Volume 33 Número 4 Dezembro 2009nematologia.com.br/files/revnb/33_4.pdf · 2019. 1. 4. · Volume 33 Number 4 December 2009 CONTENTS Articles (in English) Active substances against

NEMATOLOGIA BRASILEIRA

Volume 33 Número 4 Dezembro 2009

ÍNDICE Artigos Active substances against Meloidogyne exigua produced in a liquid medium by Bacillus

megaterium. – Oliveira, D.F., H.W.P. Carvalho, A.S. Nunes, V.P. Campos, G.H. Silva &

V.A.C. Campos.. ....................................................................................................................... 271

Comunicações Científicas

Incidência de Meloidogyne spp. e Pratylenchus sp. em cana-de-açúcar no estado de

Pernambuco, Brasil. – Chaves, A., S.R.V.L. Maranhão, E.M.R. Pedrosa, L.M.P. Guimarães &

M.K.R. dos S.Oliveira .............................................................................................................. 278

Flutuação populacional de nematoides em bananais de Minas Gerais e Bahia (anos 2003 a 2008)

– Neves W.S., M.S.C. Dias & J.G.Barbosa .............................................................................. 281

XXVIII Congresso Brasileiro de Nematologia &

II Congresso Internacional de Nematologia Tropical

Relatório ................................................................................................................................... 286

Resumos ................................................................................................................................... 288

Índice por Autor dos Resumos ................................................................................................. 433

Índice por Assunto dos Resumos ............................................................................................. 435

Lista de Revisores do Volume 33 (2009) ................................................................................. 437

NEMATOLOGIA BRASILEIRA

Volume 33 Number 4 December 2009

CONTENTS

Articles (in English)

Active substances against Meloidogyne exigua produced in a liquid medium by Bacillus

megaterium. – Oliveira, D.F., H.W.P. Carvalho, A.S. Nunes, V.P. Campos, G.H. Silva &

V.A.C. Campos.. ....................................................................................................................... 271

Communications (in Portuguese)

Ocurrence of Meloidogyne spp. and Pratylenchus sp. on sugarcane in the State of Pernambuco,

Brazil – Chaves, A., S.R.V.L. Maranhão, E.M.R. Pedrosa, L.M.P. Guimarães & M.K.R. dos

S.Oliveira .................................................................................................................................. 278

Population fluctuation of nematodes in soils grown with banana plantations in the states of

Minas Gerais and Bahia (Brazil) from 2003 to 2008 – Neves W.S., M.S.C. Dias & J.G.Barbosa

................................................................................................................................................... 281

XXVIII Congresso Brasileiro de Nematologia &


List of abstracts ......................................................................................................................... 288

Author index …………………................................................................................................. 433

Subject index ............................................................................................................................ 435

List of Referees for Volume 33 (2009) .................................................................................... 437

Nematologia BrasileiraPiracicaba (SP) Brasil

271

Active Substances against Meloidogyne exigua Produced in a Liquid Medium by Bacillus megaterium

Active Substances against Meloidogyne exigua Produced in a LiquidMedium by Bacillus megaterium

Denilson F. Oliveira1*, Hudson W.P. Carvalho1, Alexandro S. Nunes1, Vicente P. Campos3, Geraldo H. Silva2

& Viviane A.C. Campos1

1Departamento de Química, Universidade Federal de Lavras (UFLA), 37200-000 Lavras (MG) Brasil.2Núcleo de Química, Universidade Federal do Sergipe, 49500-000 Itabaiana (SE) Brasil.

3Departamento de Fitopatologia, UFLA.*Corresponding author: [email protected]

Recebido para publicação em 01 / 07 / 2009. Aceito em 22 / 09 / 2009Editado por Claudio Marcelo Oliveira

Summary - Oliveira, D.F., H.W.P. Carvalho, A.S. Nunes, V.P. Campos, G.H. Silva & V.A.C. Campos. 2009.Active substances against Meloidogyne exigua produced in a liquid medium by Bacillus megaterium.

In order to contribute to the development of new methods to control plant-parasitic nematodes, this workaimed to identify active substances against Meloidogyne exigua produced by Bacillus megaterium, which was previouslyselected due to its ability to produce nematicidal substances. Consequently, the bacterium was grown in trypticsoy broth, from which cells were removed to afford a liquid that was freeze-dried. The resulting residue wasfractionated by solvent extractions and chromatographic processes monitored by mortality assays with M.exigua second stage juveniles (J2) to select the active fractions in each step. As a result, a fraction causing highmortality of J2 was obtained. According to analyses by infrared spectroscopy and high performance liquidchromatography, this fraction comprised threonine, glutamic acid, glycine, alanine, valine, methionine, isoleucine,leucine, tyrosine, phenylalanine and histidine. The amino acids L-phenylalanine, L-isoleucine, DL-methionine,L-leucine and DL-valina, obtained from commercial sources, caused significantly higher M. exigua J2 mortalitiesthan those observed for the negative control (water), confirming the nematicidal activities observed for thesubstances from bacterial source.Key words: Meloidogyne exigua, amino acid, nematicide.

Resumo - Oliveira, D.F., H.W.P. Carvalho, A.S. Nunes, V.P. Campos, G.H. Silva & V.A.C. Campos. 2009.Substâncias ativas contra Meloidogyne exigua produzidas por Bacillus megaterium em meio de cultura líquido.

Com vistas a contribuir para o desenvolvimento de novos produtos para o controle de nematoidesfitoparasitas, buscou-se neste trabalho identificar as substâncias ativas contra Meloidogyne exigua produzidas porBacillus megaterium, que foi previamente selecionado pela sua capacidade de produzir substâncias nematicidas.Para tanto, cultivou-se a bactéria em caldo soja-tripticaseína e, após remoção das células bacterianas, o líquidoobtido foi liofilizado e fracionou-se o resíduo resultante por extração com solventes e cromatografia emcoluna de sílica gel. Todo o processo de fracionamento foi monitorado por testes de mortalidade com juvenisdo segundo estádio (J2) de M. exigua, para que as frações ativas contra o nematoide em cada etapa pudessemser identificadas. Com isso, obteve-se uma amostra que causou elevada mortalidade de J2 que, segundo análisespor espectroscopia de infravermelho e cromatografia líquida de alta eficiência, era composta por treonina,ácido glutâmico, glicina, alanina, valina, metionina, isoleucina, leucina, tirosina, fenilalanina e histidina. Osaminoácidos de origem comercial L-fenilalanina, L-isoleucina, DL-metionina, L-leucina, DL-metionina e DL-valina causaram mortalidades de J2 de M. exigua significativamente superiores as do controle negativo (água), oque permitiu confirmar as atividades nematicidas das substâncias de origem bacteriana.Palavras-chaves: Meloidogyne exigua, aminoácidos, nematicida.

ARTIGO

272 Vol. 33(4) - 2009

Denilson F. Oliveira, Hudson W.P. Carvalho, Alexandro S. Nunes, Vicente P. Campos, Geraldo H. Silva & Viviane A.C. Campos

IntroductionOne of the major problems for coffee production

in Brazil is the field infestation with the root-knotnematode Meloidog yne exigua (Tylenchina:Meloidogynidae), which is widely disseminatedthrough Brazilian coffee plantations (Campos &Villain, 2005). Particularly in the south of Minas GeraisState, M. exigua can be found in 22 % of the coffeeplantations and 95.1 % of the municipal districts(Castro et al., 2008). Losses between 30 and 45 % ofthe coffee production are attributed to thisphytoparasite, which is a concern for the State ofMinas Gerais (Barbosa et al., 2004, Castro et al., 2008),which contains about 47 % of the Brazilian coffeefields (Companhia Nacional de Abastecimento, 2009).

Although prevention methods to avoid nematodeinfestation and the use of resistant plants are the mostefficient and economical possibilities to avoid lossescaused by M. exigua in coffee fields (Campos & Silva,2008), the most usual method for controllingnematodes in the region is the use of highly toxicsubstances from synthetic origin (nematicides), whichcan contaminate humans and the environment (Silvaet al., 2002). Consequently, the development of lessharmful nematicides has been a constant objective forvarious research groups, among which are thoseconsidering the use of rhizobacteria as a promisingalternative to control nematodes (Naves et al., 2004).Apparently, such microorganisms affect nematodesby several mechanisms, the production of nematicidalmetabolites being one of them and a very interestingexample for the development of new nematicides(Campos et al., 1998). Thus, in a previous work severalrhizobacteria isolated from plants in southern MinasGerais (Brazil) were tested for the ability to produceactive substances against M. exigua. The lowestnematode population was observed on those coffeeplants treated with metabolites produced by a strainof Bacillus megaterium (Bacillales: Bacillaceae) isolatedfrom coffee roots (Oliveira et al., 2007). To continuesuch work, the present study aimed to identify thenematicidal substances produced by B. megaterium.

Material and MethodsGeneral aspects of the fractionation process.

The column chromatography process was carried out

with flash silica gel 60 (Merck). Silica gel 60impregnated with a fluorescent indicator on aluminumplates (Merck) was used for thin layer chromatography.Except when described differently, all samples frombacterial origin were dissolved in 2 ml of an aqueous0.01 g / ml Tween 80 solution for the mortality assaywith M. exigua second-stage juveniles (J2).

Production and purification of the bacterialmetabolites. The rhizobacterium Bacillus megaterium(strain 54-06) used in the present work is on depositat the Departamento de Fitopatologia, UniversidadeFederal de Lavras, Lavras (Brazil). The microorganismwas grown in 2.0 l of tryptic soy broth (TSB, Merck)for 12 days, under constant stirring (100 rpm), at 28oC. Then, bacterial cells were removed bycentrifugation (10,000 g) and the supernatant liquidwas freeze-dried to afford 55.0 g of B. megateriummetabolites. An aliquot of such material (70 mg) wasused in the mortality assay with M. exigua J2. Part ofthe freeze-dried bacterial metabolites (16.5 g) wassuccessively washed with hexane (320 ml x 6), ethylacetate (320 ml x 6) and methanol (320 ml x 6). Aftersolvent removal in a rotary evaporator and freeze-drying, four different fractions were obtained: solublein hexane (0.045 g), soluble in ethyl acetate (0.282 mg),soluble in methanol (9.283 g) and insoluble in the solventsused (4.956 g). Aliquots (1.3 %) of all fractions weresubmitted to the mortality assay with M. exigua J2.

The insoluble fraction was analyzed by thin layerchromatography employing several combinations ofethyl acetate, methanol and water as mobile phase.Ultraviolet light (UV - 254 nm) and ceric sulfate [100gof (NH4)2MoO4, 4g of Ce(SO4)2.4H2O, 100 ml ofH2SO4 and 900 ml of H2O] were used to visualizesubstances in the chromatographic plates. Then, 800mg of such fraction were successively eluted withmethanol (400 ml ), distilled water (400 ml ) and anaqueous 0.1M HCl solution (400 ml ), through a 2 x14 cm silica gel column. The new fractions wereconcentrated to dryness in a rotary evaporator andfreeze-dried, resulting in metabolites eluted withmethanol (0.286 g), distilled water (0.392 g) and withaqueous HCl solution (0.058 g). Aliquots (5 %) ofsuch fractions were dissolved in distilled water (2.0ml ) to be submitted to the mortality assay with M.exigua J2. Then, the methanol eluted fraction was


273


analyzed by thin layer chromatography usingcombinations of methanol and water containing aceticor formic acid. Substances were visualized on thechromatographic plates as described above.

Mortality test with second-stage juveniles (J2)of Meloidogyne exigua. At first, M. exigua eggs wereobtained from coffee (Coffea arabica) roots inaccordance with the modifications of the Hussey &Barker (1973) technique by Bonneti & Ferraz (1981),and purified as described by Coolen & D’Herde(1972). The J2 of the nematode were hatched fromthe eggs, collected and used in the assay, whichfollowed the modification of the Chen & Dickson(2000) technique by Amaral et al. (2003). An aqueoussuspension (20 μl ) containing approximately 20 J2

(less than two days old) and 100 μl of the solution tobe evaluated were poured into 300 μl wells of a 96-well polypropylene plate. To test solutions from thedried bacterial metabolites before the fractionationprocess or fractions obtained just after the solventwashings, an aqueous suspension (30 μl ) of 3000 μg/ ml “Pentabiótico” (a mixture of antibacterialsproduced by Fort Dodge, Brazil) was also pouredinto each well to avoid bacterial growth. Theexperiments were carried out in a random design, withsix replicates per treatment, employing aqueous 0.01g / ml Tween 80 solution or water as negative controland the commercial nematicide Aldicarb at 50 μg /ml as positive control. After 24 h at 25 oC, one dropof an aqueous 1.0 M NaOH solution was pouredinto each well and nematodes were counted. J2 thatchanged their body shape from straight to curled orhook-shaped within 3 min were considered to be alive,whereas the nematodes not responding to the additionof NaOH were considered to be dead. Values weretransformed into percentage and submitted to analysesof variance (ANOVA). Then, means were comparedin accordance with the Scott & Knott (1974) test (P ≤0.05). Statistical calculations were done using SISVARsoftware (Ferreira, 2000).

Identification of the active substances. About2.0 mg of the fraction eluted with methanol throughthe silica gel column were mixed with approximately30 mg of anhydrous potassium bromide andtransformed into a 0.5 cm diameter pellet in a 12 tonpress, to be analyzed in a Fourier Transform Infrared

Spectrometer (FT-IR, Digilab Excalibur, USA), in the4000-400 cm-1 region. Following the proceduresdescribed by Carvalho et al. (1998), another aliquot (1mg) of the same fraction was dissolved in 1 ml of asodium citrate buffer (pH 2.0) to be analyzed in ahigh performance liquid chromatograph (Shimadzu,model LC 10A/C-47A) equipped with a post-columnderivatization reactor. A cationic column (shim-pack,100 x 60 mm, 5 ìm, PSS-Na, Shimadzu, Japan) wasused and the mobile phase comprised phases “A” and“B” at a 1:1 rate (phase “A”: aqueous 0.2 M sodiumcitrate solution containing 7 % (v/v) ethanol, at pH3.2, which was obtained by the addition of 1 Mperchloric acid; phase “B”: aqueous solutioncontaining 0.6 M sodium citrate and 0.2 M H3BO3, atpH 10, which was obtained by the addition of 4 MNaOH). Total flow rate (“A” + “B”) was kept at 6.0ml and, after the column, the eluents were mixed inthe derivatization reactor with a boric acid / carbonicacid buffer (pH 10) containing sodium hypochlorite,0.08% o-ftaldialdehyde, 1.4 % ethanol, 0.04 % Bry 35and 0.10 % N-acetyl-L-cysteine. After derivatization,the amino acids were detected by fluorescence at 450nm, which resulted from light incidence at 350 nm.Peaks in the resulting chromatograms were identifiedby comparison of the retention times with valuesobtained during the analyzes of commercial aminoacids at 2.5 μM / ml (Pierce, code 20088, USA).

Amino acids from commercial sources. D,L-methionine (> 99.0 %, Proquímicos, Brazil), L-isoleucine (> 98.5 %, Vetec, Brazil), L-leucine (> 97.0%, Pfanstiehl, Germany), L-phenylalanine and DL-valine (> 99.9 %, Merck, Germany) were purchasedfrom commercial sources and used as received. Theywere dissolved in water and submitted to the in vitromortality assay with M. exigua J2 as described above.

Results and DiscussionIn the first mortality assay with M. exigua J2, both

B. megaterium metabolites before and after the freeze-drying increased the percentage of dead nematodeswhen compared to the negative control (Table 1),suggesting that the active substances produced by suchbacterium were not volatile.

Although all fractions obtained after solventwashings presented activity against M. exigua, the

274 Vol. 33(4) - 2009


percentage of dead J2 for the hexane and ethyl acetatefractions were close to the values observed for thenegative control (Table 2). In any case, such resultssuggested the production of several nematicidalsubstances by B. megaterium.

Since the insoluble fraction was the most active(Table 2), it was used in the next steps of the presentwork, the others being stored for future studies.Initially, such a fraction was analyzed by thin layerchromatography, which revealed its great complexity.Consequently, the insoluble fraction underwentfractionation in a silica gel column to afford three newactive fractions (Table 3).

Although all fractions presented activity against M.exigua, only the methanol eluted one was used tocontinue the present work, since it afforded the highest

values of dead J2 (Table 3). According to analyses bythin layer chromatography, the complexity of thechosen fraction was much lower than that observedfor the methanol soluble fraction. Consequently, aninfrared spectroscopic analysis was carried out toreveal something about the chemical structures of thesubstances present in the methanol eluted fraction. Inthe resulting infrared spectrum the following signalscould be observed: between 3132 and 2100 cm-1,which were characteristic of the N-H stretchingvibrations of ammonium ions; between 533 cm-1 and1511 cm-1, which could be attributed to bendingvibrations of NR3H

+ groups, and two strong signalsat 1587 cm-1 and 1403 cm-1 that were characteristicsof carboxylate anions (Silverstein & Webster, 1998).

The possible presence of NR3H+ and carboxylate

Table 1 - Effect of metabolites produced by Bacillus megaterium in tryptic soy broth (TSB) on second-stage juveniles (J2) of Meloidogyneexigua.

Treatment Dead J2 (%)

Tween 80 solution (negative control) 15.2 aAldicarb at 50 μg / ml (positive control) 86.2 bB. megaterium metabolites before freeze-drying 95.4 cB. megaterium metabolites after freeze-drying 97.2 cTSB 18.3 a

Means of six replicates followed by the same letter do not differ significantly (P ≤ 0.05).

Table 2 - Effect on second-stage juveniles (J2) of Meloidogyne exigua by fractions obtained during the solvent washings of themetabolites produced by Bacillus megaterium.


Tween 80 solution (negative control) 16.3 aAldicarb at 50 μg / ml (positive control) 86.8 dHexane soluble fraction 20.3 bEthyl acetate soluble fraction 22.2 bMethanol soluble fraction 50.8 cInsoluble fraction 90.2 e


Table 3 - Effect on second-stage juveniles (J2) of Meloidogyne exigua by fractions obtained during elution of the Bacillus megateriummetabolites through a silica gel column.


Water (negative control) 7.3 aAldicarb at 50 μg / ml (positive control) 85.5 dMethanol eluted fraction (7.15 mg / ml ) 90.2 dWater eluted fraction 36.6 c0.1 M HCl eluted fraction 28.5 b



275


groups and the high polarity of the fraction elutedwith methanol through silica gel column suggestedthe presence of amino acids. Consequently, thatfraction was analyzed in a high performance liquidchromatograph designed for the analyses of aminoacids. The following substances were identified in thefraction: threonine, glutamic acid, glycine, alanine,valine, methionine, isoleucine, leucine, tyrosine,phenylalanine and histidine (Figure 1). Both thefractionation and analytical processes employed couldnot differentiate between the D- and L-enantiomersof these amino acids, which can present distinct effectson several organisms. While the L-forms areconstitutively produced and used by all livingorganisms for the biosynthesis of proteins, the D-forms are found in low amounts in some organismsand, in some cases, are associated with antimicrobialand neurological activities (Silva & Silva, 2009).

