphases. (F) miR-130b expression in healthy individuals and in CML patients in chronic and advanced phases. (G) miR-142-3p expression in healthy individuals and in CML patients inchronic and advanced phases. (H) miR-145 expression in healthy individuals and in CML patients in chronic and advanced phases. (I) miR-146a expression in healthy individuals andin CML patients in chronic and advanced phases. C: controls; CP: chronic phase; AP: advanced phases.


Spinello and collaborators [21] also showed low levels of miR-146ain M1/M2 AML patients. They suggest that the low expression of miR-146a may decrease sensitivity of leukemic blast cells to apoptosis

Fig. 4.Apoptotic predicted target genes in CML different phases and controls. (A) A1 expressioncontrol group and CML patients in chronic and advanced phases. (C) c-FLIP expression in controgroup and CML patients in chronic and advanced phases. (E) c-IAP-2 expression in control grouand CML patients in chronic and advanced phases. C: controls; CP: chronic phase; AP: advance


induced by cytotoxic drugs [21]. In CML, NF-κB activation by BCR-ABLmediates proliferation, transformation, and resistance to apoptosis inBCR–ABL+ cells [22]. Our results showed low miR-146a expression in

in control group and CML patients in chronic and advanced phases. (B) BCL-2 expression inl group and CML patients in chronic and advanced phases. (D) c-IAP-1 expression in controlp and CML patients in chronic and advanced phases. (F)MCL-1 expression in control groupd phases.



Fig. 5.miRNA expression according to imatinib response. (A)miR-26a levels in CML patients resistant and responsive to IM. (B)miR-29a levels in CML patients resistant and responsive toIM. (C) miR-130b levels in CML patients resistant and responsive to IM. (D) miR-146a levels in CML patients resistant and responsive to IM. IM: imatinib mesylate; CCR: complete cyto-genetic response; R: IM resistant.


CML-AP suggesting an increase of NF-κB activity and a high metastaticpotential in CML advanced phases.

A1 levels were also altered in CML patients investigated here. Therole of A1 anti-apoptotic gene in hematopoiesis or leukemia inductionis not clear [23] but it seems that its expression is associated with theevolution of myeloid leukemia induced by MYC overexpression [24].These data suggest that higher levels of A1 in CML patients can be asso-ciated with CML leukemic cells' resistance to apoptosis and CML clonalevolution.

We also observed higher C-IAP-1 and C-IAP-2 expressions in CMLpatients in comparison to controls. Brieger and collaborators [25] veri-fied a cleavage of C-IAP-1 and C-IAP-2 in K562 cells after IM treatment.These results suggest that IM may act as an apoptosis inductor and theC-IAP-1 and C-IAP-2 upregulations observed in our CML patients maybe associated with the BCR–ABL inhibition by IM and with the IMresponse during CML treatment.

miRNA and target genes according to IM response

We evaluated miR-26a, miR-29c, miR-130b and miR-146a and theirpredicted target geneC-IAP-1 andMCL-1 expressions in IM resistant andresponsive CML patients. Our results showed highermiRNA levels in IM

Fig. 6. Apoptotic predicted target gene expression according to imatinib response. (A) c-IAP-1resistant and responsive to IM. IM: imatinib mesylate; CCR: complete cytogenetic response; R:


resistant group in comparison with responsive patients. Enériz and col-laborators [26] also evaluatedmiR-26a andmiR-29c in IM resistant CMLpatients, however, they noted that its expression was downregulated.The deregulation of miR-26a, miR-29c, miR-130b, miR-146a and theirpredicted targets C-IAP-1 andMCL-1might be a mechanism of IM resis-tance since these genes are anti-apoptotic and may inhibit the BCR–ABL+ cell death increasing the leukemic cell survival.

The IM resistance may occur by BCR–ABL amplification, overexpres-sion of BCR–ABL or spontaneous mutations of the tyrosine kinase do-main of BCR–ABL resulting in insensitivity to IM. Furthermore,resistance may be due to evolution of the disease with the occurrenceof novel numeric or structural cytogenetic aberrations which lead toBCR–ABL-independent proliferation of leukemic cells [27]. So, it seemsthat miR-26a, miR-29c, miR-130b and miR-146a are involved in BCR–ABL-mediated leukemogenesis, although further studies are requiredto show whether they display differential expression in more primitivehematopoietic cells of CML patients during IM treatment [28].miR-146awas shown to negatively regulate NF-κB pathway by inhibiting the ex-pression of IRAK1 and TRAF6 [29]. This suggests that high expressionof miR-146a observed here could be involved in the inhibition of NF-κB signaling induced by BCR–ABL, thereby contributing apoptosis ofthe IM resistant cells.

levels in CML patients resistant and responsive to IM. (B) MCL-1 levels in CML patientsIM resistant.



Table 2Real time PCR oligonucleotide sequences, annealing temperature and amplicon size.

Gene Oligonucleotide sequences (5′–3′) AT (°C) PCR product (bp)

β-ACTIN R: GGC CAT CTC TTG CTC GAA 58 192F: GTG GGC ATG GGT CAG AAG

A1 R: CCA GTT AAT GAT GCC GTC 50 227F: GGC TGG CTC AGG ACT ATC

BCL-2 R: GCG GTA GCG GCG GGA GAA GTC 67 241F: AGT TCG AGA CCC GCT TCC

c-FLIP R: GCC CAG GGA AGT GAA GGT 54 464F: AGT CTT GCT CGT GCT GGT TT

CIAP-1 R: ATG GAC AGT TGG GAA AAT GC 59 550F: AGT CTT GCT CGT GCT GGT TT

CIAP-2 R: TGC TTT TGC CAG ATC TGT TG 58 432F: GCC CTG AGG CAC TCT TCC A

MCL-1 R: CC AGC TCC TAC TCC AGC AAC 56 183F: AGA AAG CTG CAT CGA ACC AT

BCR–ABLB2A2

R: TGGGTCCAGCGAGAAGGTT 62 210F: GCATTCCGCTGACCATCAAT

BCR–ABLB3A2

R: TGGGTCCAGCGAGAAGGTT 62 210F: CCACTCAGCCACTGGATTTAA

R: reverse; F: forward; AT: annealing temperature; PCR: polymerase chain reaction; bp:base pair.


Taken together, the apoptosis-related-gene and microRNA expres-sion associated with resistance on this study may provide an under-standing of the mechanisms linked to acquisition of resistance andapoptosis of leukemic cells which do not undergo CCR after IMtreatment.

Methods

Cell lines

The HL-60 (ATCC: CCL-240) and HL-60.BCR–ABL cells were culturedin RPMI-1640 medium (Invitrogen™ Life Technologies, Carlsbad, USA)supplemented with 10% fetal bovine serum, 1% glutamine, 1% penicillinand streptomycin (Gibco™, New York, USA). The HL-60.BCR–ABL wasobtained from HL-60 cells infected with recombinant retrovirustransfected with (ψ2 + PA 317) packaging lines containing pSR MSVp185bcr–abl tkneo plasmid [13]. The HL-60 and HL-60.BCR-ABL celllineswere kindly donated by Prof. Dr. João Gustavo P. AmaranteMendesfrom Instituto de Ciências Biomédicas-Universidadede São Paulo, Brazil.

Cell line treatment

Three million HL-60 and HL-60.BCR–ABL cells were treated with10 μM of imatinib mesylate, 5 nM of dasatinib and 5 nM of nilotinib in24-well culture plates at 37 °C and 5% CO2 during 4 and 8 h.

Table 3Upregulated miRNAs and their apoptosis-related target genes, fold change andchromosomal location.