To attribute the nematicidal property bymetabolites produced by B. megaterium to the above-mentioned amino acids may sound strange at a firsthearing, since such substances are universally used asnutrients by living organisms. However, reports on

the activity of the amino acids L-arginine and L-glutamic acid against Meloidogyne javanica can be foundin the literature (Osman, 1993). Analogously, Talavera& Mizukubo (2005) reported the activity of DL-methionine against Meloidogyne incognita. In experimentswith tomato plants (Lycopersicon esculentum) bothapplications of DL-methionine to soil and to plantaerial parts reduced M. incognita population in plantroots (Setty et al. , 1977, Reddy et al., 1975).Furthermore, in a recent work with Paenibacillusmacerans the nematicidal properties of the bacterialmetabolites were also attributed to L-amino acids(Oliveira et al., 2009).

To corroborate the results described above, someL- and DL-amino acids from commercial sourceswere also submitted to the mortality assay with M.exigua J2. Despite the low activity, all of them increasedJ2 death when compared to the negative control (Table4). A combination of L-isoleucine and DL-methioninewas also used in the mortality test to evaluate a possiblesynergic effect, but no alteration in the percentage ofdead J2 was observed.

In view of the above-mentioned results, it is

Figure 1 - Chromatogram obtained when the fraction of Bacillus megaterium metabolites that eluted through a silica gel column withmethanol was analyzed by high performance liquid chromatography. Thr: threonine, Glu: glutamic acid, Gly: glycine, Ala: alanine, Val:valine, Met: methionine, Ile: isoleucine, Leu: leucine, Tyr: tyrosine, Phe: phenylalanine, His: histidine.

Inte

nsi

ty(a

.u.)

Time (min)

0 10 15 20 25 30 35 40 45 50 55 60

Thr

Glu Gly Ala

ValIle

Leu

Tyr PheHisMet

276 Vol. 33(4) - 2009


possible to conclude that amino acids, probably theL-enantiomers, contribute to the nematicidal activityobserved for the metabolites produced by Bacillusmegaterium in tryptic soy broth. Apparently, they wereproduced by the action of bacterial hydrolytic enzymeson proteic nutrients of the culture medium, the aminoacids of which should be in the L-form. Consequently,protein containing media should be cautiously usedfor the selection of bacteria able to producenematicidal metabolites to avoid the interference ofamino acids.

AcknowledgementsThe authors are grateful to CAPES (Coordenação

de Aperfeiçoamento de Pessoal de Nível Superior),CNPq (Conselho Nacional de DesenvolvimentoCientífico e Tecnológico) and FAPEMIG (Fundaçãode Amparo à Pesquisa do Estado de Minas Gerais)for financial support and a fellowship. The authorsalso express their sincere thanks to Prof. Eduardo M.Cilli for the HPLC analyses carried out at AraraquaraChemistry Institute, UNESP (Universidade EstadualPaulista).

Literature CitedAMARAL, D.R., F.E.R. OLIVEIRA, D.F. OLIVEIRA &

V.P. CAMPOS. 2003. Purification of two substancesfrom bulbs of onion with nematicidal activity againstMeloidogyne exigua Goeldi. Nematology 5: 859–864.

ARAÚJO, F.F., J.F.V SILVA & A.S.F. ARAÚJO. 2002.Influência de Bacillus subtilis na eclosão, orientação einfecção de Heterodera glycines em soja. Ciência Rural, 32(2):197-202.

Table 4 - Effect on second-stage juveniles (J2) of Meloidogyne exigua by amino acids from commercial sources.

Means of six replicates followed by the same letter, in each column, do not differ significantly (P ≤ 0.05).1500 μg of L-Isoleucine + 500 μg of DL-Methionine + 1.0 or 0.5 ml of water.

Treatment Dead J2 (%)1,000 μμμμμg / ml 2,000 μμμμμg / ml

Water (negative control) 3.6 a 3.6 aAldicarb at 50 μg / ml (positive control) 85.2 c 85.2 eL-phenylalanine 24.0 b 28.1 bL-isoleucine 25.0 b 48.0 dDL-methionine 25.3 b 28.5 bL-leucine 24.2 b 27.8 bL-isoleucine + DL-methionine1 24.0 b 36.3 cDL-valine 25.3 b 28.5 b

BARBOSA, D.H.S.G., H.D. VIEIRA, R.M. SOUZA, A.P.VIANA & C.P. SILVA. 2004. Field estimative of coffeeyield losses and damage threshold by Meloidogyne exigua.Nematologia Brasileira 28 (1): 49-54.

BONETI, J.I.S. & J. FERRAZ. 1981. Modificação dométodo de Hussey e Barker para extração de ovos deMeloidogyne exigua de cafeeiro. Fitopatologia Brasileira 6:553.

CAMPOS, V.P. & J.R.C. SILVA. 2008 Management ofMeloidogyne spp. in coffee plantations. In: SOUZA, R.M.(ed). Plant Parasitic Nematodes of Coffee. Springer, p.149-164.

CAMPOS, V.P., J.T. SOUZA & R.G. SOUZA. 1998. Controlede fitonematóides por meio de bactérias. Revisão Anualde Patologia de Plantas 6: 285-327.

CAMPOS, V.P. & L. VILLAIN. 2005. Nematode parasits ofcoffee and cocoa. In: LUC, M., R.A. SIKORA & J.BRIDGE. (ed). Plant Parasitic Nematodes in Subtropicaland Tropical Agriculture. 2nd Ed. CAB International,Wallingford - UK, p. 531-535.

CARVALHO, R.S.H., A. ETCHEGARAY, A.H. STRAUS,H.K. TAKAHASHI, I.L.S. TERSARIOL, H.B.NADER, E.M. CILLI & C.R. NAKAIE. 1998.Purification of peptides and other biological compoundswith highly substituted resins so far used for peptidesynthesis. EUROPEAN PEPTIDE SYMPOSIUM,XXV, Budapest. Proceedings, p. 294-295.

CASTRO, J.M.C., V.P. CAMPOS, E.A. POZZA, R.L.NAVES, W.C. ANDRADE Jr., M.R. DUTRA, J.L.COIMBRA, C. MAXIMINIANO & J.R.C. SILVA.2008. Levantamento de fitonematóides em cafezais dosul de Minas Gerais. Nematologia Brasileira 32 (1):56-64.

CHEN, S.Y. & D.W. DICKSON. 2000. A technique fordetermining live second-stage juveniles of Heteroderaglycines. Journal of Nematology 32: 117-121.

COMPANHIA NACIONAL DE ABASTECIMENTO.2009. Acompanhamento da safra brasileira: Café.<http://www.conab.gov.br/conabweb/download/safra/4cafe08.pdf> acesso em 30 de abril de 2009.


277


COOLEN, W.A. & C.J. D’HERDE. 1972. A Method for theQuantitative Extraction of Nematodes from PlantTissue. Nematology and Entomology Research Station,Ghent – Belgium, p.77.

FERREIRA, D.F. 2000. Análises estatísticas por meio doSisvar para Windows versão 4.0. In: REUNIÃOANUAL DA REGIÃO BRASILEIRA DASOCIEDADE INTERNACIONAL DEBIOMETRIA, XLV, São Carlos (SP). Resumos, p. 255-258.

HUSSEY, R.S. & K.R.A. BAKER. 1973. Comparison ofmethods for collecting inocula of Meloidogyne sppincluding a new technique. Plant Disease Reporter, 57(12):1025-1028.

NAVES, R.L., V.P. CAMPOS & R.M. SOUZA. 2004. Filtradosde culturas bacterianas endofíticas na motilidade,mortalidade e eclosão de juvenis de segundo estádio deMeloidogyne javanica. Fitopatologia Brasileira 29:384-388.

OLIVEIRA, D.F., V.P. CAMPOS, D.R. AMARAL, A.S.NUNES, J.A. PANTALEÃO & D.A. COSTA. 2007.Selection of rhizobacteria able to produce metabolitesactive against Meloidogyne exigua. European Journal ofPlant Pathology 119:477–479.

OLIVEIRA, D.F., H.W.P. CARVALHO, A.S. NUNES, G.H.SILVA, V.P. CAMPOS, H.M. SANTOS Jr. & A.J.CAVALHEIRO. 2009 The activity of amino acidsproduced by Paenibacillus macerans and from commercialsources against the root-knot nematode Meloidogyneexigua. European Journal of Plant Pathology 124: 57-63.

OSMAN, G.Y. 1993. Effect of amino-acids amd ascorbicacid on Meloidogyne javanica Chitw. (Tylenchidae,

Nematoda). Anzeiger fur SchadlingskundePflanzenschutz Umweltschutz 66 (7):140-142.

REDDY, P.P., H.C. GOVINDU & K.G.H. SETTY. 1975.Studies on the effect of amino acids on the root-knotnematode Meloidogyne incognita infecting tomato. IndianJournal of Nematology 5 (1):36-41.

SCOTT, A.J. & M. KNOTT. 1974. Cluster analysis methodfour grouping means in the analysis of variance.Biometrics 30: 507-512.

SETTY, K.G.H., K. KRISHNAPPA & K.S.K. PRASAD.1977. Chemotherapeutic action of L-cysteine againstroot-knot nematode [Meloidogyne incognita (Kofoid andWhite)] Chitwood on tomato. Current Research 6(7):124-5.

SILVA, J.J.R.F & J.A.L. SILVA. 2009. D aminoácidos embiologia – mais do que se julga. Química Nova 32(2):554-561.

SILVA, G.H., D.F. OLIVEIRA & V.P. CAMPOS. 2002.Purificação de metabólitos fúngicos com efeitos tóxicossobre Meloidogyne incognita. Fitopatologia Brasileira,27:594-598.

SILVERSTEIN, R.M. & F.X. WEBSTER. 1998.Spectrometric Indentification of Organic Compounds.6th Edi. John Wiley & Sons, New York - EUA, p.114.

SOUSA, C.S., A.C.F. SOARES, M.S. GARRIDO & G.M.C.O.ALMEIDA. 2006. Estreptomicetos no controle dameloidoginose em mudas de tomateiro. PesquisaAgropecuária Brasileira 41 (12):1759-1766.

TALAVERA, M. & T. MIZUKUBO. 2005. Effects of DL-methionine on hatching and activity of Meloidogyneincognita eggs and juveniles. Pest Management Science61 (4): 413-416.

278 Vol. 33(4) - 2009

Andréa Chaves, Sandra R.V.L. Maranhão, Elvira M.R. Pedrosa, Lílian M.P. Guimarães, & Misterlaine K.R. dos S. Oliveira

Incidência de Meloidogyne spp. e Pratylenchus sp. em Cana-de-açúcar noEstado de Pernambuco, Brasil

Andréa Chaves¹*, Sandra R.V.L. Maranhão², Elvira M.R. Pedrosa², Lílian M.P. Guimarães1,& Misterlaine K.R. dos S. Oliveira1

¹RIDESA, Estação Experimental de Cana-de-açúcar do Carpina, Universidade Federal Rural de Pernambuco (UFRPE),Rua Ângela Cristina C.P. de Luna s/n, Bairro Novo, 55810-000 Carpina (PE) Brasil.

²Departamento de Agronomia, UFRPE, Rua Dom Manoel de Medeiros s/n, Dois Irmãos, 52171-900 Recife (PE) Brasil.*Autora para correspondência: [email protected]

Enviado para publicação em 12 / 02 / 2009. Aceito em 29 / 09 / 2009Editado por Mário Inomoto

Resumo - Chaves, A., S.R.V.L. Maranhão, E.M.R. Pedrosa, L.M.P. Guimarães & M.K.R. dos S. Oliveira.Incidência de Meloidogyne spp. e Pratylenchus sp. em cana-de-açúcar no estado de Pernambuco, Brasil.

A presente pesquisa teve como objetivo realizar levantamento populacional de fitonematoides em áreas dolitoral norte de Pernambuco cultivadas com as variedades de cana-de-açúcar RB-873710, RB-72454, RB-784764, RB-813804, SP71-6949, SP79-1011 e SP78-4764. Registrou-se a ocorrência de Meloidogyne spp. ePratylenchus sp. em todas as variedades avaliadas, com maiores densidades do nematoide-das-galhas em RB-813804, SP71-6949 e SP79-1011 e menores em RB-72454 e SP78-4764. Em relação a Pratylenchus sp., observou-se que RB-763710, RB-813804 e SP79-1011 apresentaram as maiores densidades de Pratylenchus sp., enquantoRB-72454, SP71-6949 e SP78-4764 as menores. Os menores rendimentos agrícolas ocorreram em RB-813804,que apresentou altos índices populacionais dos dois gêneros de nematoides.Palavras-chaves: Saccharum spp. tabuleiros costeiros, nematoide-das-lesões, nematoide-das-galhas.

Summary - Chaves, A., S.R.V.L. Maranhão, E.M.R. Pedrosa, L.M.P. Guimarães & M.K.R. dos S. Oliveira.Incidence of Meloidogyne spp. and Pratylenchus sp. on sugarcane in Pernambuco state, Brazil.

The present research had as objective to evaluate the plant parasitic nematode density on the followingsugarcane varieties: RB-873710, RB-72454, RB-784764, RB-813804, SP71-6949, SP79-1011 and SP78-4764,cultivated in the north coastline of Pernambuco state. The nematodes Meloidogyne spp. and Pratylenchus sp. werefound parasitizing all varieties evaluated, with the highest densities of the root-knot nematodes in RB-813804,SP71-6949 and SP79-1011, and the lowest in RB-72454 and SP78-4764. The highest density of Pratylenchus sp.occurred in RB-763710, RB-813804 and SP79-1011, in contrast with RB-72454, SP71-6949 and SP78-4764,which presented the lowest densities. In addition to presenting high population density of both nematodes,RB-813804 showed the lowest agricultural performance.Key words: Saccharum spp., coastal trails, lesion nematode, root-knot nematode.

COMUNICAÇÃO

ConteúdoAssociado às estiagens, que impõem condição de

estresse à cana-de-açúcar, o acúmulo de problemasfitossanitários, em particular as fitonematoses,contribuem de forma significativa para uma baixaprodutividade agrícola na Região Nordeste (FerreiraLima, 2000). Estes organismos vêm assumindo papelde destaque, devido às limitações das técnicas de

controle em diminuir de forma drástica e prolongadaas populações em áreas infestadas, ocasionando perdaselevadas (Barros et al., 2002; Chaves et al., 2002).

Nematoides danificam o sistema radicular dasplantas, comprometendo a absorção de água enutrientes e consequentemente o seu desenvolvimento,além de inviabilizar a utilização de áreas para novoscultivos, tornando assim antieconômica a exploração


279

Incidência de Meloidogyne spp. e Pratylenchus sp. em Cana-de-açúcar no Estado de Pernambuco, Brasil

1011 e RB-813804. As amostragens foram conduzidasem tabuleiros costeiros e em socarias, coletadas a partirde amostragem composta nos locais e enviadas aoLaboratório de Fitonematologia da EstaçãoExperimental de Cana-de-açúcar do Carpina(EECAC-UFRPE), procedendo-se à extração denematoides pela metodologia de Jenkins (1964) eBarker (1985), utilizando-se 20 g de raiz e 300 cm3 desolo. A identificação dos nematoides foi realizada emlâminas de Peters, sob microscópio óptico. Dadosdas estimativas populacionais dos nematoides e deprodutividade das áreas foram estatisticamentetestados pela análise da variância, utilizando-se o testede Duncan para comparação das médias. Os dadosdas estimativas populacionais dos nematoides paraanálise estatística foram transformados para log10 (x+ 1).

Em todas as variedades amostradas foramencontrados nematoides dos gêneros Meloidogyne ePratylenchus. Resultados semelhantes foram obtidosatravés de levantamento realizado por Moura et al.(2000) em campos de cana-de-açúcar nos estados doRio Grande do Norte, Paraíba, Pernambuco eAlagoas, através da análise de 1.097 amostras,demonstrando a prevalência destas fitonematoses noNordeste. Observou-se que as maiores densidadesde Meloidogyne spp. ocorreram em RB-813804, SP71-6949 e SP79-1011 e as menores densidadespopulacionais foram verificadas na RB-72454, massem diferenças estatísticas (Tabela 1). Esses resultadosdiscordam de Barros et al. (2005), que estudandointeração entre nematicidas e variedades comerciaisno Nordeste observaram baixos índices

de certas culturas em determinadas áreas (Dinardo-Miranda & Menegatti, 2003).

Dinardo-Miranda & Ferraz (1991) quantificaramos danos causados por P. zeae em cana-de-açúcar eobtiveram até 52,4 % em variedades susceptíveis. Navariedade SP71-1406 aos seis meses de idade,densidades populacionais de 2.700 P. zeae por 50 g deraiz foram responsáveis pela quebra de 35 % daprodução.

Níveis de danos de Meloidogyne spp. em cana-de-açúcar são pouco estudados. De acordo comNovaretti (1997), níveis maiores que 400 juvenis por50g de raízes indicam alta densidade populacional,justificando neste caso a adoção de medidas decontrole. Em relação a P. zeae, Dinardo-Miranda et al.(1996) consideram que 2.500 espécimes por 50 g deraízes causam reduções de produtividade emvariedades susceptíveis, a exemplo de RB-813804, queapresentou susceptibilidade a Meloidogyne spp. e P. zeaeem condições de campo (Chaves et al., 2002).

Dessa forma, este estudo teve como objetivomonitorar densidades populacionais de nematoidesdos gêneros Pratylenchus e Meloidogyne em tabuleiroscosteiros do litoral norte de Pernambuco emvariedades comerciais, para se conhecer a necessidadede utilização de sistema de manejo integrado nessaárea produtora.

Levantamentos foram realizados no período dejulho a setembro de 2005 em dezoito lotes da UsinaSanta Teresa (270 amostras) e em dezessete lotes daUsina São José (255 amostras), totalizando 525amostras. As variedades amostradas foram: RB-873710, RB-72454, SP71-6949, RB-784764, SP79-

Tabela 1 - População de Meloidogyne spp. e Pratylenchus zeae em 20 g de raiz e 300 cm3 em socaria por ocasião da colheita eprodutividade agrícola.

1Dados transformados em log10 (x + 1) para análise estatística.Médias seguidas por mesma letra minúscula na coluna não diferem estatisticamente ao nível de 5 % de probabilidade pelo teste de Duncan

Variedade Meloidogyne spp. Pratylenchus sp. ProdutividadeRaiz1 Solo1 Raiz1 Solo1 (t / ha)

RB-72454 150 a 60 a 860 a 90 a 66,79 aRB-763710 254 a 120 a 1.169 a 90 a 66,36 aRB-813804 1139 a 90 a 1.286 a 60 a 50,53 bSP71-6949 1176 a 90 a 622 a 30 a 62,30 aSP78-4764 116 a 0 a 732 a 30 a 56,08 abSP79-1011 978 a 60 a 1.299 a 120 a 54,38 abC.V. (%) 34,0 34,0 31,0 31,0 14,0

280 Vol. 33(4) - 2009

Andréa Chaves, Sandra R.V.L. Maranhão, Elvira M.R. Pedrosa, Lílian M.P. Guimarães, & Misterlaine K.R. dos S. Oliveira

populacionais deste endoparasito em RB-813804 ealtos índices em RB-72454 aos 12 meses de idade.Pereira & Novaretti (2002) classificaram a variedadeSP79-1011 como má hospedeira a M. incognita eafirmaram que a tentativa de classificar ocomportamento de genótipos de cana-de-açúcar emrelação aos nematoides estudados pode incorrer emerros, uma vez que são comuns as ocorrênciasconjuntas de gêneros nas áreas amostradas. De acordocom Ferris & Ferris (1974), a interação entre osmesmos pode ocasionar alterações, interferindo nocomportamento destes fitoparasitos.