MicroRNA Target gene Fold change Chromosome

hsa-miR-222 BMF, BCL-W 366.60 Xp11.3hsa-miR-145 BCL-2, CIAP-1, NOXA, BAX 325.96 5q32hsa-miR-96 CIAP-1 165.94 7q32.2hsa-let-7e BAX 91.59 19q13.41hsa-miR-16 BID, BIK, BCL-2 41.14 13q14.2hsa-miR-21 CIAP-2, FASL 37.01 17q23.1hsa-miR-26a BCL-2, BID, c-FLIP, CIAP-2 22.55 3p22.2hsa-miR-130b CIAP-2 18.07 22q11.21hsa-miR-132 BIMEL 14.19 17p13.3hsa-miR-324-5p BIK 11.45 17p13.1hsa-miR-130a C-FLIP, CIAP-2 8.01 11q12.1hsa-miR-15b BIK 7.99 3q25.33hsa-miR-30e FAS 5.80 1p34.2hsa-miR-26b c-FLIP, CIAP-2, BID 2.91 2q35hsa-miR-326 PUMA 2.66 11q13.4


MicroRNA global expression in HL-60 and HL-60.BCR–ABL

The HL-60 and HL-60.BCR–ABL lineages were submitted to RNAextraction by TRIzol (Invitrogen™, Carlsbad, CA, USA) according to themanufacturer's instructions and reverse transcription was performedwith specified primers RT stem loop for each miRNA (AppliedBiosystems™, Foster City, CA, USA). TaqMan™ Universal PCR MasterMix (Applied Biosystems™, Foster City, CA, USA) was used to detectmiRNA expression by real time PCR. The global expression of miRNAsin HL-60 and HL-60.BCR–ABL was performed using a microRNA panelwhich amplifies 160 human microRNAs (TaqMan™ MicroRNA AssayHuman Panel Early Access Kit— code 4365381/batch: 0505001) accord-ing to the manufacturer on Prism 7500 Real Time PCR (AppliedBiosystems™, Foster City, CA, USA). The RNU24 and RNU44 were theendogenous control genes for miRNA studies. MicroRNA expressionswhich presented fold change, ratio HL-60.BCR–ABL/HL-60, higher than2.5 and lower than 0.4 were considered differentially expressed. Thesedata are described in Tables 3 and 4.

Bioinformatic analysis

The differentially expressed microRNAs in HL-60.BCR–ABL weresubmitted to “in silico” target gene prediction analyses. Functionalanalyses were also done to identify the signaling pathways, biologicalprocesses of the predicted target genes and chromosomal localizationassociated with the miRNA differently expressed.

miRNA targets were analyzed using TARGETSCAN (http://www.targetscan.org), PICTAR (http://pictar.mdc-berlin.de) and miRBase(http://microrna.sanger.ac.uk/sequences/index.shtml). To reduce falsepositive results, only putative target genes predicted by at least two ofthe programs were accepted.

In the present work, we focused the analyses in genes involved incell death regulation. This information was obtained from the databasis Gene Ontology (www.geneontology.org) and miRGen (www.diana.pcbi.ipenn.edu/miRGen.html). The signaling pathways datawere collected from KEGG (www.genome.jp/kegg) and BioCarta(www.cgap.nci.nih.gov/Pathways/BioCarta_Pathways).

RNA isolation and quantitative real-time PCR (qRT-PCR)

Mononuclear cells from patients and controls were isolated byFicoll-Hypaque™ 1077 according to the manufacturer's instructions(Sigma-Aldrich, Steinheim, Germany) and total RNA was extractedwith TRIzol™ (Invitrogen Life Technologies™, Carlsbad, USA) asdescribed by the manufacturer. cDNA was synthesized using High Ca-pacity cDNA reverse transcription™ (Applied Biosystems™, FosterCity, CA, USA). The oligonucleotide sequences, annealing temperatureand amplicon size are described in Table 2. The predicted target geneA1, BCL2, c-FLIP, CIAP-1, CIAP-2 andMCL-1 expression analyseswere per-formed by SYBR GREEN PCR Master Mix (Applied Biosystems™, FosterCity, CA, USA). β-Actin mRNA was used for normalization and analysis.

BCR–ABL and phosphotyrosine detection by Western-blot

For BCR–ABL and phosphotyrosine detection, 3 × 106 HL-60 and HL-60.BCR–ABL cells were lysed in 100 μL of Western-blot sample buffer(5% mercaptoethanol, 4% sodium dodecyl sulfate — SDS, 20% glyceroland 100mMTris–HCl, pH 6.8), heated at 100 ºC for 5min and separatedby 8% Tris-Glycine SDS-PAGE. The cellular lysates were submitted toelectrophoresis and then the separated proteins in the gels wereelectrophoretically transferred to polyvinylidene difluoride (PVDF)membrane (Amersham/GE Healthcare Bio-Sciences, Piscataway, NJ,USA) at 350 mA for 2 h and 30 min. The membrane was blocked withbovine serum albumin (BSA) for 2 h and 30 min and then incubatedwith anti-cABL primary antibody (mouse anti-cABL monoclonal,Millipore, New York, NY, USA) diluted at 1:1000 in BSA during 16 h.


http://www.targetscan.org

http://www.targetscan.org

http://pictar.mdc-berlin.de

http://microrna.sanger.ac.uk/sequences/index.shtml

http://www.geneontology.org

http://www.diana.pcbi.ipenn.edu/miRGen.html

http://www.diana.pcbi.ipenn.edu/miRGen.html

http://www.genome.jp/kegg

http://www.cgap.nci.nih.gov/Pathways/BioCarta_Pathways


Table 4DownregulatedmiRNAs, apoptosis-related target genes, fold change and chromosomal lo-cation.

MicroRNA Target gene Fold change Chromosome

hsa-miR-141 CIAP-2 0.36 12p13.31hsa-miR-150 BAX, c-FLIP 0.33 19q13.33hsa-miR-98 FASL 0.22 Xp11.22hsa-miR-125b BAK, BIK, PUMA, c-FLIP 0.17 11q24.1hsa-miR-142-3p BIK, CIAP-2, c-FLIP 0.16 17q22hsa-miR-200a NOXA 0.15 1p36.33hsa-miR-155 CIAP-2 0.15 21q21.3hsa-let-7d A1, BCL-2, BAK, FAS 0.11 9q22.32hsa-miR-302d BAD, c-FLIP 0.08 4q25hsa-miR-204 CIAP-1 0.05 9q22.12hsa-miR-99a BIMEL 0.03 21q21.1hsa-miR-203 CIAP-1 0.03 14q32.33


The anti-phosphotyrosine antibody diluted at 1:1000 in BSA was usedfor phosphotyrosine determination. The reference protein was detectedusing anti-γ-tubulin (AK-15) (anti-rabbit gamma tubulin polyclonal,Sigma™, St Louis, MO, USA) diluted at 1:5000 in skimmilk and incubat-ed for 16 h at room temperature.

The membranes were also labeled by anti-mouse IgG linked to per-oxidase (Amersham Biosciences, Foster City, CA, USA) diluted at 1:2000in BSA. The tubulin detectionwas donewith anti-rabbit IgG (AmershamBiosciences, Foster City, CA, USA) antibody diluted 1:5000 in skim milkfor 50 min. After the incubation period the membranes were washedwith TBS-T and submitted to detection reagent Amersham™ ECL PlusWestern blotting Detection Reagents ECL (Amersham/GE HealthcareBio-Sciences, Piscataway, NJ, USA) as described by the manufacturer.

Statistical analysis

To compare the microRNA and apoptosis-related gene expressionbetween patients and controls and between patients in CCR or IM-resistant, Mann–Whitney test was used. The analyses were performedusing the software GraphPad Prism 5 Demo. A p-value b0.05 was con-sidered statistically significant. To compare the apoptomiRs expressionamong the treated and non-treated cells, the relative quantificationbased on its expression levels was done.