Populações de Pratylenchus sp. foram encontradasacima do nível de dano em RB-763710, RB-813804e SP79-1011. Menores médias foram alcançadas porRB-72454, SP71-6949 e SP78-4764 e menores emRB-763710. Resultados obtidos por Chaves et al.(2002) foram semelhantes aos resultados oraapresentados em relação à variedade RB-813804, quetambém apresentou-se como susceptível a estenematoide. Encontrou-se Pratylenchus sp. em elevadadensidade populacional na maioria das variedadesestudadas. Apenas RB-716949 apresentou densidadepopulacional maior de Meloidogyne spp. As populaçõesdos dois endoparasitos foram baixas no solo (Tabela1).

Menores rendimentos agrícolas ocorreram emRB-813804, que apresentou altos índices populacionaisdos nematoides estudados. Segundo Maranhão (2008),a despeito dos dois parasitos descreverem função decrescimento populacional semelhante, aquela descritapor Meloidogyne spp. + Pratylenchus sp. na raiz retrata oefeito aditivo dos parasitos.

A época de amostragem (julho a setembro) foiquando as precipitações pluviométricas médias nolitoral norte de Pernambuco são maiores e devem terbeneficiado o desenvolvimento dos nematoides.

Literatura CitadaBARKER, K.R. 1985. Sampling nematodes communities.

In: BARKER, K.R., C.C. CARTER & J.N. SASSER(ed). An Advanced Treatise on Meloidogyne, Vol.II,Methodology. North Carolina State University Graphics,Raleigh (NC) EUA, p. 3-17.

BARROS, A.C.B., R.M. MOURA & E.M.R. PEDROSA.2002. Efeito da aplicação de terbufos nas populações detrês nematóides ectoparasitos em cana-de-açúcar.

Fitopatologia Brasileira, 27: 309-311.BARROS, A.C.B., R.M. MOURA & E.M.R. PEDROSA.

2005. Estudo de interação variedade-nematicida em cana-de-açúcar, em solo naturalmente infestado porMeloidogyne incognita, M. javanica e Pratylenchus zeae.Nematologia Brasileira, 29 (1): 39-46.

CHAVES, A., E.M.R. PEDROSA & R.M. MOURA. 2002.Efeitos da aplicação de terbufós sobre a densidadepopulacional de nematóides endoparasitos em 5variedades de cana-de-açúcar no Nordeste. NematologiaBrasileira, 26 (2):167-176.

DINARDO-MIRANDA, L.L. & C.C. MENEGATTI. 2003.Danos causados por nematóides a variedades de cana-de-açúcar em cana planta. Nematologia Brasileira, 27 (1):69-73.

DINARDO-MIRANDA, L.L. & L.C.C.B. FERRAZ. 1991.Patogenicidade de Pratylenchus brachyurus e Pratylenchuszeae a duas variedades de cana-de-açúcar (Saccharum sp.).Nematologia Brasileira, 15 (1): 9-16.

DINARDO-MIRANDA, L.L., J.L. MORELLI, M.G.A.LANDELL & M.A. SILVA. 1996. Comportamento degenótipos de cana-de-açúcar em relação a Pratylenchuszeae. Nematologia Brasileira, 20: 52-58.

FERREIRA LIMA, R. 2000. Influência do nematicidaTerbufos na flutuação populacional de nematóides eparâmetros produtivos de duas variedades de cana-de-açúcar (Saccharum spp.). Sociedade dos TécnicosAçucareiros e Alcooleiros do Brasil, 19 (2):36-39.

FERRIS, V.R. & J.M. FERRIS. 1974. Inter-relationshipsbetween nematode and plant communities inagricultural ecosystems. Agro-Ecosystems, 1: 275-299.

JENKINS, W.R. 1964. A rapid centrifugal-flotation techniquefor separating nematodes from soil. Plant DiseaseReporter, 48: 692.

MARANHÃO, S.R.V.L. 2008. Comunidade, dinâmicapopulacional e variabilidade espacial de nematóides emáreas de cultivo da cana-de-açúcar sob diferentescondições edafoclimáticas (Tese de Doutorado).Universidade Federal Rural de Pernambuco, Recife, 126p.

MOURA, R.M., E.M.R. PEDROSA, S.R.V.L. MARANHÃO,M.E.A. MACEDO, A.M. MOURA, E.G. SILVA & R.F.LIMA. 2000. Ocorrência dos nematóides Pratylenchuszeae e Meloidogyne spp. em cana-de-açúcar no Nordestedo Brasil. Fitopatologia Brasileira, 25: 101-103.

NOVARETTI, W.R.T. 1997. Controle de Meloidogyne incognitae Pratylenchus zeae (Nemata: Tylenchoidea) em cana-de-açúcar com nematicidas, associados ou não à matériaorgânica. (Tese de Doutorado). Escola Superior deAgricultura Luiz de Queiroz – Universidade de SãoPaulo, Piracicaba, 51 p.

PEREIRA, E.D.M.G. & W.R.T. NOVARETTI. 2002. Reaçãode variedades de cana-de-açúcar, cultivadas no Estadode Pernambuco ao tratamento com Aldicarb 150G emáreas infestadas com nematóides. In: CONGRESSONACIONAL DA STAB,VII, Recife. Anais, p. 3-6.


281

Flutuação Populacional de Nematoides em Bananais de Minas Gerais e Bahia (Anos 2003 a 2008)

Flutuação Populacional de Nematoides em Bananais de Minas Gerais eBahia (Anos 2003 a 2008)

Wânia S. Neves, Mario S.C. Dias* & João G. Barbosa

Empresa de Pesquisa Agropecuária de Minas Gerais (EPAMIG) – Unidade Regional Norte de Minas. Rodovia MGT 122km 155, 39525-000 Nova Porteirinha (MG) Brasil

*Autor para correspondência: [email protected]

Recebido para publicação em 29 / 09 / 2009. Aceito em 03 / 11 / 2009Editado por Mário Inomoto

Resumo - Neves W.S., M.S.C. Dias & J.G. Barbosa. 2009. Flutuação populacional de nematoides em bananaisde Minas Gerais e Bahia (anos 2003 a 2008).

O Brasil é um grande produtor de frutas, sendo a bananeira (Musa spp.) a segunda frutífera mais plantadano país. Entretanto, há baixo rendimento produtivo da cultura devido a práticas inadequadas de manejo,ataque de pragas e à ocorrência de doenças. Dentre os fitopatógenos que causam grandes danos à cultura,estão os fitonematoides, que, além dos danos diretos em decorrência do seu ataque, provocam também aredução da produtividade da cultura, com influência no custo final de produção. Várias espécies de nematoidesforam relatadas, sendo Meloidogyne sp., Radopholus similis, Helicotylenchus multicinctus, Pratylenchus coffeae e Rotylenchulusreniformis as mais frequentes na bananicultura. O presente trabalho teve como objetivo identificar a presença eavaliar os níveis de infestação dos nematoides na cultura da bananeira em municípios dos estados de MinasGerais e Bahia, no período de janeiro de 2003 a agosto de 2008. Foram analisadas 3.120 amostras de solo e deraízes, provenientes de 31 municípios, e constatou-se a presença dos cinco táxons citados anteriormente emtodos os municípios, havendo um aumento considerável da densidade ao longo dos anos do estudo.Palavras chaves: Musa spp., nematoides, população.

Abstract - Neves W.S., M.S.C. Dias & J.G. Barbosa. 2009. Population fluctuation of nematodes in soils grownwith banana plantations in the states of Minas Gerais and Bahia from 2003 to 2008.

Brazil is a great fruit producer and banana (Musa spp.) is the second fruit crop most planted in the country.Nevertheless, there is a low yield of the culture due to inadequate management practices, pest attack andoccurrence of diseases. Amongst the phytopathogens that cause great damage to the culture are thephytonematodes, which, besides the direct damage to the plant in consequence of their attack, also decreasethe productivity of the crop, therefore interfering in the final cost of production. Several nematode speciesoccur in banana and the most frequent are Meloidogyne sp., Radopholus similis, Helicotylenchus multicinctus, Pratylenchuscoffeae and Rotylenchulus reniformis. This work aimed to identify the presence and to evaluate the levels of nematodeinfestation in banana plantations, in 31 municipalities from Minas Gerais and Bahia states, in the period ofJanuary 2003 to August 2008, analyzing 3,120 soil and roots samples. The five nematode species cited occurredin all municipalities and the nematode densities increased along the years of the survey.Key words: Musa sp., nematodes, population.

COMUNICAÇÃO

ConteúdoO Brasil destaca-se como grande produtor de

frutas, sendo a bananeira (Musa spp.) a segunda frutíferamais plantada no país.O Brasil é o segundo maior

produtor mundial de banana, com 504 mil hacultivados e 7 milhões de toneladas de frutasproduzidas em 2006, resultando em um rendimentomédio de 14,1 t / ha (FAO, 2006). A bananeira

282 Vol. 33(4) - 2009

Wânia S. Neves, Mario S.C. Dias & João G. Barbosa

nematoides associados à cultura da bananeira emmunicípios produtores de banana da Bahia e do nortede Minas Gerais, no período de 2003 a 2008, assimcomo avaliar os níveis de infestação dos nematoidesmais importantes para a cultura.

No período de janeiro de 2003 a agosto de 2008,foram analisadas 3.120 amostras de solo e de raízesprovenientes de campo de produção de banana. Asanálises foram realizadas no laboratório deFitopatologia da Empresa de Pesquisa Agropecuáriade Minas Gerais (EPAMIG) – Unidade RegionalNorte de Minas, situado na Fazenda experimental doGorutuba, no município de Nova Porteirinha. Asamostras foram provenientes de 23 municípiosprodutores de banana da região norte de Minas Geraise oito municípios do estado da Bahia. Os municípiosestudados no norte de Minas foram Bocaiúva,Buritizeiro, Capitão Enéas, Espinosa, Francisco Sá,Ibiaí, Itacarambi, Jaíba, Janaúba, Januária, Joaíma,Manga, Matias Cardoso, Mato Verde, Monte Azul,Montes Claros, Nova Porteirinha, Pedras de Mariada Cruz, Pirapora, Porteirinha, Salinas, São Franciscoe Verdelândia. No estado da Bahia foram coletadasamostras nos municípios de Barreiras, Bom Jesus daLapa, Carinhanha, Guanambi, Luís EduardoMagalhães, Santana, Urandi e Wagner.

Foram coletadas dez subamostras de solo e raízespor hectare, que foram misturadas obtendo-se umaamostra composta de 500 gramas de solo e umaporção de raízes. De cada amostra composta foramutilizados 200 cm3 de solo e 20 gramas de raízes. Paraa extração dos nematoides do solo foi utilizado ométodo de flutuação centrífuga em solução desacarose (Jenkins, 1964). As raízes foram cortadas comtesoura, em pedaços de 1-3 cm, misturadas e separadasem amostras de 20 gramas cada. Cada amostra foisubmetida à trituração, peneiramento e centrifugaçãoconforme a metodologia de Coolen e D’Herde(1972).

Tanto para amostras do solo quanto para de raízes,realizou-se a quantificação e identificação até gêneroem câmara de Peters (1 ml ), sob microscópio ótico.Foram realizadas três contagens por amostra,obtendo-se a média final entre as contagens. Ao finalda contagem multiplicou-se a média do resultadoobtido pelo volume líquido total obtido após extração

encontra-se presente na grande maioria dos municípiosbrasileiros e os estados de São Paulo, Bahia, Pará, SantaCatarina, Minas Gerais, Pernambuco e Ceará são osprincipais produtores (IBGE, 2007). A região nortede Minas Gerais, juntamente com algumas da Bahia,vem ocupando lugar de destaque no cenário nacionalde produção de banana, sendo atualmente a terceiramaior região produtora da fruta no país. Embora oBrasil desfrute o status de grande produtor mundial,seus índices de produtividade são baixos (Rodrigues,2008). O baixo rendimento é devido principalmentea práticas inadequadas de manejo, ao ataque de pragase à ocorrência de doenças, que reduzem a capacidadeprodutiva e a viabilidade da cultura.

Entre os principais patógenos da banana,destacam-se os fungos Fusarium oxysporum f.sp. cubense- causador do mal-do-Panamá, Mycosphaerella fijiensis eM. musicola - que causam as manchas foliares deSigatoka, e os fitonematoides. Os nematoidesMeloidogyne sp., Radopholus similis, Helicotylenchusmulticinctus, Pratylenchus coffeae e Rotylenchulus reniformis sãoos mais frequentes na bananicultura brasileira e mundial(Carlier et al., 2003). Em plantações comerciais debanana, o ataque de nematoides pode ocasionarperdas de produção de 10 a 50 % (Davide, 1996),existindo relatos no Brasil de perdas de 100 % (Zem,1982). As perdas médias mundiais estimadas devidoao ataque de nematoides na bananeira são de 19,7 %,o que equivale a US$ 178 milhões por ano (Sasser,1989). Em geral os danos de fitonematoides aosbananais são diretamente proporcionais às suaspopulações, ocorrendo redução do tamanho, massae atraso na maturação dos cachos, menorperfilhamento e morte das plantas (Borges & Souza,2004).

Dados obtidos por meio de levantamentospopulacionais são úteis na identificação dos nematoidesassociados às culturas e determinação da distribuiçãonuma dada localidade, o que possibilita o início deestudos a respeito da biologia, ecologia e de métodosde controle de nematoides. O estudo de taisinformações é importante para a adoção de medidasde controle antes que os patógenos atinjam o nível dedano econômico.

Diante do exposto, o presente trabalho teve comoobjetivo identificar a presença dos táxons de


283


de cada amostra para obter a densidade populacionalem 200 cm3 de solo e em 20 g de raízes.

A identificação dos gêneros foi realizada comauxílio da chave de Mai e Mullin (1996). Os dadosobtidos nas análises nematológicas foramarmazenados em planilhas de dados, utilizando-se oprograma MS Excel e analisados segundo o métodoapresentado por Barker (1985), para caracterizaçãode nematoides e quantificação da sua densidadepopulacional.

Foi constatado em todas as cidades avaliadas, tantono norte de Minas Gerais quanto na Bahia, a presençade Meloidogyne spp., Pratylenchus spp., Radopholus similis,Rotylenchulus reniformis e Helicotylenchus multicinctus, quesão os nematoides mais importantes para a cultura dabanana. Tal resultado corrobora as observaçõesCavalcante et al. (2005) sobre a infestação simultâneade diferentes gêneros de nematoides em diferentesgenótipos de bananeira em Rio Branco, no estado doAcre. Pereira (2006), em um trabalho realizado paraidentificação de nematoides associados à bananeirano leste do Paraná, também encontrou populações

mistas em amostras de solos de diversos municípiosdo estado.

A partir dos dados obtidos nas análises de solo, épossível constatar que houve aumento considerável,ao longo dos anos, na densidade populacional detodos os nematoides, nas áreas de cultivo de bananaavaliadas (Figura 1).

O nematoide R. reniformis foi o que alcançoumaiores densidades no solo, ao longo dos anos deavaliação (Figura 1). Entre 2003 e 2008, a populaçãode R. reniformis aumentou aproximadamente quatrovezes, o que é muito preocupante devido aos possíveisdanos que podem ser causados. Os presentesresultados diferem dos obtidos em outras regiões dopaís, como por exemplo no leste do Paraná, ondePereira (2006) identificou H. multicinctus como onematoide com maior densidade populacional nossolos cultivados com bananeira. Essa diferença podeser explicada devido à influência de fatores comotemperatura, umidade, plantas hospedeiras, tipo e usodo solo, intensidade e variabilidade do inóculo inicial(Zem, 1982). O resultado encontrado é um alerta aos

Figura 1 - Densidade populacional média anual dos principais nematoides da bananicultura da Bahia e norte de Minas Gerais em200 cm3 de solo.

nem

atói

des

por

ccd

eso

lo

1800

1600

1400

1200

1000

800

600

400

200

02003 2004 2005 2006 2007 2008

Meloidogyne spp.Helicotylenchus spp.Pratylenchus spp.Radopholus similisRotylenchulus reniformis

284 Vol. 33(4) - 2009

Wânia S. Neves, Mario S.C. Dias & João G. Barbosa

agricultores das regiões avaliadas, pois como talnematoide causa sérios problemas em outras culturas.Essa espécie de nematoide está amplamentedisseminada nas regiões tropicais e subtropicais (Starr,1998), sendo uma espécie polífaga tambémencontrada infestando raízes de abacaxizeiro, cafeeiro,mamoneira, maracujazeiro, soja, tomateiro e emespecial algodoeiro (Lordello, 1981). Esse aumentono solo ano após ano, mesmo sem que sejamdetectados sintomas de parte aérea, pode fazer comque em determinado ponto a população do nematoideatinja um número tal que cause grandes prejuízos àcultura da banana.

Outro nematoide que merece destaque é onematoide cavernícola (R. similis). Esse nematoidetambém apresentou aumento na densidadepopulacional nas áreas avaliadas durante o períodoestudado (Figuras 1 e 2), o que serve de alerta, devidoaos danos que reconhecidamente esse nematoide podecausar à cultura da banana. Como exemplo, Jaehn etal. (1991) realizaram um trabalho em que observaramredução de produção que chegou a 215 %.

Embora os nematoides do gênero Meloidogynesejam considerados muitas vezes pelos agricultoresde importância secundária, podem causar declínio de

produção. Conforme as Figuras 1 e 2, Meloidogyne spp.apresentaram aumento no período de 2003 a 2008.

De modo geral, a população de nematoides nasraízes das bananeiras foi até dez vezes mais elevadaque no solo (Figuras 1 e 2). Segundo Gowen &Quénéhervé (1990), esse evento é decorrente do modode vida endoparasita dos nematoides da bananeira.

AgradecimentosÀ Fundação de Amparo a Pesquisa de Minas

Gerais (FAPEMIG) pela concessão da bolsa.

Literatura CitadaBARKER, K.R. 1985. Sampling nematode communities.

In: BARKER, K.R., CARTER, C.C. & J.N. SASSER(ed). An Advanced Treatise on Meloidogyne. v.2.Methodology. North Carolina State University Graphics,Raleigh, p. 3-17.

BORGES, A.L. & L.S. SOUZA. 2004. O Cultivo daBananeira. Embrapa Mandioca e Fruticultura, Cruz dasAlmas, 279 p.

CARLIER, J., D. DeWAELE & J.V. ESCALANT. 2003.Global evaluation of Musa germplasm for resistance toFusarium wilt, Mycosphaerella leaf spot diseases andnematodes. Performance evaluation (A. Vézina and C.Picq, eds). INIBAP Technical Guidelines 7, Montpellier- France.

CAVALCANTE, M.J.B., R.D. SHARMA & J.H. CARES.

Figura 2 - Densidade populacional média anual dos principais nematoides da bananicultura na Bahia e no norte de Minas Gerais em20 gramas de raízes de plantas de bananas.

nem

atói

des

por

gd

era

ízes

9000

8000

7000

6000

5000

4000

3000

2000

1000

02003 2004 2005 2006 2007 2008

Meloidogyne spp.Helicotylenchus spp.Pratylenchus spp.Radopholus similisRotylenchulus reniformis


285


2005. Nematoides associados a genótipos de bananeiraem Rio Branco. Nematologia Brasileira, Brasília, 29 (1):91-94.

COOLEN, W.A. & C.J. D’HERDE. 1972. A Method for theQuantitative Extraction of Nematodes from PlantTissue. State Nematology and Entomology ResearchStation, Ghent, 77 p.

DAVIDE, R.G. 1996. Overview of nematodes as limitingfactor in Musa production. In: FRISON, E.A., J.P.HORRY & D. DeWAELE (ed). New frontiers inresistance breeding for nematode, fusarium and sigatoka.INIBAP, Montpellier – France, p. 27-31.

FAO - Food and Agriculture Organization of the UnitedNations. 2006. FaoStat. <http://faostat.fao.org/site/567/DesktopDefault.aspx?PageID=567> acesso em 19de agosto de 2008.

GOWEN, S. & P. QUÉNÉHERVÉ. 1990. Nematodesparasites of bananas, plantains and abaca. In: LUC, M.,SIKORA, R. A., BRIDGE, J. (ed). Plant ParasiticNematodes in Subtropical and Tropical Agriculture. CABInternational, Wallingford - UK, p. 431-460.

IBGE - Instituto Brasileiro de Geografia e Estatística. 2004.Produção Agrícola Municipal, Culturas Temporárias ePermanentes, vol. 31. <http://www.ibge.gov.br/home/estatistica/economia/pam/2004> acesso em 16de março de 2009.

JAEHN, A., J.A.C. NAVARRO & R.A. LESSI. 1991. Uso denematicidas na renovação da bananeira em área infestadapor Radopholus similis. In: CONGRESSO BRASILEIRODE NEMATOLOGIA, XV, Botucatu. p. 20.

JENKINS, W.R. A rapid centrifugal-flotation technique forseparating nematodes from soil. Plant Disease Reporter,48: 692. 1964

LORDELLO, L.G.E. 1981. Nematóides das PlantasCultivadas. Nobel, São Paulo, 314 p.

MAI, W.F. & P.G. MULLIN. 1996. Plant-parasitic Nematodes:A Pictorial Key to Genera. Cornell University Press, Ithaca– EUA, 277 p.

PEREIRA, A.M. 2006. Nematoides associados à cultura dabananeira na região norte do Paraná. (Tese de Mestrado).Universidade Federal do Paraná, 121 p.

RODRIGUES, M.G.V. de. 2008. Aspectos socioeconômicosda bananicultura. In: RODRIGUES, M.G.V., M.S.C.DIAS & D.D. PACHECO (ed) Informe Agropecuário:Bananicultura Irrigada - Inovações Tecnológicas.EPAMIG, Belo Horizonte, p. 8-12.

SASSER, J.N. 1989. Plant Parasitic Nematodes: The Farmer’sHidden Enemy. Department of Plant Pathology /Consortium for International Crop Protection. 114 p.

STARR, J. L. 1988. Cotton. In: BARKER, K.R., G.A.PEDERSON & G.L. WINDHAM (ed). Plant andNematode Interactions. American Society of Agronomy,Madison - EUA, p. 359-380.

ZEM, A.C. 1982. Problemas nematológicos em bananeiras(Musa spp.) no Brasil - contribuição ao seu conhecimentoe controle. (Tese de Doutorado). Escola Superior deAgricultura Luiz de Queiroz - Universidade de SãoPaulo, Piracicaba (SP), 140 p.

286 Vol. 33(4) - 2009

XXVIII Congresso Brasileiro de Nematologia | II Congresso Internacional de Nematologia TropicalRESUMOS

XXVIII Congresso Brasileiro de NematologiaII Congresso Internacional de Nematologia Tropical

O II Congresso Internacional de NematologiaTropical (CINT) foi organizado pelo Centro deCiências Agrárias/Universidade Federal de Alagoas(CECA/UFAL) e Embrapa Recursos Genéticos eBiotecnologia, em parceria com entidades oficiais eprivadas, tendo como organizadoras a Profa. Dra.Maria de Fátima Muniz e a Dra.Regina Maria DechechiGomes Carneiro. O evento foi realizado no Hotel RitzLagoa da Anta, em Maceió (AL), no período de 4 a 9de outubro de 2009 e contou com 322 participantes.

A abertura oficial do II CINT contou com aparticipação de representantes das instituiçõespromotora e organizadora, palestrantes econgressistas. A mesa diretiva foi composta pela reitorada UFAL - Profa. Dra. Ana Dayse Rezende Dorea, oassessor de cooperação internacional da UFAL - Prof.Dr. José Niraldo de Farias, o coordenador técnico daEmbrapa AL - Dr. Antônio Dias Santiago, a presidenteda Organization of Nematologists of TropicalAmerica (ONTA) - Dra Rosa Manzanilla, a vice-presidente da ONTA - Dra Patricia Stock, a presidenteda Sociedade Brasileira de Nematologia (SBN) - Dra.Regina Maria Dechechi Gomes Carneiro, a vice-presidente da SBN e organizadora do evento - Profa.Dra. Maria de Fátima Silva Muniz, e o vice-diretor daUA-CECA/UFAL - Prof. Dr. Ivanildo Soares de Lima.

A programação do evento incluiu 32 mesasredondas com 132 apresentações orais, em que foramabordados vários aspectos de importantes espécies denematoides fitoparasitas, tais como Meloidogyne spp.,Nacobbus aberrans, Heterodera glycines, Globodera spp.,Rotylenchulus reniformis, Radopholus similis, Pratylenchus spp.e Scutellonema bradys, em culturas agrícolas, incluindodiferentes estratégias de manejo. Novos métodosdiagnósticos, baseados em análise molecular,taxonomia de fitonematóides, nematoidesentomopatogênicos, zooparasitas e marinhos, einterações entre fitonematóides e outros patógenoshabitantes do solo também foram discutidos, dentreoutros temas relevantes. Foram apresentados 302trabalhos científicos na forma de pôster, relacionados

ao desenvolvimento científico e à geração de novastecnologias na área de Nematologia. O evento tambémofereceu um dia de campo na Usina Coruripe emAlagoas. Durante a Assembéia da SBN foi eleita a novadiretoria da entidade.

No encerramento do evento foram premiados pelaSBN os melhores trabalhos de pesquisa apresentados naforma de pôsteres pelos estudantes de graduação (PrêmioAnário Jahen) e de pós-graduação (Prêmio DimitriTihohod). Os trabalhos premiados foram:

Prêmio Anário Jaehn (graduação):1º. lugar: Anmyna Soraia de Oliveira (Univag, VárzeaGrande, MT) - Efeito de densidades populacionaisde Meloidogyne javanica sobre plantas de Tectona grandis.Orientadora: Rosângela Aparecida da Silva.2º. lugar: Marcilene Fernandes Santos (EmbrapaRecursos Genéticos e Biotecnologia, Brasília, DF) –Identification and genetic variability of Meloidogynemayaguensis isolates by the analysis of molecularmarkers. Orientadora: Regina Gomes Carneiro.3º. lugar: Viviane Aparecida Costa Campos(Universidade Federal de Lavras, Lavras, MG) - Effectof Meloidogyne incognita on the metabolite productionby soya and tomato plants resistant and susceptibleto plant-parasitic nematodes. Orientador: Denílson F.Oliveira.

Prêmio Dimitry Tihohod (pós-graduação)1º. lugar: Luciany Favoreto (Faculdade de CiênciasAgrárias e Veterinárias, Universidade Estadual Paulista,Jaboticabal, SP) - Taxonomy study of phytonematodesin seeds of forage grasses, host-pathogen interactionsand associated fungi. Orientador: Jaime Maia dosSantos.2º. Lugar: Bruno Flávio Figueiredo Barbosa(Faculdade de Ciências Agrárias e Veterinárias,Universidade Estadual Paulista, Jaboticabal, SP) -Comparative agressiveness of Pratylenchus brachyurusand P. zeae to sugarcane in pot at open area.Orientador: Jaime Maia dos Santos.


Maceió (AL) de 4 a 9 de outubro de 2009

287

3o. Lugar: Alan Machado Almeida (UniversidadeEstadual do Norte Fluminense, Campos dosGoytacazes, RJ) – Efeito de diferentes fontes dematéria orgânica incorporadas ao solo sobreMeloidogyne mayaguensis em casa-de-vegetação.Orientador: Ricardo Moreira de Souza.

O evento contou com a importante parceria dosseguintes órgãos governamentais e empresas privadas,que possibilitaram o grande sucesso alcançado noevento, aos quais manifestamos o nossoagradecimento: Conselho Nacional deDesenvolvimento Científico e Tecnológico (CNPq),Ministério da Ciência e Tecnologia (MCT),Financiadora de Estudos e Projetos (FINEP),Coordenação de Aperfeiçoamento de Pessoal de NívelSuperior (CAPES), Fundação de Amparo à Pesquisa

do Estado de Alagoas (FAPEAL), Serviço Brasileirode Apoio às Micro e Pequenas Empresas (SEBRAE-AL), Fundação de Apoio à Pesquisa Agrícola(FUNDAG), FMC Corporation, Syngenta CropProtection, Syntech Research do Brasil Ltda, UsinaCoruripe-AL, Associação dos Plantadores de Cana doEstado de Alagoas (ASPLANA) e Semear Comércioe Representações Ltda.

Agradecemos o apoio recebido da SBN e daONTA e a todos que participaram do evento. Nosreencontraremos em 2011, em Brasília, para o XXIXCongresso Brasileiro de Nematologia. Até breve!

Profa. Dra. Maria de Fátima S. Muniz e Dra. ReginaMaria D. G. Carneiro, organizadoras do evento

288 Vol. 33(4) - 2009

XXVIII Congresso Brasileiro de Nematologia | II Congresso Internacional de Nematologia Tropical

1 – MARINE NEMATODE TAXONOMY IN THE DNA AGE: THE PRESENT AND FUTURE OFMOLECULAR TOOLS TO ASSESS THEIR BIODIVERSITY [TAXONOMIA DE NEMATÓIDES MARINHOSNA ERA DO DNA: PRESENTE E FUTURO DE FERRAMENTAS MOLECULARES PARA ACESSAR ABIODIVERSIDADE] Silva, N.R.R.1, 2,3,4; Neres, P.F.3; Genevois, V.G.F.3; Esteves, A.M.3; De Ley, P.5; Decraemer, W.6,7;Rieger, T.T.2; Santos, M.T.C.1 1Biochemistry Department; 2Genetics Department; 3Zoology Department, UniversidadeFederal de Pernambuco, Av. Prof. Moraes Rêgo, s/n, Cidade Universitária, Recife, PE, Brazil; 4Instituto Federal do RioGrande do Norte, Campus Zona Norte, Rua Brusque 2926, Potengi, Natal, RN, Brazil; 5Department of Nematology,University of California, Riverside, CA 92521, USA; 6Department of Biology, Ghent University, Ledeganckstraat 35 B-9000, Ghent, Belgium; 7Royal Belgian Institute of Natural Sciences, Vautierstraat 29 B-1000 Brussels, Belgium. E-mail:[email protected]; [email protected]

Molecular taxonomy is one of the most promising yetchallenging fields of biology. Concepts of DNA barcodingand integrative taxonomy are discussed in this review.Molecular markers such as nuclear genes and mitochondrialgenes are being used in a variety of studies surveying marinenematode taxa. Sequences from more than 600 species havebeen deposited to date in online databases. Morphology-based surveys are greatly limited in processing speed, whilebarcoding approaches for nematodes are hampered by

difficulties in matching sequence data with traditionaltaxonomy. DNA barcoding is a promising approach becausesome genes have been consistently conserved duringevolution and therefore there are variable regions in thegene that can be used to discriminate species boundaries,to discover cryptic species, to quantify biodiversity and toanalyze phylogeny. We advocate a combination of DNAbarcoding and conventional taxonomy as a necessary stepin the application of a concept of integrative taxonomy.

In Mexico, an Aphelenchoides species is causing damage ingarlic (Allium sativum L.), a crop that is destined primarilyfor export to the US and Europe. There are, however, noreports that this nematode could affect vegetables. Molecularmarkers like 18S and ITS1 have been widely used fordiscrimination and identification of species of nematodes,but there are few available molecular sequences in publicdatabases of Aphelenchoides species to permit comparisonsin order to conduct a comprehensive phylogenetic analysis.In this study we used the 18S and ITS1 genes to explore thephylogenetic relationship between specimens ofAphelenchoides affecting garlic in Mexico. Nematodes wereextracted from garlic plants showing yellowing and stuntsymptoms from Penjamo, Guanajuato, Mexico. Pictures andmorphometric measurements were taken from individualnematodes that were subsequently smashed and useddirectly as DNA template. Portions of 18S and ITS1 geneswere PCR amplified and sequenced using the primers18s1.2a-18sr2b and rDNA1.58S-rDNA2 respectively.

Maximum Parsimony and Bayesian mixed inferences wereperformed on 18S, ITS1, coded indels and combined datausing PAUP and MrBayes. Numerous large Aphelenchoidesspecimens were predominantly found infesting the rootsystem although there were some infesting garlic cloves.The nematode’s morphological characters were similar toA. subtenuis: females with the head slightly offset byconstriction, the oesophageal bulb is not quite so elliptical,long post-vulval uterine sac that ends at a point more orless half way between the vulva and the anus; blunt tail,somewhat flattened terminally with a small ventral mucro.Males were shorter than females, and possessed the typicalthorn shape spicules. The molecular analysis appears tosupport the morphological identification. However, only asingle ITS1 sequence of A. subtenuis was available inGeneBank. Other available Aphelenchoides sequences wereparticularly distant from the Mexican specimens. Until moredetailed taxonomic studies are available, we can onlytentatively identify this species as A. subtenuis.

Section 1 - Molecular Biology

2 – PHYLOGENETIC ANALYSIS OF FOLIAR AND BULB NEMATODE Aphelenchoides subtenuisAFFECTING GARLIC IN GUANAJUATO, MEXICO [ANÁLISE FILOGENÉTICA DOS NEMATÓIDESFOLIARES E DE BULBOS, Aphelenchoiedes subtemuis, QUE AFETAM O ALHO EM GUANAJUATO, MÉXICO] Ramirez-Suarez, A.1; Powers, T.O.1; Orti, G.2 1Plant Pathology Department, College of Agriculture and Natural Resources, 411Plant Science Hall, zip code 68583-0722 University of Nebraska-Lincoln, USA; 2School of Biological Sciences, Universityof Nebraska-Lincoln, USA. E-mail: [email protected]



289

3 – DIFFERENTIATION OF Meloidogyne spp. FROM FLORIDA USING RANDOM AMPLIFIEDPOLYMORPHIC DNA (RAPD) [DIFERENCIAÇÃO DE Meloidogyne spp. DA FLORIDA USANDO RAPD] Kaur,R.1; Brito, J. A.2; Hao, M.2; Dickson, D. W.3 1Department of Plant Pathology and Crop Physiology, Louisiana State University,Agricultural Center, Baton Rouge, LA, 70803 USA; 2Florida Dept. of Agriculture and Consumer Services, Division ofPlant Industry, P. O. Box 147100 Gainesville, FL 32614 USA; 3Entomology and Nematology Dept. University of Florida,Gainesville, FL 32611 USA. E-mail: [email protected]

Twenty-six random 10-mer primers (OPA01 to OPA20;M20, E07, J20, K07, K14, K19) were evaluated for theirpotential to differentiate 49 isolates of Meloidogyne spp. (M.arenaria, M. floridensis, M. incognita, M. javanica, M. mayaguensisand four unidentified Meloidogyne spp.[M. sp. 2-5]) collectedfrom Florida. Genomic DNA was extracted from 20females. RAPD profiles analyzed for Meloidogyne spp. showedabundant polymorphisms. The number of reproducibleamplified fragments varied from 1 to 19 per isolate, andtheir size ranged from ~150 to ~2000 bp. Overall eachprimer produced 23 to 56 polymorphic bands. Thereproducible fragments from all isolates varied from 201-623 bp and amplified bands that were polymorphic rangedfrom 80.4 to 95.1%. The RAPD analysis revealed a high

level of genetic similarities between the isolates of a samespecies of Meloidogyne (>98%). The primer OPA01 andOPA03 distinguished the M. floridensis from M. incognita, andprimers OPA02 and OPA03 produced amplified DNAbands whose size allowed the differentiation of M. arenaria,M. floridensis and M. mayaguensis from each other. Numerouspolymorphisms were found between the isolates of eachunidentified Meloidogyne sp.; however, the isolates of M. sp.3 were grouped more closely to isolates of M. javanica. ThePAUP*4.0 dendrogram deduced from the RAPD patternsshowed that clustering of isolates within a root-knotnematode species did not reflect any genetic polymorphismand it suggests a common origin for the isolates of eachMeloidogyne spp. tested.

4 – IDENTIFICATION OF SELECTED SPECIES OF Meloidogyne spp. USING ITS-RFLP AND mtDNAMARKERS [IDENTIFICAÇÃO DE ESPÉCIES SELECIONADAS DE Meloidogyne spp. USANDO OS MARCADORESITS-RFLP e mtDNA ] Kaur, R.1; Brito, J. A.2; Mendes, M. L.3; Dickson, D.W.3 1Department of Plant Pathology and CropPhysiology, Louisiana State University, Agricultural Center, Baton Rouge, LA, 70803 USA; 2Florida Dept. of Agricultureand Consumer Services, Division of Plant Industry, P. O. Box 147100 Gainesville, FL 32614 USA; 3Entomology andNematology Dept. University of Florida, Gainesville, FL 32611 USA. E-mail: [email protected]

The nominal species of root-knot nematodes (RKN) usedin this study were Meloidogyne arenaria, M. floridensis, M.mayaguensis, and four unidentified populations (M. sp. 2-5).The rDNA-ITS region from the RKNs were amplified usingthe ITS-specific primers 18S (5’ TTGATTACGTCCCTGCCCTTT 3’) and 26S (5’ TTTCACTCGCCGTTACTAAGG 3’). Each isolate of RKN yielded one majorproduct of approximately 700 bp. The amplified ITSregions were digested with nine restriction enzymes (EcoRI,RsaI, Msp I, Hind III, Alu I, Ssp I, HinfI, Dra I and Tru9I). The restriction patterns produced by enzymes AluI,Dra I, Hind III, RsaI, and Tru 9I did not distinguish any ofthe RKN species. The patterns of EcoRI digestion of M.arenaria, which consisted of two fragments of approx. 600and 200 bp, were distinct from those of the other RNKs.The Enzyme HinfI produced two fragments. One set offragments had bands with approx. 400 and 300 bp, whereasthe other set had bands of 500 and 200bp. These patternsseparated M. arenaria, M. floridensis, M. sp.3 and M. sp.5 from

M. mayaguensis, M. sp.2 and M. sp.4. The enzyme Msp I didnot separate M. arenaria, M. floridensis, M. sp.3 and M. sp.5from each other. RsaI and SspI did not restrict any of theamplified products. Amplification of mtDNA from allRKN species with primers C2F3 (5’GGTCAATGTTCAGAAATTTGTGG 3’) and MRH106(5’ AATTTCTAAAGACTTTTCTTAGT 3’) producedfragments of approx. 700 to 1800 bp. M. incognita, M. javanicaand M. sp.5 produced a PCR product ca. 1800 bp, while M.arenaria produced a smaller product ca. 1300bp. M.mayaguensis and M. sp.2 produced fragments of the samesize, ca. 850 bp, while M. sp.4 produced fragments of ca.1500 bp. Four isolates of M. sp.3, characterized previouslyby having an esterase profile of one or two bands, producedsame sized fragments of about 700 bp. M. floridensisproduced a fragment of ca.1600bp. This set of primersclearly separated M. floridensis from the other RKN speciesand will be further evaluated using more isolates of thisRKN.