Conflict of interest

The authors declare that they have no conflict of interest

Authors' contributions

AFF designed and performed experiments, analyzed data and wrotethe paper, LGM collected the peripheral blood samples, IT and CI per-formed the bioinformatic analyses, LA performed the Western blot as-says, BPS and NH were the physicians responsibles for the CMLpatients' treatment and for the selection of patients for study, GAC con-tributed to the bioinformatic analysis, experiment design, discussion ofthe experiments and revised thepaper, DTC discussed the results and SKdiscussed the results and revised the paper. FAC conceived the project,created the study design, sought funding and wrote the paper. All au-thors critically reviewed the manuscript.

Acknowledgments

We first wish to thank the CML patients who participated in thisstudy. We are grateful to Zita Gregório for her technical assistance andhelp in collecting peripheral blood samples. We thank to Dr. GustavoAmarante Mendes for giving us the HL-60.BCR–ABL cell line. This


work was supported by FAPESP Grant Numbers 2005/57746-8, 2008/52049-5, 2011/20135-2 and CNPq.

References

[1] J.V. Melo, D.J. Barnes, Chronic myeloid leukemia as a model of disease evolution inhuman cancer, Nature 7 (2007) 441–450.

[2] M.W. Deininger, S. Vieira, R. Mendiola, et al., BCR–ABL tyrosine kinase activity regu-lates the expression of multiple genes implicated in the pathogenesis of chronic my-eloid leukemia, Cancer Res. 60 (2000) 2049–2055.

[3] G.P. Amarante-Mendes, D.R. Green, The regulation of apoptotic cell death, Braz. J.Med. Biol. Res. 32 (1999) 1053–1061.

[4] S. Gutierrez-Castellanos, M. Cruz, L. Rabelo, et al., Differences in BCL-X(L) expressionand STAT5 phosphorylation in chronic myeloid leukaemia patients, Eur. J. Haematol.72 (2004) 231–238.

[5] K.J. Aichberger, M. Mayerhofer, M.T. Krauth, et al., Identification of mcl-1 as aBCR/ABL-dependent target in chronic myeloid leukemia: evidence for cooperativeantileukemic effects of imatinib and mcl-1 antisense oligonucleotides, Blood 105(2005) 3303–3311.

[6] D. Perrotti, P. Neviani, From mRNA metabolism to cancer therapy: chronic myelog-enous leukemia shows the way, Clin. Cancer Res. 13 (2007) 1638–1642.

[7] S. Faderl, H.M. Kantarjian, M. Talpaz, Chronic myelogenous leukemia: update on bi-ology and treatment, Oncology 13 (1999) 169–180.

[8] Y. Cheng, R. Ji, J. Yue, et al., MicroRNAs are aberrantly expressed in hypertrophicheart: do they play a role in cardiac hypertrophy? Am. J. Pathol. 170 (2007)1831–1840.

[9] A. Cimmino, G.A. Calin, M. Fabbri, et al., miR-15 and miR-16 induce apoptosis bytargeting BCL2, PNAS 102 (2005) 13944–13949.

[10] D.L. Zanette, F. Rivadavia, G.A. Molfetta, et al., miRNA expression profiles in chroniclymphocytic and acute lymphocytic leukemia, Braz. J. Med. Biol. Res. 40 (2007)1435–1440.

[11] H. Seca, G.M. Almeida, J.E. Guimarães, M.H. Vasconcelos, miR signatures and the roleof miRs in acute myeloid leukaemia, Eur. J. Cancer 46 (2010) 1520–1527.

[12] F.P. Careta, Expression of Genes Involved in Cell Proliferation and Apoptosis inChronic Lymphocytic Leukemia, Master Degree Thesis Faculty of Medicine ofRibeirão Preto-University of São Paulo, 2007. (75 pp.).

[13] A.E. Bueno-da-Silva, G. Brumatti, F.O. Russo, Bcr–Abl1-mediated resistance to apo-ptosis is independent of constant tyrosine-kinase activity, Cell Death Differ. 10(2003) 592–598.