290 Vol. 33(4) - 2009


5 – VARIABILITY IN Nacobbus aberrans POPULATIONS FROM ARGENTINA REVEALED BY RFLP OFTHE rDNA ITS REGION [VARIABILIDADE POPULAÇÕES DE Nacobbus aberrans POR RFLP DA REGIÃO ITSDO rDNA] Lax, P.1; Rondan Dueñas, J.C.2; Gardenal, C.N.2; Doucet, M.E.1 1Centro de Zoología Aplicada, C.C. 122, 5000Córdoba, Argentina; 2Genética de Poblaciones y Evolución, FCEFyN, Córdoba, Argentina. E-mail: [email protected]

Previous studies on several N. aberrans populations fromdifferent countries of South and North America showed aconsiderable variability in the rDNA ITS. In the presentwork, the polymorphism of this region in eight Argentinepopulations was analyzed. Total DNA was extracted fromeach specimen; PCR products were digested with threerestriction enzymes. Seven, six, and two different bandingpatterns were obtained for Alu I, Hinf I, and Rsa I,respectively. The analysis of 20 fragments showed a highlevel of genetic differentiation (Ÿ=0.78) among populations.A UPGMA analysis based on genetic distances showed onecluster comprising most of the populations of differentgeographical origin and different host preference(Lycopersicon esculentum, tomato; Capsicum annuum, pepper;

Solanum tuberosum, potato): Río Cuarto (Province ofCórdoba), Santa María, El Pucará del Aconquija(Catamarca), Lules (Tucumán), Lisandro Olmos (BuenosAires), Tunuyán (Mendoza). The population from CoronelBaigorria (Córdoba), which exhibited a marked preferencefor Chenopodium album (quinoa), was separated from the rest.Nematodes from Yavi (Jujuy), which were from the Andeanregion and associated with Andean potato (S. tuberosumsubsp. andigenum), were the most genetically differentiated.An ongoing study including new populations from differentareas and with different host range is being conducted inour laboratory to provide complementary morphologicaland morphometrical characterization data of differentpopulations of this species.

6 – STUDY OF GENETIC DIVERSITY OF NEMATODE COMMUNITY USING PCR/RFLP 18S rDNATECHNIQUE [ESTUDO DA DIVERSIDADE GENÉTICA DA COMUNIDADE DE NEMATÓIDES USANDOA TÉCNICA DE PCR/RFLP 18S rADN] Mondino E.A.1; Covacevich, F.2; Berbara, R.L.L.3; Studdert, G.A.4; P. Pimentel51CPGA-CS, Laboratório de Biologia do Solo, Universidade Federal Rural do Rio de Janeiro, UFRRJ, BR 465, km 7, 23890-000 Seropédica, RJ, Brazil; 2CPGA-CS, Laboratório de Biologia do Solo, UFRRJ, Seropédica, RJ, Brazil; 3Departamentode Solos, UFRRJ, Seropédica, RJ, Brazil; 4Universidad Nacional de Mar del Plata, RN 226 km 73,5; Balcarce C.P. 7620,Buenos Aires, Argentina; 5Departamento de Fitopatologia, UFRRJ, Seropédica, RJ, Brazil. E-mail: [email protected]

The objective was to assess whether the use of PCR/RFLPis a suitable tool to monitor soil nematological diversity.The study was conducted in the Pampa Austral (Mar ySierras region, Buenos Aires, Argentina) on plots of a long-term experiment (30 years) with mixed rotations and cropsequences at the UIB (Facultad de Ciencias Agrarias,UNMdP-EEA INTA Balcarce). Treatments were two tillagesystems (till and non till) in combination with two croprotations (crops and grasses). Soil samples were collectedin winter and summer of 2006. Samples were extracted at20 cm depth as composite samples by using the zig-zagmethod of soil collection. Nematodes were extracted bythe centrifugation-flotation technique and identification wasdone under microscope, up to the genera category. Theextraction of genomic DNA was performed by macerationof the nematodes in CTAB buffer with proteinase K (100ìg/ml), â-mercaptoethanol (1%) and phenol:chloroform:isoamyl alcohol (25:24:1). The 18S region of rDNA wasamplified by using the primer pairs NemF1/S3 and NS1/NS4, and fragments of expected size (600 and 1000 bp,

respectively) were obtained. The PCR products weredigested with the endonucleases HaeIII and Hinf1, as wellas with the mixture of both enzymes. Digested sampleswere run by electrophoresis (80 V, 3 h) in agarose gels(2.5%). The RFLP patterns from gels were photographed,digitized and analyzed with the TotalLab® software. Withresults of taxonomic identification and RFLP patterns theShannon diversity index (H) was calculated for eachtreatment. In general, we found similar behavior of bothtaxonomic and RFLP diversity indices. We detectedunderestimations for the indices calculated by RFLP in 83%of cases with a similar degree of decrease for the differenttested treatments. While some overestimations for the RFLPindex were detected, this occurred particularly fortreatments with the lowest taxonomic diversity. Futurestudies should aim to detect the causes of this behavior. Inconclusion, even taking into account the generalunderestimation, the use of RFLP was seen to be a rapidand efficient tool for monitoring the nematologicalbiodiversity of environmental soil samples.



291

7 – MOLECULAR CHARACTERIZATION OF THE FALSE ROOT-KNOT NEMATODE Nacobbus aberransFROM NORTH AMERICA [CARACTERIZAÇÃO MOLECULAR DO FALSO NEMATÓIDE DAS GALHASNacobbus aberrans] Ramirez-Suarez, A.1; Powers, T.O.1; Orti, G.2; Gardner, S.L.3; Ratcliffe, B.C.4 1Plant Pathology Department,College of Agriculture and Natural Resources, 411 Plant Science Hall, zip code 68583-0722, University of Nebraska-Lincoln, USA; 2School of Biological Sciences, University of Nebraska-Lincoln, USA; 3State Museum and School of BiologicalSciences, University of Nebraska-Lincoln, USA; 4Entomology Department, University of Nebraska-Lincoln, USA. E-mail: [email protected]

Little is known about the systematic relationship amongNorth America isolates of Nacobbus aberrans. We startedmorphometric and molecular analysis of single specimensfrom populations affecting sugarbeet (Western Nebraska,US); tomato and chard (Mexico State, Mexico) and drybean(Zacatecas, Mexico). The nematodes were heat relaxed,mounted on 2% water-agar media and each stage wasphotographed and analyzed morphometrically. Followingmorphological analysis each specimen was disrupted andused as a DNA template for PCR reactions to amplify themolecular markers using primer set for Internal TranscribedRegion 1 (ITS1), a small subunit of ribosomal DNA (18S)and cytochrome b of the mitochondrial genome (Cyt b).

Each nematode-DNA template was amplified andsequenced for all three molecular markers. Each markerwas considered separately in the construction of theMaximum Likelihood phylogenetic trees using PhyMLprogram. The ribosomal 18S marker displayed nonucleotide sequence variation among isolates; however, bothITS1 and Cyt b markers exhibited subdivision by geography.Three groups were shown: 1.Drybean (Zacatecas, Mexico),2.Chard and Tomato (Mexico State, Mexico) and 3.Sugarbeet (Western Nebraska, US). The DNA sequencesprovided sufficient information to identify “pure”diagnostic characters which were specific for each of thepopulations.

8 – MOLECULAR AND MORPHOLOGICAL PHYLOGENY OF THE ROOT-LESION NEMATODEGENERA Pratylenchus AND Zygotylenchus [FILOGENIA MOLECULAR E MORFOLÓGICA DO NEMATÓIDEDA LESÃO DE RAIZ DOS GÊNEROS Pratylenchus E Zygotylenchus] Castillo, P.1; Palomares-Rius, J.E.1; Liébanas, G.2;Vovlas, N.3; Landa, B.B.1; Navas-Cortés, J.A.1; Subbotin, S.A.4 1Instituto de Agricultura Sostenible , IAS-CSIC, Córdoba,Spain; 2Universidad de Jaén, Jaén, Spain; 3Istituto per la Protezione delle Piante, CNR, Bari, Italy; 4Plant Pest DiagnosticCenter, California Department of Food and Agriculture, Sacramento, USA. E-mail: [email protected]

Root-lesion nematodes of the family Pratylenchidae arerecognized worldwide as one of the major constraints ofcrops of primary economic importance. Correctidentification of a Pratylenchidae species is a prerequisitenot only for any phytopathological or biological research,but also for quarantine schemes and application of diseasecontrol measures. A polyphasic approach study usingmultivariate analyses including factor, cluster and stepwisecanonical discriminant analyses of most useful diagnosticmorphometrical characters for Pratylenchus and Zygotylenchusspecies and analysis of ribosomal DNA sequences wasperformed to clarify similarities and relationships withinPratylenchus spp. and Zygotylenchus spp. and otherPratylenchidae. Sequences of the D2-D3 expansion regionsof 28S rRNA, 18S rRNA and ITS rRNA were analyzedusing maximum parsimony, maximum likelihood and

Bayesian inference to reconstruct phylogenetic relationshipsamong representatives of Pratylenchidae. The hierarchicalcluster and factor analyses carried out based on diagnosticcharacters clearly separate the genera Zygotylenchus andPratylenchus. Also, discriminant analysis proved effective todifferentiate 70 Pratylenchus species from the three validspecies of Zygotylenchus. The results of phylogenetic analysesrevealed that the genus Hirschmanniella formed a highlysupported monophyletic clade in all trees, whereasPratylenchus was paraphyletic and includes several lineageswith unresolved relationships, however, maximumlikelihood tests supported the monophyly of the genusPratylenchus. Relationships between the genera Pratylenchus,Zygotylenchus, Hirschmanniella, Nacobbus and Apratylenchus andresults of Shimodaira-Hasegawa test of alternativetopologies are discussed.

292 Vol. 33(4) - 2009


9 – MOLECULAR CHARACTERIZATION OF PUPULATIONS OF Pratylenchus spp. THROUGH PCR-RFLP [CARACTERIZAÇÃO MOLECULAR DE POPULAÇÕES DE Pratylenchus spp. POR MEIO DE PCR-RFLP]Andrade, E.P.1; Cordeiro, M.C.2; Gonzaga, V.3; Cares, J.E.1 1Departamento de Fitopatologia, Universidade de Brasília,70900-900 Brasília, DF, Brazil; 2Embrapa Cerrados, BR020, km 18, 73310-979 Planaltina, DF, Brazil; 3Embrapa Recursos Genéticose Biotecnologia, 70770-900 Brasília, DF, Brazil. E-mail: [email protected]

The Pratylenchus species are generally referred to as rootlesion nematodes due to the symptoms of necrotic lesionsin roots of their hosts. These parasites have been consideredas the second most important group of plant-parasiticnematodes to agriculture, being exceeded only by root-knotnematodes (Meloidogyne spp.). The ITS region of rDNAhas been used for molecular characterization ofnematodes, since it displays considerable variation amongspecies and within populations of the same species. Theobjective of present research was to characterizepopulations of P. zeae, P. coffeae, and P. jaehni fromdifferent geographical regions in Brazil, on the basis of

molecular approaches. PCR-RFLP analyses were carriedout, using the enzymes Pst I, Hpa II, and Hind III. Thepolymerase chain reaction (PCR) amplified the ITSregion of rDNA of the populations studied, and revealeddifferences in sizes, ranging from approximately 800 to1200 bp. Through the digestion of the fragmentsgenerated with restriction enzymes, only the fragmentsof P. coffeae were digested. This is the first record usingthis molecular approach for P. jaehni. Taking into accountprevious works, present results suggest the existence ofdifferences among populations of P. zeae. FinancialSupport: CNPq, Embrapa.

10 – CARACTERIZAÇÃO MOLECULAR DE ARAÇAZEIROS E GOIABEIRA SUSCETÍVEIS ERESISTENTES A Meloidogyne mayaguensis [MOLECULAR CHARACTERIZATION OF ARAÇÁ AND GUAVAPLANTS SUSCEPTIBLE AND RESISTANT TO Meloidogyne mayaguensis] Almeida, E.J.1; Wickert, E.1; Santos, J.M.11Universidade Estadual Paulista, Faculdade de Ciências Agrárias e Veterinárias, Departamento de Fitossanidade, 14887-900 Jaboticabal. E-mail: [email protected]

A goiaba é um Myrtaceae que engloba mais de 70 gênerose 2800 espécies distribuídas em regiões tropicais esubtropicais do mundo, principalmente nas Américas e naAustrália. O gênero Psidium inclui cerca de 150 espécies.Tecnologias com marcadores moleculares são cada vez maisutilizadas em programas de melhoramento, visandoaumentar a eficiência da seleção e caracterização degermoplasma e da maximização dos ganhos genéticos.Encontraram-se fontes de resistência a Meloidogynemayaguensis entre os acessos estudados, pertencentes àColeção de Frutas Nativas e Exóticas da Unesp/FCAV.Objetivando identificar marcadores moleculares AFLPcapazes de diferenciar e caracterizar os genótipos queapresentaram resistência genética a Meloidogyne mayaguensisrealizou-se este trabalho com resultados preliminares. Todosos acessos de araçá utilizados neste trabalho e submetidosà análise de AFLP mostraram amplificação para 18 das 24combinações seletivas testadas. Combinações envolvendofluorescência Joe mostraram maior eficiência, medidas pelonúmero de bandas polimórficas, seguido por Ned e Fam.

Embora ainda seja necessário realizar as análises pertinentesde distância genética, é possível observar que os acessosaraçazeiro 1,1, 1,2, 1,3, 1,4 e 1,6 mostraram grandesimilaridades no perfis eletroforéticos. O mesmo éverdadeiro para o acesso araçá pêra 1 e 2, que mostraramperfil semelhante entre si e diferente em relação aos demais.O mesmo aconteceu com as adesões de araçá vermelho 1,2 e 3. A goiabeira ‘Paluma’ mostrou um perfil diferente detodos os acessos de araçá. Os materiais deste estudomostraram distâncias genéticas variando de 0,10185 (menor)para 0,86667 (maior). A análise de agrupamento desimilaridade mostrou que os acessos do presente estudoapresentaram a formação de 3 grupos distintos. O grupo1 foi formado pelos acessos Araçá pêra 1 e 2, os deGoiaba da Costa Rica e o de goiaba ‘Paluma’. AraçáVermelho 1, 2 e 3 formaram o Grupo 2 do dendrograma,demonstrando grande similaridade genética. Os cincoacessos de araçá ainda não classificadas em espéciesagruparam-se formando o Grupo 3, apesar de seremdispostos em dois subgrupos.



293

11 – A NOVEL SPECIES-SPECIFIC SATELLITE DNA FAMILY IN THE INVASIVE ROOT-KNOTNEMATODE Meloidogyne mayaguensis AND ITS POTENTIAL USE FOR DIAGNOSTICS [NOVA FAMÍLIADE DNA SATÉLITE ESPÉCIE ESPECÍFICA PARA O NEMATÓIDE DAS GALHAS Meloidogyne mayaguensis E SEUPOTENCIAL DE USO PARA O DIAGNÓSTICO] Randig O.1; Deau, F.2; Santos M.F.A.3; Tigano, M.S.3; Carneiro,R.M.D.G.3; Castagnone-Sereno, P.2 1CNPq, Coordenação do Programa de Pesquisa em Agropecuária e do Agronegócio,COAGR, SEPN 509, Bloco A, 70750-501 Brasília, DF, Brazil; 2INRA UMR1301, UNSA, CNRS UMR6243, InteractionsBiotiques et Santé Végétale, 400 route des Chappes, BP167, 06903 Sophia Antipolis, France; 3EMBRAPA, RecursosGenéticos e Biotecnologia, C.P. 02372, 70849-970 Brasília, DF, Brazil. E-mail: [email protected]

The root-knot nematode (RKN) Meloidogyne mayaguensis isconsidered as one of the most damaging RKN speciesbecause of its extremely wide host range. Recent surveyshave shown the rapid spread of this parasite in agro-ecosytems, often making crop cultivation not viable in theheavily infested areas. Here, we report the identification,molecular cloning, genomic organization and sequenceanalysis of a new satellite DNA (satDNA) family from M.mayaguensis (named pMmPet). It is comprised of twogroups of A+T rich, tandemly repeated units of 174and 180 bp, respectively. Using these sequences as targets,hybridization and PCR experiments performed on a widecollection of 44 populations belonging to 15 RKN

species showed that the pMmPet family could only bedetected in the 16 M. mayaguensis populations tested. Inaddition, because of their repetitive nature, positivedetection of pMmPet sequences was achieved in singleindividual nematodes. Therefore, the repeated sequencedescribed here possesses features that make it anexcellent candidate for use as a specific and extremelysensitive tool for the accurate detection and identificationof this invasive pest on a routine basis. Clearly,monitoring the occurrence and spread of M. mayaguensisat the domestic and international levels is needed to avoidwholesale loss of agricultural resources in the infestedregions.

12 – DEVELOPMENT OF SPECIFIC SCAR MARKERS TO IDENTIFY THE ROOT-KNOT Meloidogynemayaguensis [DESENVOLVIMENTO DE MARCADORES ESPECÍFICOS SCAR PARA IDENTIFICAÇÃO DEMeloidogyne mayaguensis] Siqueira, K.M.S.1; Carneiro, R.M.D.G.1; Santos, M.F.A.1; Queiroz, P.R.1; Silva, J.G.P.1; Castagnone-Sereno, P.2; Tigano, M.S.1 1Embrapa Recursos Genéticos e Biotecnologia, C. P. 02372, 70770-917 Brasília, DF, Brazil;2INRA/UNSA/CNRS, UMR1301, BP167, 06330 Sophia Antipolis, France. E-mail: [email protected]

Meloidogyne mayaguensis Rammanh & Hirschimann, 1988, wasdetected for the first time in Brazil, in guava roots in thePetrolina (PE), Curaçá and Maniçoba (BA) regions, causingserious economic problems. Considering the difficulty ofidentification by the perineal pattern method, M. mayaguensishas been misidentified in different regions of the world.The objective of this study was to develop an economicallyviable molecular marker system for application in detection.For the development of sequence characterized amplifiedregion (SCAR) markers from specific random amplifiedpolymorphic DNA (RAPD), 16 isolates of M. mayaguensisand 11 isolates belonging to other Meloidogyne spp.,obtained from different localities and/or hosts, wereused. The M. mayaguensis isolates were identified bybiochemical (esterase phenotype) and molecular markers.

The RAPD method was used to investigate the geneticdiversity of the Meloidogyne spp. isolates, and allowed toidentify several species-specific RAPD fragments. Twoprimers, OPK-7 and OPM-20, were identified as givingspecific fragments to M. mayaguensis. These fragmentswere cloned and sequenced, and from the sequencesobtained, two sets of primers were designed and tested.For both primer sets, the amplification of one fragment,520 or 450 bp-long, respectively, occurred only for the16 isolates of M. mayaguensis. Thus, these two sets ofSCAR primers specific for M. mayaguensis constitutemolecular tools which could be used as a simple methodto detect this nematode from field samples. Also, thistechnique could be used as a routine diagnostic test forquarantine devices.

294 Vol. 33(4) - 2009


13 – IDENTIFICATION AND GENETIC VARIABILITY OF Meloidogyne mayaguensis ISOLATES BY THEANALYSIS OF MOLECULAR MARKERS [IDENTIFICAÇÃO E VARIABILIDADE GENÉTICA DE ISOLADOSDE Meloidogyne mayaguensis POR MEIO DA ANÁLISE DE MARCADORES MOLECULARES] Santos, M.F.A.1; Carneiro,R.M.D.G.1; Queiroz, P.R.1; Siqueira, K.M.S.1; Silva, J.G.P.1; Teixeira, C.C.1; Almeida, M.R.A.1; Castagnone-Sereno, P.2; Tigano,M.S.1 1Embrapa Recursos Genéticos e Biotecnologia, C. P. 02372, 70770-917 Brasília, DF, Brazil; 2INRA/UNSA/CNRS,UMR1301, BP167, 06330 Sophia Antipolis, France. Email: [email protected]

Meloidogyne mayaguensis is a polyphagous root-knot nematodespecies which presents a high reproductive rate. In Brazil,this nematode is known for causing serious economicdamage on guava crops. Sixteen M. mayaguensis isolates fromdifferent geographical regions and/or hosts were used inthis study. The identification was done based on isozymesand DNA analyses. All isolates presented the typicalisoesterase phenotype for M. mayaguensis (Est M2), with twomajor bands (Rm:0.70, 0.90) and two secondary (Rm:0.75,0.95). The DNA amplification of the IGS (rDNA) and ofthe region between the cytochrome oxidase subunit II(COII) and 16S rRNA genes (mtDNA) also showed the

specific size of fragments expected for this nematode,i.e., 780 and 705 bp, respectively. The intraspecificvariability among the isolates was evaluated with threedifferent neutral molecular markers, AFLP, ISSR andRAPD, using 30, 35 and 20 primers, respectively. Theconcatenated data were analyzed with distance-based(neighbor-joining) and parsimony phylogeny-reconstructing methods, and the resulting trees were verysimilar to each other. Overall, the results showed a highlevel of homogeneity among the isolates tested,indicat ing that M. mayaguens i s is a genetical lyhomogeneous root-knot nematode species.

14 – GENETIC VARIABILITY OF Meloidogyne ethiopica ISOLATES REVEALED BY MOLECULARMARKERS [VARIABILIDADE GENÉTICA DE ISOLADOS DE Meloidogyne ethiopica POR MEIO DA ANÁLISE DEMARCADORES MOLECULARES] Mattos, V.S.1; Carneiro, R.M.D.G.1; Santos, M.F.A.1; Siqueira, K.M.S.1; Queiroz, P.R.1;Almeida, M.R.A.1; Castagnone-Sereno, P.2; Tigano, M.S.1 1Embrapa Recursos Genéticos e Biotecnologia, C. P. 02372,70770-917 Brasília, DF, Brazil; 2INRA/UNSA/CNRS, UMR1301, BP167, 06330 Sophia Antipolis, France. E-mail:[email protected]

Meloidogyne ethiopica Whitehead, 1968 is a root-knot nematodewhich causes serious economic damage in grape-vine cropsin Chile. In Brazil, although M. ethiopica has been detectedwith low frequency in kiwi, this nematode can spreadthroughout the country and provokes economic losses insome important commercial crops. The objective of thisstudy was to evaluate the genetic variability of M. ethiopicausing AFLP and RAPD analyses. Fifteen isolates wereobtained from different geographic regions and/or hosts.For all isolates, isoenzyme analysis revealed the typicalpattern of esterase E3 (Rm:0.9, 1.05, 1.20) for M. ethiopica.Three isolates of Meloidogyne sp. showing an atypical esterasephenotype L3 (Rm: 1.0, 1.1, 1.25) and one isolate of M.

mayaguensis were included in the DNA analyses as outgroups.The DNA amplifications were done using 20 and 17 primersfor AFLP and RAPD analyses, respectively. The treesobtained for each marker showed similar clustering of theisolates, so the results of both types of marker were analyzedtogether. The results showed a high level of homogeneityamong the M. ethiopica isolates analyzed, which clusteredtogether in the tree (82% of bootstrap support). The threeMeloidogyne sp. isolates also showed a high homogeneity andclustered separately from M. ethiopica (100% of bootstrapsupport). These molecular data indicate close geneticrelationships between M. ethiopica isolates, regardless of theirdifferent geographical and/or host plants origins.

15 – GENETIC VARIABILITY IN POPULATIONS OF Meloidogyne incognita RACE 3 PARASITES OFCOTTON CROP IN NORTHWEST PARANÁ, BRAZIL [VARIABILIDADE GENÉTICA DE POPULAÇÕESDE Meloidogyne incognita RAÇA 3 PARASITAS DO ALGODOEIRO NO NOROESTE DO PARANÁ, BRASIL] Antes,V.A.1; Pires, E.1; Furlanetto, C.2; Bonett, L.P.3; Schuelter, A.R.3; Fiorentin, F.1 1Universidade Estadual do Oeste do Paraná,Centro de Ciências Agrárias, 85.960-000 Marechal Cândido Rondon, PR, Brazil; 2Universidade de Brasília, Departamentode Fitopatologia, 70.910-900 Brasília, DF, Brazil; 3Universidade Paranaense, Campus de Toledo, 85.903-170 Toledo, PR,Brazil. E-mail: [email protected]

This work aimed at studying the genetic variability of sixpopulations of M. incognita race 3, collected in the counties

of Moreira Sales, Iporã, Umuarama, Santa Lúcia, Mariluzand Pérola, Western Paraná, Brazil, through RAPD



295

technique. Nematode monospecific populations were builtup on tomato plants and DNA of each population (30ng)was extracted from mature females. RAPD reactions wererun in a Biocycler Peltier Thermal Cycler with 45 cycles at94 ºC/15s, 35 ºC/30s and 72 ºC/1 minute. A total of 15ten-nucleotide arbitrary primers were screened for theirpotential use in the differentiation of these populations.RAPD profiles of five primers revealed DNA fragmentswith 19.05% polymorphism and genetic distances rangingfrom 0.17% to 0.5%. Populations were separated in five

clusters (UPGMA method) by the primers AK20 (5’TGATGGCGTC 3’), A10 (5’ GTGATCGCAG 3’), AQ12(5’ CAGCTCCTGT 3’), AS08 (5’ GGCTGCCAGT 3’) andF01 (5’ ACGGATCCAG 3’). The populations were split asfollows: Group 1. Mariluz and Umuarama; Group 2. Pérola;Group 3. Altônia; Group 4. Iporã; Group 5. Moreira Salesand Santa Lúcia. RAPD technique detected genetic variabilitywithin homogeneous populations of M. incognita. Future workwill find out whether this variability is related or not to theaggressiveness of each population on host plants.

16 – MOLECULAR DIAGNOSIS OF Ditylenchus dipsaci IN IMPORTED POTATO GERMOPLASM[DIAGNÓSTICO MOLECULAR DE Ditylenchus dipsaci EM GERMOPLASMA DE BATATA IMPORTADO] Martins,D.M.S.1; Gonzaga, V.1; Costa, D.C.1; Polez, V.L.P.1 1Embrapa Recursos Genéticos e Biotecnologia, C.P. 02372, 70770-917Brasília, DF, Brazil. E-mail: [email protected]

Ditylenchus dipsaci is one of the most devastating plantparasitic nematodes, especially in temperate regions.However, it occurs in more than ten biological breeds, someof which have a limited host-range. The breed(s) thatreproduce on rye, oats and onions seem to be polyphagousand can also infest several other crops, whereas thosebreeding on lucerne and strawberries are virtually specificfor their named hosts and seem to have relatively fewalternative host plants. It is known that some of the breedscan interbreed and that their progeny have different hostpreferences. This parasite is present in the list of quarantineabsentee organisms in Brazil, except for the garlic breed.In Brazil it was reported in Pernambuco, Paraná, Rio Grandedo Sul, Santa Catarina and São Paulo states. It lives as anendoparasite in aerial or underground (bulbs, tubers andrizomes) parts of plants. The internal transcribed spaces(ITS) region of ribosomal RNA localized between the smallnuclear ribosomal subunit (18S) and large nuclear ribosomalsubunit (28S) is very important to identify species ofnematodes. The objective of the present study was toidentify the species of Ditylenchus in imported potato

germplasm through molecular diagnosis based on theanalysis of the ITS region. The analysis was carried out inthe Plant Quarantine Laboratory/Embrapa GeneticResources and Biotechnology. The DNA was extractedfrom individual adult nematodes using the DNA easy bloodtissue kit (QIAGEN). The concentration of the DNA wasmeasured utilizing Nanodrop 1000. The primers rDNA1and rDNA2 were used in the PCR analysis. After the DNAamplification, 25uL of the product was run on 1% agarose.The products of PCR (length of approximately 950 basepairs) were purified using a QIAquick gel extraction kit(QIAGEN). The DNA fragments were directly sequenced.The sequences were aligned and analyzed in the GenBankdatabase. These sequences showed 99% of similarity withD. dipsaci. At present, the distribution of the differentbreeds throughout the region is patchy and somecountries apply official control measures to limit spread.As there is no known occurrence of D. dipsaci in thepotato crop in Brazil, the germplasm was incinerated, asrequired by the standards of the Brazilian phytosanitarylegislation.

17 – GENE ISOLATION AND VECTOR CONSTRUCTION FOR TOBACCO TRANSFORMATION AIMINGFOR GENE SILENCING OF THE PLANT PARASITIC NEMATODE Meloidogyne incognita [ISOLAMENTODE GENE E CONSTRUÇÃO DE VETOR PARA TABACO VISANDO GENE SILENCIADOR DO NEMATÓIDEPARASITA DE PLANTA, Meloidogyne incognita] Lourenço, I.T.1,2; Antonino-Souza Junior, J.D.1,2; Fragoso, R.R.3; Souza,D.S.L.E.2; Rocha, T.L.2; Grossi-de-Sá, M.F.2 1Departamento de Biologia Celular, Universidade de Brasília, Brasília, DF,Brazil; 2Embrapa Recursos Genéticos e Biotecnologia, Brasília, DF, Brazil; 3Embrapa Cerrados, Planaltina, DF, Brazil. E-mail: [email protected]

Plant parasitic nematodes are responsible for hugeeconomic losses in world agriculture that reaches US$ 125billion yearly. The most important of these plant pathogens,Meloidogyne incognita, has six developmental stages during the

life cycle (egg, four juveniles and female). The infectivejuvenile 2 (J2) enters the host root via mechanical forceand enzymatic degradation to establish the host-pathogeninteraction and differentiate in apomitic adult female, which

296 Vol. 33(4) - 2009


deposits around 2,000 eggs. Current agronomic practicesare usually unsuccessful and expensive, so the cultivationof resistant varieties is now the most efficient way to controlnematodes. The phenomenon of gene expressioninterference mediated by RNA (RNAi) found in eukaryoticorganisms was recently discovered, and our understandinghas been constantly improved. In parallel, its application asa molecular biological tool has been continually improvedtoo. As well as becoming a powerful strategy for genefunction identification, RNAi is a promising tool for genetherapy and viral, protozoal, fungal, nematoidal, acaridal,arthropodal and insecticidal control in different organisms.Ingestion of double strand RNA (dsRNA) by nematodeleads to an RNAi process that culminates in specific geneexpression silencing, resulting in nematode physiologyalterations. In this work, aiming to transform Nicotianatabacum with plasmidial constructions for double strandRNA expression for bioassays by infection with Meloidogyneincognita, the nematode target genes chosen were: IsocitrateLyase, Arginine Kinase, 14-3-3 Protein, Heat Shock Protein

90, Aspartic, Cysteine and Serine proteinases, â-1,4-endoglucanase and an esophageal gland gene named Mi-2.One region of each target gene was selected, isolated andsubcloned in the RNAi vector pK7GWIWG2(I) for tobaccotransformation using Agrobacterium tumefaciens. In addition,an expression analysis of Isocitrate Lyase, Arginine Kinase,14-3-3 Protein and Heat Shock Protein 90 target genes wasdone, normalized with housekeeping genes â-actin and 18SrRNA, using quantitative real time PCR. This experimentshowed that these genes are differentially expressed whencompared during egg, J2 and female phases. The majorgene expression difference observed was in Isocitrate Lyasepattern, which is a hundred times more expressed in J2 orfemale when compared with egg. The Arginine Quinaseexpression was five-fold higher in J2 and ten-fold shorterin female compared with egg. The 14-3-3 expression hadinsignificant variation in all three stages. Finally, the HSP90expression level was the same in egg and J2, but was 32times less in female than in egg. Supported by: CNPq,EMBRAPA

18 – EFFECT OF Meloidogyne incognita ON METABOLITE PRODUCTION BY SOYA AND TOMATOPLANTS RESISTANT AND SUCEPTIBLE TO PLANT-PARASITIC NEMATODES [EFEITO DE Meloidogyneincognita NA PRODUÇÃO METABÓLITA DE PLANTAS DE SOJA E DE TOMATE RESISTENTES E SUSCETÍVEISA NEMATÓIDES PARASITAS DE PLANTAS] Campos, V.A.C.1; Machado, A.R.T.1; Fontes, T.V.1; Moreira, M. A.1;Oliveira, D.F.1; Campos, V.P.2 1Universidade Federal de Lavras, Departamento de Química, Laboratório de ProdutosNaturais, C. P. 3037, 37200-000 Lavras, MG, Brazil; 2Universidade Federal de Lavras, Departamento de Fitopatologia,Laboratório de Nematologia, C. P. 3037, 37200-000 Lavras, MG, Brazil. E-mail: [email protected]

One of the plant defense mechanisms against nematodesconsists of the production of nematicidal substances inresponse to parasite presence. Since such compounds maybe of great importance to the development of newnematicides and new cultivars to be used in nematode-contaminated areas, the present work aimed to find outmetabolite variations in plant roots that could correlate withplant resistance to nematodes. First, soya and tomato plantsresistant and susceptible to Meloidogyne incognita wereinoculated with 696 second-stage juveniles (J2) of thenematode. At 0, 24, 48 and 96 h after inoculation, rootswere submitted to spectrophotometric methods to quantifysoluble carbohydrates, sucrose, free amino acids, alkaloids

and phenols. The only difference between susceptible andresistant soya plants was observed for the amount ofalkaloids, which was 2445 % higher in the resistant plant at0 h and increased to a value 10210 % higher than the oneobserved for the susceptible plant at 96 h. Regarding tomatoplants, phenols seemed to be involved in plant defensemechanism, since in the resistant plants the amount of thesesubstances was 107 % higher than the value observed forsusceptible plants 48 h after inoculation. Concluding,alkaloids and phenols apparently are respectively involvedin the mechanism of resistance of soya and tomato plantsto nematodes.

Section 2 - Resistance



297

19 – METABOLIC VARIATIONS IN THE ROOTS OF PLANTS EXPOSED TO Meloidogyne exigua ANDMeloidogyne incognita [VARIAÇÕES METABÓLITAS NAS RAÍZES DE PLANTAS EXPOSTAS A Meloidogyneexigua E Meloidogyne incognita] Machado, A.R.T.1; Campos, V.A.C.1; Chagas, R.C.R.1; Oliveira, D.F.1; Campos, V.P.2; Silva,W.J.R.1 1Laboratório de produtos naturais, Universidade Federal de Lavras, C. P. 3037, 37200-000, Lavras, MG, Brazil;2Laboratório de Nematologia, Universidade Federal de Lavras, C. P. 3037, 37200-000, Lavras, MG, Brazil. E-mail:[email protected]

To increase the knowledge about the resistance process tonematodes by plants and, consequently, to contribute tothe development of new methods to control such parasites,this work aimed to evaluate the metabolic variations in theroots of coffee and common bean plants exposed to theroot-knot nematodes Meloidogyne exigua and Meloidogyneincognita, respectively. Thus, resistant (cv. IAPAR-59) andsusceptible (cv. Catuaí-vermelho) coffee seedlings, as wellas resistant (cv. Ouro Negro) and susceptible (cv. Carioca)common bean seedlings, were inoculated with 696 second-stage juveniles of the nematodes. 0, 24, 48 and 96 h after

the inoculation, free amino acids, alkaloids, solublecarbohydrates, sucrose and phenols were quantified in theroots. The most significant metabolic alteration in plantroots was observed 48 h after the nematode inoculationfor the amount of sucrose, which increased 382 and 92 %in coffee and common bean plants resistant to thenematodes, respectively, while the amount of thiscarbohydrate did not vary in susceptible coffee plants andfell by 60 % in common bean plants. These results suggestthat sucrose is involved in the mechanism of plant defenseagainst nematodes.