[14] W. Guo, R. Liu, Y. Ono, et al., Molecular characteristics of CTA056, a novelinterleukin-2-inducible T-cell kinase inhibitor that selectively targets malignant Tcells and modulates oncomirs, Mol. Pharmacol. 82 (2012) 938–947.

[15] O.H. Rokah, G. Granot, A. Ovcharenko, et al., Downregulation of miR-31, miR-155,and miR-564 in chronic myeloid leukemia cells, PLoS One 7 (2012) 35501.

[16] S. Suresh, L. McCallum, W. Lu, MicroRNAs 130a/130b are regulated by BCR–ABL anddownregulate expression of CCN3 in CML, J. Cell Commun. Signal. 5 (2011)183–191.

[17] G.A. Calin, C.D. Dumitru, M. Shimizu, et al., Frequent deletions and down-regulationof micro-RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia,Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 15524–15529.

[18] G.J. Nuovo, M. Garofalo, N. Valeri, et al., Reovirus-associated reduction ofmicroRNA-let-7d is related to the increased apoptotic death of cancer cells in clini-cal samples, Mod. Pathol. 25 (2012) 1333–1344.

[19] J.L. Mott, S. Kobayashi, S.F. Bronk, G.J. Gores, miR-29 regulates Mcl-1 protein expres-sion and apoptosis, Oncogene 26 (2007) 6133–6140.

[20] Y. Xiong, J.H. Fang, J.P. Yun, et al., Effects of microRNA-29 on apoptosis, tumorigenic-ity, and prognosis of hepatocellular carcinoma, Hepatology 51 (2010) 836–845.

[21] I. Spinello, M.T. Quaranta, R. Riccioni, et al., MicroRNA-146a and AMD3100, twoways to control CXCR4 expression in acute myeloid leukemias, Blood Cancer J. 1(6) (2011) e26.

[22] W.Wei, H. Huang, S. Zhao, et al., Alantolactone induces apoptosis in chronic myelog-enous leukemia sensitive or resistant to imatinib through NF-κB inhibition andBcr/Abl protein deletion, Apoptosis 18 (9) (2013) 1060–1070.

[23] J.Y. Métais, T. Winkler, J.T. Geyer, et al., BCL2A1a over-expression inmurine hemato-poietic stem and progenitor cells decreases apoptosis and results in hematopoietictransformation, PLoS One 7 (2012) 48267.

[24] L.J. Beverly, H.E. Varmus, MYC-inducedmyeloid leukemogenesis is accelerated by allsix members of the antiapoptotic BCL family, Oncogene 28 (2009) 1274–1279.

[25] A. Brieger, S. Boehrer, S. Schaaf, et al., In bcr–abl-positive myeloid cells resistant toconventional chemotherapeutic agents, expression of Par-4 increases sensitivity toimatinib (STI571) and histone deacetylase-inhibitors, Biochem. Pharmacol. 68(2004) 85–93.

[26] E.S.J. Enériz, J.R. Gómez, A.J. Velasco, et al., MicroRNA expression profiling inimatinib-resistant chronic myeloid leukemia patients without clinically significantABL1-mutations, Mol. Cancer 8 (2009) 69.

[27] A. Hochhaus, S. Kreil, A.S. Corbin, et al., Molecular and chromosomal mechanisms ofresistance to imatinib (STI571) therapy, Leukemia 16 (2002) 2190–2196.

[28] S. Flamant, W. Ritchie, J. Guilhot, et al., Micro-RNA response to imatinib mesylate inpatients with chronic myeloid leukemia, Haematologica 95 (2010) 1325–1333.

[29] K.D. Taganov, M.P. Boldin, K.J. Chang, D. Baltimore, NF-kappaB-dependent inductionof microRNA miR-146, an inhibitor targeted to signaling proteins of innate immuneresponses, Proc. Natl. Acad. Sci. U. S. A. 103 (2006) 12481–12486.


http://refhub.elsevier.com/S1079-9796(14)00014-X/rf0005














































































Documents

ApoptomiRs expression modulated by BCR–ABL is linked to CML progression and imatinib resistance