20 – ESTUDO HISTOPATOLÓGICO DA INTERAÇÃO Meloidogyne incognita x Coffea canephora[Histopathology of Meloidogyne incognita on Coffea canephora plants] Bessi, R.1; Inomoto, M.M.1 1ESALQ/USP, 13418-900Piracicaba, SP, Brazil. E-mail: [email protected]

O desenvolvimento e a reprodução dos nematoides dogênero Meloidogyne dependem da presença das célulasnutridoras, que constituem o sítio de alimentação na plantahospedeira. Neste estudo, foram observadas as alteraçõesanatômicas induzidas por M. inognita nas raízes de cultivaresde Coffea canephora, relacionando-as ao crescimento oudesenvolvimento do parasita e sua fecundidade. Foramutilizadas plântulas de C. canephora, ‘Robusta IAC 4810’,‘Kouillou IAC 4765’ e ‘IAC Apoatã’, obtidas de sementesfornecidas pelo Centro de Café ‘Alcides Carvalho’ (IAC).Coffea arabica ‘Mundo Novo’ foi utilizada como padrãosuscetível. Amostras de raízes de aproximadamente 0,5 cmforam retiradas 16 e 32 dias após a inoculação de 1.000juvenis de segundo estádio/plântula. Os fragmentos foramfixados, desidratados e embebidos em resina glicolmetacrilato. Para estudo das alterações, secções de 5 ìmforam coradas em Floxina B e azul de toluidina eexaminadas em microscópio Zeiss Axioskop 2. Regiõesdesorganizadas do cilindro central, aparentemente causadas

pela formação de células nutridoras pequenas, foramobservadas em ‘Apoatã’. Células nutridoras pequenas epouco densas foram induzidas no genótipo ‘IAC 4810’.Observou-se nessas duas cultivares a presença de sítios dealimentação formados por células multinucleadas e comcitoplasma denso, que permitiram o aumento da populaçãodo nematoide. Os sítios de alimentação em ‘IAC 4765’apresentaram características semelhantes às de ‘MundoNovo’, com células nutridoras ocupando grande área docilindro central e apresentando citoplasma denso e carátermultinucleado. O desenvolvimento das células gigantesprovocou a completa desorganização do cilindro central, oque constitui indício de que seja genótipo menos resistentea M. incognita que ‘Apoatã’ e mesmo ‘IAC 4810’. Os estudoshistopatológicos demonstraram a utilidade do exame dascélulas nutridoras induzidas por Meloidogyne incognita comoferramenta para a caracterização de genótipos para os quaisas avaliações tradicionais, com base em variáveis dareprodução do nematoide, não são conclusivas.

298 Vol. 33(4) - 2009


21 – COMPORTAMIENTO DE LOS GENES DE RESISTENCIA A Meloidogyne incognita ENMONOCULTIVOS DE PIMIENTO DEL SURESTE DE ESPAÑA [RESISTANCE GENES’ BEHAVIOR TOMeloidogyne incognita ON CHILI CROP IN THE SOUTHEAST OF SPAIN] Ros, C.1; Lacasa, A.1; Cano, A.2; Robertson,L.3; Cenis, J.L.1; Martínez, C.1; Díez-Rojo, M.A.3; Bello, A.3 1Biotecnología y Protección de Cultivos, IMIDA, C/Mayor s/n 30150, La Alberca Murcia, España; 2SSVV. Consejería de Agricultura y Agua. /Mayor s/n 30150 La Alberca Murcia,España; 3Agroecología, Centro de Ciencias Mediambientales, CSIC, C/ Serrano 115, 28006 Madrid, España. E-mail:[email protected]

En el sureste de España, Meloidogyne incognita estáampliamente distribuido en los invernaderos de la Regiónde Murcia donde el pimiento es un monocultivo desde hacemás de 20 años. La prohibición del uso del bromuro demetilo como desinfectante del suelo plantea el empleode portainjertos resistentes al nematodo como métodode control. Seleccionando aquellos patrones portadoresde resistencia que mejor comportamiento ofrezcan frentea las poblaciones de nematodos l igadas a estemonocultivo, se evaluó, en condiciones controladas, elcomportamiento de los genes de resistencia presentesen siete patrones comerciales (cvs Atlante, Snooker,Nemahard, C19, RT12 & DRO 8801) y dosexperimentales (cvs IMIDA 1 & IMIDA 2)

comparándolos con dos cultivares comerciales sensiblesal nematodo (Sonar y Yolo Wonder), mediante lainoculación de dos poblaciones de M. incognita, aisladasde nuestra zona de cultivo, una de ellas virulenta. A suvez se detectaron los genes de resistencia presentes enestos patrones mediante técnicas moleculares, teniendocomo referencia la identificación del gen Me1 en el cvPI 201234; el gen Me3 en el cv PI 322719 y el gen Me7en el cv CM334. Todos los portainjerto resultaron serresistentes a la población avirulenta del nematodoindependientemente de los genes de resistencia queportaran, sin embargo hubo diferencias en la resistenciade estos patrones frente a la población virulenta, segúnel gen o los genes de los que era portador cada uno.

22 – INTERACCION Meloidogyne incognita & Phytophthora spp. EN PIMIENTO [Meloidogyne incognita &Phytophthora spp. INTERACTION ON CHILI] Ros, C.1; Lacasa, C.M.1; Martínez, V.3; Martínez, M.C.1; Díez-Rojo, M.A.2;Lacasa, A.1 1IMIDA, Mayor s/n, 30150 La Alberca (Murcia) España; 2Centro de Ciencias Medioambientales, CSIC, Serrano,115. 28006 Madrid. España; 3Programa de Colaboración FECOAM-CAAMA, Caballero, 3. 30002 Murcia. España. E-mail: [email protected]

Meloidogyne incognita y Phytophthora spp. son los principalespatógenos del suelo en los invernaderos de pimiento delsureste español, realizándose desinfecciones todos los añospara su control. El injerto sobre patrones con resistencia auno o a ambos patógenos se ha evaluado como unaalternativa a la desinfección del suelo. La reiteración deluso de patrones resistentes a M. incognita en el mismo sueloprovoca, en algunos casos, la aparición de poblacionesvirulentas, capaces de infestarlos, sin que, se haya observadolo mismo para Phytophthora. En condiciones controladas, seha estudiado la posible interacción de M. incognita en lainfección por P. capsici y P. parasitica que pudieracomprometer la resistencia a los hongos. Se utilizaron 3poblaciones de M. incognita de pimiento y dos aislados dePhytophthora, de la misma especie o uno de cada una, condiferente agresividad, obtenidos de pimiento. La interacciónse evaluó inoculando cada uno de los patógenos y ambos

juntos en un cultivar comercial sensible (cv Sonar) y endiez patrones (C2, C19; C25, C28, C30, C45; C5, DRO3403; RT12 & M1) que se comportan como resistentes aP. capsici y/o M. incognita. Las lesiones del nematodo facilitanla instalación de Phytophthora spp en las raíces de patronesresistentes al hongo, provocando una reducción en eldesarrollo radicular y manchas necróticas, lo que no sucedecuando se inocula, por separado, el hongo o el nematodo,no observándose síntomas de marchitez o “seca” de lasplantas. En los aislados más agresivos la destrucción de lasraíces por el hongo redujo la infestación de estas por elnematodo. Dos poblaciones del nematodo colonizaron lasraíces de los patrones con abundantes nódulos. Con lasotras dos poblaciones no se produjeron alteraciones en lasraíces cuando se inoculó con cualquiera de los dos aisladosdel hongo. El cultivar comercial fue infestado por todas laspoblaciones.



299

23 – COMPARAÇÃO ENTRE TÉCNICAS DE COLORAÇÃO DE RAÍZES DE SOJA INFECTADAS PORHeterodera glycines, Meloidogyne incognita E Pratylenchus brachyurus [COMPARISON OF ROOT STAININGMETHODS OF SOYBEAN INFESTED BY Heterodera glycines, Meloidogyne incognita AND Pratylenchus brachyurus] Araújo,F.G.1; Barbosa, K.A.G.1; Santos, L.C.1; Teixeira, R.A.1; Rocha, M.R.1 1Universidade Federal de Goiás, Escola de Agronomiae Engenharia de Alimentos, Laboratório de Nematologia, C. P. 131, 74001-470 Goiânia, GO, Brazil. E-mail:[email protected]

A coloração de nematóides dentro do tecido radicular éuma rotina nos laboratórios de nematologia de todo omundo, sendo a capacidade de visualização de nematóidesdentro do tecido radicular, essencial para muitas áreas deinvestigação nematológica. Com o objetivo de avaliar aeficiência de duas técnicas de coloração de raízes, conduziu-se experimento em casa de vegetação, colorindo raízes desoja cultivar Emgopa 313, infectadas pelos três principaisfitonematóides que afetam a cultura: Heterodera glycines,Meloidogyne incognita e Pratylenchus brachyurus. Foram realizadastrês avaliações aos 10, 17 e 25 dias após o plantio da sojaem solo naturalmente infestado, com os nematóidesavaliados. A técnica empregando clareamento com NaOCl

e fuccina ácida e a técnica que emprega lacto-glicerol efuccina ácida foram eficientes na coloração dos nematóides,permitindo a sua visualização no interior do tecido radicular.Em função da duração do ciclo de vida do P. brachyurus nãofoi possível a visualização desses nematóides nos tecidosradiculares na primeira avaliação empregando a técnica doclareamento e coloração com fuccina ácida, e na segundaavaliação, em ambas as técnicas testadas. Para tecidos maistenros a técnica que emprega o clareamento seria a maisindicada por facilitar a visualização dos nematóides, já queos tecidos sofrem certa descoloração, e por utilizar umamenor quantidade de corante, o que auxilia no processo dedescoloração.

24 – COMPARAÇÃO ENTRE NÍVEIS DE INÓCULO, ÉPOCAS DE AVALIAÇÃO E VARIÁVEIS PARAScreenings DE Psidium sp. VISANDO A DETECÇÃO DE RESISTÊNCIA A Meloidogyne mayaguensis[ASSESSMENT OF INOCULUM LEVELS, EVALUATION TIME AND VARIABLES FOR Screenings OF Psidium sp.FOR RESISTANCE TO Meloidogyne mayaguensis] Burla, R.S.1; Souza, R.M.1; Gomes, V.M.1 1Universidade Estadual doNorte Fluminense Darcy Ribeiro/CCTA/LEF. Av. Alberto Lamego, 2000, 28015-620, Campos dos Goytacazes, RJ, Brasil.E-mail: [email protected]

Devido às dificuldades para o controle químico e culturalde M. mayaguensis na cultura da goiaba, a resistência genéticamostra-se como a melhor estratégia de controle destenematóide a médio prazo. Não obstante haja screenings degenótipos sendo realizados no Brasil e no exterior, não existepadronização metodológica quanto ao nível de inóculo donematóide, época de avaliação e variável a seremempregados. Neste trabalho, mudas de goiabeira ‘Paluma’(susceptível ao nematóide) de 4 pares de folhas foraminoculadas em vasos com 2 L de substrato Plantimax® com500, 2.000, 3.500, 5.000 ou 6.500 ovos de M. mayaguensis, eavaliadas 1,5, 3, 4,5 ou 6 meses após. As variáveis avaliadasforam massa fresca do sistema radicular, população finaldo nematóide, fator de reprodução (FR) e número de ovos+ J2/g de raiz. O experimento foi conduzido em casa-de-vegetação em duas épocas (verão-outono e inverno-primavera), em delineamento inteiramento casualizado com

20 tratamentos e 6 repetições/tratamento, sendo os dadosanalisados por ANOVA, teste F a 5% e regressão linear.Em ambos os períodos do ano o nível de inóculo nãointerferiu na massa final do sistema radicular ou napopulação final do nematóide, mas estas variáveismostraram uma correlação positiva com a época deavaliação (de 1,5 a 6 meses após a inoculação). A variávelnúmero de ovos + J2/g de raiz mostrou-se ruim parascreenings de genótipos, pois não se correlacionou com onível de inóculo ou com a época de avaliação. O FRmostrou-se a melhor variável para screenings, mas osresultados indicaram claramente que os níveis de inóculode 3.500, 5.000 e 6.500 ovos/planta reduzem o FR, podendogerar resultados falso-positivos (falsa resistência aonematóide). As melhores combinações nível de inóculo xépoca foram 500 ou 2.000 ovos/planta e avaliação 4,5 ou 6meses após a inoculação com o nematóide.

300 Vol. 33(4) - 2009


25 – REAÇÃO DE GENÓTIPOS DE CANA-DE-AÇÚCAR AOS NEMATÓIDES DE GALHAS [REACTIONOF SUGARCANE GENOTYPES TO ROOT-KNOT NEMATODES] Santos, D.A.1; Dias-Arieira, C.R.1; Souto, E.R.1;Biela, F.1; Milani, K.F.1; Ortiz, T.1; Silva, M.L.1 1Universidade Estadual de Maringá, Campus Regional de Umuarama, C. P.65, 87501-970 Umuarama, Paraná, Brasil. E-mail: [email protected]

O cultivo de cana-de-açúcar cresce de forma significativaem diversas regiões agrícolas do país. Contudo, algunsproblemas fitossanitários têm reduzido a produtividade daslavouras, como é o caso dos nematóides de galhas. O usode variedades resistentes assume um papel relevante nocontrole destes patógenos, por não aumentar o custo deprodução e ser ambientalmente seguro. Assim, objetivou-se avaliar a suscetibilidade de variedades de cana-de-açúcardo grupo CTC aos nematóides de galhas. Para isto, mudasdas variedades CTC 11, CTC 12, CTC 13, CTC 14, CTC15, CTC 16, CTC 17 e CTC 18, previamente produzidasem câmaras de germinação e bandejas contendo areia foramtransplantadas para vasos com capacidade para três litros.Após dez dias, foram inoculadas com suspensão contendo4.000 ovos de Meloidogyne incognita, M. javanica ou M.paranaensis. Decorridos 60 dias, as plantas foram avaliadasquanto ao peso fresco e seco da parte aérea, altura da planta,

peso fresco das raízes e número de ovos por sistemaradicular, a partir do qual se calculou o fator de reprodução(FR=população final/população inicial). Após a retiradadas plantas, cada vaso recebeu uma muda de tomateiro‘Santa Cruz’ como bioteste, que foi avaliado após 35 diasde cultivo. O experimento foi em DIC, com seis repetiçõese as médias foram comparadas pelo teste Tukey 5%.Nenhuma variedade estudada apresentou reação deimunidade aos nematóides (FR=0). Para M. paranaensis todasas variedades apresentaram FR > 1, ou seja, foramsuscetíveis. Quanto a M. javanica, as variedades CTC 11 eCTC 17 apresentaram 0<FR<1, enquanto as demaisapresentaram FR>1. Por fim, para M. incognita, CTC 12,CTC 13 e CTC 14 apresentaram FR>1. No bioteste todosos tratamentos apresentaram números elevados de galhas,comprovando a viabilidade do inóculo, sendo os maioresnúmeros registrados para a CTC 16.

26 – SUSCETIBILIDADE DE GENÓTIPOS DE CANA-DE-AÇÚCAR A Pratylenchus brachyurus E P. zeae[SUCEPTIBILITY OF SUGARCANE GENOTYPES TO Pratylenchus brachyurus AND P. zeae] Santos, D.A.1; Dias-Arieira,C.R.1; Souto, E.R.1; Milani, K.F.1; Biela, F.1, Ortiz, T.1; Silva, M.L.1 1Universidade Estadual de Maringá, Campus Regionalde Umuarama, C. P. 65, 87501-970 Umuarama, Paraná, Brazil. E-mail: [email protected]

Na região Noroeste do Paraná, os nematóides de lesõesradiculares são frequentemente recuperados em amostrasde solo e raízes de cana-de-açúcar, geralmente compopulações bastante elevadas. O controle químico tem sidoo método empregado na região, porém, é necessário a buscapor alternativas de controle, mais seguras e econômicas.Neste contexto o uso de variedades resistentes assume umpapel importante. Assim, o presente trabalho tem comoobjetivo avaliar em condições controladas, a suscetibilidadedos genótipos CTC 11, CTC 12, CTC 13, CTC 14, CTC15, CTC 16, CTC 17 e CTC 18 de cana-de-açúcar aosnematóides Pratylenchus zeae e P. brachyurus. Para isto, asmudas foram produzidas em câmaras de germinação e

bandejas contendo areia e, posteriormente, foramtransplantadas para vasos com capacidade para três litros.Após dez dias, foram inoculadas com suspensão contendo500 ovos dos respectivos nematóides. Decorridos 60 dias,as plantas foram avaliadas quanto ao peso fresco e seco daparte aérea, altura da planta, peso fresco das raízes e númerode ovos por sistema radicular, a partir do qual se calculou ofator de reprodução (FR=população final/população inicial).Para P. brachyurus, não houve diferença estatística entre o númerode nematóides na população final e todos apresentaram reaçãode suscetibilidade (FR>1). O mesmo foi observado para P.zeae, porém aqui a variedade CTC 17 apresentou número denematóides estatisticamente inferior às demais.

27 – ANÁLISIS HISTOPATOLÓGICO DE RAÍCES DE Vitis vinifera CULTIVAR CABERNET SAUVIGNONINFECTADAS POR Meloidogyne ethiopica, CHILE [ROOT HISTOPATHOLOGICAL ANALYSIS OF Vitisvinifera CULTIVAR CABERNET SAUVIGNON INFECTED BY Meloidogyne ethiopica, CHILE] Tordable, M.1; Lax, P.2;Doucet, M.E.2; Magunacelaya, J.C.3 1Morfología Vegetal, Universidad Nacional de Río Cuarto, 5800 Río Cuarto, Córdoba,Argentina; 2Centro de Zoología Aplicada, Universidad Nacional de Córdoba, Casilla de Correo 122, 5000 Córdoba,Argentina; 3Facultad de Ciencias, Universidad Católica de Valparaíso, Valparaíso, Chile. E-mail: [email protected]

Con el objetivo de definir el tipo de respuesta y precisar elgrado de asociación hospedador-parásito se analizaron

tejidos radicales de vid cv. Cabernet sauvignon, provenientesde la localidad El Huique, Municipio Santa Cruz (VI Región,



301

Chile), atacados por M. ethiopica. Trozos de raíces con y sinagallas fueron fijados en FAA y procesados siguiendotécnicas convencionales para microscopía óptica. Cortesdesparafinados fueron tratados con PAS para corroborarla presencia de polisacáridos en paredes celulares y dealmidón en citoplasmas. Se observaron agallas cilíndricasque no superaban los 5 mm de diámetro. En ellas, se detectóun importante aumento del cilindro central debido a lapresencia de tejido hiperplásico. Además, en esta zona, elnematodo indujo la formación de células gigantes (hastasiete por sitio de alimentación). Se distinguieron célulasgigantes en diferentes etapas de desarrollo: inicial,

diferenciada y no funcional. Los sitios de alimentaciónestaban inmersos en los radios más anchos del xilemasecundario; incorporaban en su formación células de esetejido provocando interrupción y reducción del mismocomo así también del cambium vascular. En estrecharelación con las células gigantes se encontraron hembrasdel nematodo, que debido al aumento del volumen de sucuerpo, dañaban los tejidos del cilindro central y de losestratos corticales de la raíz. El parásito desarrolló su ciclode vida completo incluida la formación de masas de huevos.El cultivar evaluado constituye un eficiente hospedador parala población de M. ethiopica en la localidad considerada.

28 – DISSIMILARIDADE GENÉTICA ENTRE GENÓTIPOS DE SOJA INOCULADOS COM Heteroderaglycines [ GENETIC DISSIMILARITY AMONG SOYBEAN GENOTYPES INOCULATED WITH Heterodera glycines]Matsuo, É.1; Sediyama, T.1; Oliveira, R.D.L.2; Cruz, C.D.3; Oliveira, R.C.T4; Nogueira, A.P.O.1; Ferreira, A.O.2 1UniversidadeFederal de Viçosa, Departamento de Fitotecnia, 36570-000 Viçosa, MG, Brasil; 2UFV, Departamento de Fitopatologia, 3

UFV, Departamento de Biologia Geral, 4UFV,Campo Experimental Bacuri. E-mail: [email protected]

O controle do nematóide de cisto da soja pode ser realizadoutilizando-se cultivares resistentes e rotação com plantasnão hospedeiras. A combinação dessas estratégias apresentabons resultados. Desta forma, objetivou-se avaliar adissimilaridade genética entre genótipos elites de soja[Glycine max (L.) Merrill], com adaptação para diferentesregiões, inoculados com nematóide de cisto, visando aescolha de genitores para cruzamentos. O experimento foiconduzido em condições de casa de vegetação daUniversidade Federal de Viçosa, no período de dezembro/2008 a janeiro/2009. Dos genótipos avaliados, trêsapresentaram reação de resistência e três de moderadaresistência ao nematóide de cisto, raça 3, os quais foramutilizados para estimar as distâncias generalizadas deMahalanobis. Estas foram agrupadas pelo métodohierárquico distância média entre grupos (UPGMA) emétodo de otimização de Tocher, utilizando-se o Programa

Genes. Foi verificada, pela análise de variância, diferençasignificativa entre os caracteres: número de fêmeas, índicede fêmeas, número de ovos, número de ovos por fêmea,fator de reprodução e altura de planta. Os métodos deagrupamentos demonstraram a formação de quatrogrupos distintos. Pelo método UPGMA foi possívelobservar que a menor dissimilaridade foi apresentadaentre BCR1070G229 e UFVS 2010 seguido porBCR945G114 e BCR1057G163. O genótipoBCR945G110 foi o mais divergente, dentre os avaliados,e possui resistência ao nematóide de cisto, raça 3. Diantedisto, é o mais indicado para cruzamentos com osgenótipos BCR132390 e BCR1057G163, visando aoincremento da resistência a H. glycines nas progêniesdesenvolvidas, uma vez que apresentaram reação demoderada resistência e são originadas de diferentesparentais. (CNPq e FAPEMIG)

29 – EFEITO DA RESISTÊNCIA GENÉTICA SOBRE O DESENVOLVIMENTO DE MACHOS E FÊMEASDE Heterodera glycines [EFFECT OF GENETIC RESISTANCE ON Heterodera glycines MALE AND FEMALEDEVELOPMENT] Araújo, F.G.1; Santos, L.C.1; Teixeira, R.A.1; Rezende Neto, U.R.1; Ferreira, C.S.1; Rocha, M.R.11Universidade Federal de Goiás, Escola de Agronomia e Engenharia de Alimentos, Laboratório de Nematologia, C. P.131, 74001-470 Goiânia, GO, Brazil. E-mail: [email protected]

O nematóide de cisto da soja, Heterodera glycines Ichinohe, éum dos principais problemas fitossanitários que afeta acultura da soja, Glicine max (L.) Merr., nos principais paísesprodutores desta oleaginosa. Com o objetivo de avaliar oefeito da resistência genética de cultivares comerciais desoja sobre o desenvolvimento de machos de H. glycines,quando a resistência é efetiva contra fêmeas, foram

realizados dois experimentos nos anos de 2007 e 2008.Foram avaliadas as cultivares suscetíveis BRSGO Araçu,BRSGO Jataí, BRSGO Luziânia, BRS Favorita RR, BRSValiosa RR, BRS Silvânia RR e as cultivares resistentesBRSGO Ipameri e BRSGO Chapadões. Plântulas pré-germinadas de soja foram transferidas para vasos com solonaturalmente infestado com H. glycines, raça 14, e, após 10

302 Vol. 33(4) - 2009


dias, parte das plantas permaneceram nos vasos paraavaliação de fêmeas e outra parte foi utilizada para instalaçãodo sistema hidropônico para avaliação de machos. Noensaio conduzido em 2008 as plantas foram divididasem três partes sendo a última destinada a coloração deraízes para contagem de juvenis e avaliação da taxa desobrevivência. As cult ivares resistentes sempremantiveram baixo número de fêmeas e machos com

exceção da cultivar BRSGO Ipameri que obteve altosíndices de machos. Somente as cultivares BRS FavoritaRR e BRS Silvânia RR obtiveram uma relação macho/fêmea de 1:1. As demais cult ivares suscet íveisapresentaram número maior de machos que o de fêmeascom proporções variando de 5 a 11:1. A taxa desobrevivência foi nula para ambas as cultivares resistentese variou de 6,75% a 35,00% para as cultivares suscetíveis.

30 – INOCULAÇÃO DE Meloidogyne javanica E SEU EFEITO NA CONCENTRAÇÃO DEISOFLAVONÓIDES EM GENÓTIPOS DE SOJA RESISTENTES E SUSCETÍVEIS A NEMATÓIDE[INOCULATION OF Meloidogyne javanica AND ITS EFFECT ON ISOFLAVONOID CONCENTRATION INSOYBEAN GENOTYPES] Silva, J.F.V.1; Veronezzi, G.1; Lima, C.G.1; Dias, W.1; Hoffmann-Campo, C.B.1 1Embrapa Soja,C. P. 231, 86001-970 Londrina, PR, Brasil. E-mail: [email protected]

Os nematóides do gênero Meloidogyne estão amplamentedisseminados no Brasil, onde M. javanica é a espécie maisfrequentemente associada a reduções na produção de soja.O uso de cultivares de soja resistentes é a principal formade controle desses nematóides. Para estudar o papel que osisoflavonóides desempenham na resistência, avaliou-se aformação dessas substâncias em genótipos resistentes esuscetíveis a nematóides, inoculados e não inoculados comM. javanica. Os genótipos PI 595099 (resistente) e BRS 133(suscetível) foram semeados em tubetes, mantidos em casa-de-vegetação da Embrapa Soja, Londrina, PR e inoculadoscom 7.200 juvenis por plântula, em orifício próximo àradícula, com cinco repetições de cada tratamento. Após48, 96, 168, 216 e 264 h da inoculação, foram coletadas asraízes de soja para extração dos compostos; comotestemunhas foram coletadas raízes dos genótipos seminoculação. As raízes foram maceradas em almofariz, emN2 líquido. Amostras de 100 mg foram pesadas e, após aadição de 1000mL de MeOH (90%), centrifugadas e secasem N2 gasoso. As amostras foram resolubilizadas, 1,5mLde 80% de MeOH e, após filtração foram injetadas noCromatrógrafo Líquido de Alta Performace (HPLC) paraanálise e quantificação. Comparando-se os espectros e ostempos de retenção obtidos nos cromatogramas dosextratos de raízes dos genótipos PI595099 e BRS 133 com

os dos padrões de isoflavonóides, observou-se a presençade daidzina, malonil-daidzina, acetil-daidzina (glicosídeos),daidzeína (aglicona) e gliceolinas. Daidzeína foi observadaem maior quantidade em raízes inoculadas com o nematóidenos dois genótipos, entretanto as concentrações forammaiores no resistente em todas as coletas. Em relação à dedaidzina, observou-se que a sua concentração nos extratosde raízes da PI 595099 inoculadas com nematóidesaumentou de 6,56 mg/g para 15,70 mg/g, nas análisesrealizadas 48h e 264h, respectivamente. Malonil daidzinaembora, em menor proporção, seguiu a mesma tendência,aumentando de 4,22 mg/g para 7,52 mg/g, nas mesmasdatas de coleta. Comparada com as demais isoflavonas,acetil daidzina foi observada em menor concentração emrelação e, geralmente, foi maior nos extratos das raízes daPI 595099 e BRS 133, coletadas 48h e 264h após ainoculação, respectivamente, não havendo, porém, diferençaentre extratos de plantas inoculadas ou não com M. javanica.Picos de gliceolinas foram observados em todas asrepetições, nos estratos e raízes da PI PI 595099. Assim, osresultados obtidos indicam que o genótipo resistente PI595099 responde à infecção do nematóide M. javanica atravésda produção de isoflavonoides, especialmente, dosglicosídeos daidzina e malonil daidzina e que,contrariamente ao esperado, a resposta é lenta.

31 – PENETRATION AND DEVELOPMENT OF Meloidogyne mayaguensis IN WATERMELON ROOTS[PENETRAÇÃO E DESENVOLVIMENTO DE Meloidogyne mayaguensis EM RAÍZES DE MELANCIA] Pontes, M.F.C.1;Pedrosa, E.M.R.1; Vicente, T.F.S.1 1Universidade Federal Rural de Pernambuco, Rua Dom Manoel de Medeiros s/n, DoisIrmãos, 52.171-900 Recife, PE, Brazil. Email: [email protected]

Tendo em vista a larga dispersão geográfica, dificuldadesde controle e os severos danos causados pelo nematóidede galhas Meloidogyne mayaguensis, a busca por variedadesresistentes tem se intensificado. Recentemente, sessenta

acessos do Banco de Germoplasma de melancia do Centrode Pesquisa do Trópico Semi-Árido da EMBRAPA foramavaliados para resistência a esse nematóide. Seis acessos(92-0221, 92-0223, PI244019, 92-385 (Pi -10 A))



303

pertencentes ao grupo Citrullus lanatus var. citróide e 92-0228, Tra 2, que pertencem ao grupo Citrullus lanatus var.lanatus apresentaram índice de galhas inferiores a três, sendopor essa razão considerados resistentes. O presente estudoteve como objetivo avaliar esses genótipos quanto àpenetração e desenvolvimento de M . mayaguensis,acompanhando a evolução dos juvenis do segundo estádio

até a forma adulta, aferindo a produção de ovos e índice degalhas. A cultivar Crinsom Sweet foi usada como padrãode susceptibilidade. O genótipo PI244019 destacou-sedos demais apresentando significativamente menorpenetração, taxa de desenvolvimento econsequentemente menor produção de ovos, semapresentar formação de galhas.

32 – REACTION OF Coffea spp. TO Meloidogyne mayaguensis [REAÇÃO DE Coffea spp. A Meloidogyne mayaguensis]Alves, G.C.S.1; Almeida, E.J.1; Santos, J.M.1 1Departamento de Fitossanidade, Faculdade de Ciências Agrárias e Veterinárias,Universidade Estadual Paulista, FCAV, UNESP, 14883–090 Jaboticabal, SP, Brazil. E-mail: [email protected]

Root-knot nematodes (Meloidogyne spp.) are the mostdestructive pest on coffee in Brazil as well as in otherproducer regions of the world. Among the species of root-knot nematodes in Brazil, Meloidogyne mayaguensis Rammah& Hirschmann causes severe damage in some crops,including perennial and annual ones. The nematode hasbeen found in areas where coffee was cultivated in the pastand, according to history, root-knot nematodes were amongthe causes for the substitution of the coffee crop bysugarcane. This study was carried out with the objective ofevaluating the responses of seven varieties of coffee (Obatã1669-20 IAC, IAC Apoatã 2258 (Coffea canephora), CatuaíAmarelo IAC 62, IAC 99 Catuaí Vermelho, Catucaí Amarelo17/02, Catucaí Vermelho 20/15 and Mundo Novo IAC379-19) to Meloidogyne mayaguensis. This experiment wasconducted in a greenhouse of the Departamento deFitossanidade at Faculdade de Ciências Agrárias eVeterinárias of the Universidade Estadual Paulista, Campusof Jaboticabal. The experimental design was completelyrandomized with seven treatments and six replications, eachone consisting of a pot with one coffee plant. Theidentification of the species was done according to the

morpho-anatomical study of males and females under lightmicroscope and SEM, and confirmed by the identificationof the esterase phenotype. A suspension of eggs and J2 ofthe nematode was obtained by grinding up the roots ofguava (Psidium guajava L.) heavily infected by the nematodein a blender with NaClO 0.5%, and passing the suspensionthrough a 200 mesh sieve onto another 500 mesh (0.025mm). The eggs and J2 retained on the second sieve werecollected in a beaker of 500 mL in an aqueous suspension andthe concentration was adjusted to 400 eggs and J2 by mL.Then, 10 mL of this suspension was applied on the roots ofthe each young coffee plant as they were being planted in potswith a heat-treated mixture of sand and soil in the greenhouse.In order to check the viability of the inoculum, six individualtomato plants (Solanum lycopersicum L.) cv. Santa Cruz Kadawere also inoculated under the same procedure. After 240 daysall the stages of the nematode were recovered from the rootsof coffee seedlings and the reproduction factor was calculated(RF = Pf / Pi, Pf being the final population and Pi the initialpopulation that was inoculated on each plant). The datarevealed that all cultivars of coffee tested had a FR < 1 andare not hosts of Meloidogyne mayaguensis.

33 – QUANTIFICATION OF RESISTANCE TO ROOT-KNOT NEMATODES IN LOCAL SOYBEANGERMPLASM [QUANTIFICAÇÃO DA RESISTÊNCIA AOS NEMATÓIDES DE GALHAS EM GERMOPLASMADE SOJA LOCAL] Fourie, H.1; Mc Donald, A.H.1; Mienie, C.M.1; Waele, D.2 1Agricultural Research Council-Grain CropsInstitute, Private Bag X1251, Potchefstroom, 2520, South Africa; 2Catholic University of Leuven, Laboratory of Tropicaland Crop Improvement, Kasteelpark Arenberg 13, 3001 Leuven, Belgium. E-mail: [email protected]

Host plant resistance to root-knot nematodes is a usefuland cost-effective tool for optimization of soybean yieldas well as profitability of the crop. Locally no nematicide iscurrently registered on soybean and most crops used insoybean rotations are also susceptible to M. incognita race 2and M. javanica. These root-knot nematode species arepredominant parasites of soybean in South Africa.Subsequently local and foreign soybean genotypes wereevaluated for resistance to this nematode species in

greenhouse experiments. In addition, root-knot nematoderesistance were verified, introgressed in high-yieldingcultivars and molecular markers developed to expedite thebreeding process. To date six local cultivars and one linehave been identified with resistance to M. incognita race 2,while four local cultivars have been identified as beingresistant to M. javanica. Local cultivars LS5995 and Gazelleexhibited superior resistance to M. incognita race 2 and M.javanica, respectively, and this has been consistently verified

304 Vol. 33(4) - 2009


under microplot and field. Data on the quantitativerelationships between soybean crop performance and initialpopulation densities of M. incognita race 2 obtained in hailnetcage and microplot studies showed that LS5995 has adamage threshold level that is 10 times higher than that ofa susceptible standard. According to pre- and post-infectional and histological studies, resistance in cultivarLS5995 is manifested in the inhibited development andreproduction of M. incognita race 2. It was identified as post-infectional antibiosis resistance. Molecular markers were

linked to M. incognita race 2 and M. javanica resistance incultivars LS5995 and Gazelle, respectively. These markersare currently used in a marker-assisted breeding programme(MAS) to expedite the breeding process. In addition, thesemarkers have also been verified in a number of exotic andlocal soybean genotypes. Results from this study showedthat root-knot nematode resistance is present in local,commercial cultivars and that MAS could be used in abreeding program using the markers that were identifiedand validated in this study.

34 – HOSPEDABILIDADE DE MAMOEIROS PÉ-FRANCOS E ENXERTADOS À NEMATÓIDES [HOSTSTATUS OF GRAFTED AND NON-GRAFTED PAPAYA TREE TO NEMATODES] Barbosa, K.A.G.1; Garcia,R.A.2; Santos, L.C.1; Teixeira, R.A.1; Rocha, M. R.1; Lima, L.A.3; Naves, R.V.3; Cunha, M.G.2 1Universidade Federal deGoiás, Escola de Agronomia e Engenharia de Alimentos, C. P. 131, 74001-470 Goiânia, GO, Brazil; 1Laboratório deNematologia; 2Departamento de Fitossanidade; 3Setor de Horticultura. E-mail: [email protected]

A cultura do mamão é hospedada por vários gêneros defitonematóides, entretanto o gênero Meloidogyne é o que podeocasionar as maiores perdas em produtividade. O gêneroPratylenchus pode ocorrer na cultura, mas com menorfrequência. Contudo, faltam estudos sobre ahospedabilidade de cultivares e híbridos de mamão aosgêneros Meloidogyne e Pratylenchus. Desta forma, este estudoteve como objetivo avaliar a hospedabilidade das cultivaresde mamoeiro Golden e Sunrise Solo e do híbrido TainungF2 a nematóides. Foram conduzidos dois experimentos,sendo um em condições de campo, em um mamoal comum ano de idade e solo naturalmente infestado, avaliando-se as cultivares e o híbrido em sistema de pé-franco eenxertados sobre Tainung F2. Para isso, foram coletadasamostra de solo e raízes, que foram submetidas a extração,

identificação e contagem de nematóides. O outroexperimento foi conduzido em casa de vegetação cominoculação artificial (M. incognita - 4000 ovos + J2 por planta;P. brachyurus - 4000 ovos + J2 por planta e M. incognita + P.brachyurus - 2000 + 2000 ovos + J2 por planta) nas cultivaresGolden e Sunrise Solo e no híbrido Tainung F2 propagadospor sementes. Em campo, os fitonematóides Meloidogyne sp.,Rotylenchulus sp., Rotylenchoides sp. e Helicotylenchus sp. foramos mais frequêntes, não havendo diferença significativa entrecultivares e híbrido de mamoeiro pé-franco e enxertadosquanto à hospedabilidade a estes fitonematóides. Em casade vegetação, houve maior hospedabilidade das cultivarese do híbrido a M. incognita do que a P. brachyurus e a misturadas duas espécies. Não houve diferença significativa entreos cultivares e o híbrido.

35 – STUDY OF THE HOST-PATHOGEN RELATIONSHIPS OF Meloidogyne incognita (KOFOID &WHITE) CHITWOOD, M. javanica (TREUB) CHITWOOD AND Pratylenchus brachyurus (GODFREY)FILIPJEV & SCHUURMANS STEKHOVEN IN SUGAR CANE [INTER-RELAÇÕES PATÓGENO-HOSPEDEIRO DE Meloidogyne incognita (KOFOID & WHITE) CHITWOOD, M. javanica (TREUB) CHITWOOD EPratylenchus brachyurus (GODFREY) FILIPJEV & SCHUURMANS STEKHOVEN EM CANA-DE-AÇÚCAR] Barbosa,B.F.F.¹; Santos, J.M.1 1UNESP, Faculdade de Ciências Agrárias e Veterinárias, 14884-900 Jaboticabal, SP, Brazil. E-mail:[email protected]

In Brazil, Pratylenchus zeae, Meloidogyne javanica and M. incognitaare the key species for sugar cane. In two experimentscarried out in pots in a greenhouse in Jaboticabal city, onewith duration of 12 months and another for 75 days, therelationships of M. incognita, M. javanica and P. brachyurus,involving 10 varieties of sugar cane, were studied. Theresistance of the varieties varied significantly in relation tothe nematodes. While the rate of increase of M. javanica inSP911049 variety has been lower than that of M. incognita,

the data suggest that M. javanica is more aggressive. Theparasitism of M. javanica and M. incognita to ‘SP911049’predisposes that variety to attack of Saccharicoccus sacchari.The biometric variables used in this study, the mass of freshmatter of the above-ground part and the mass of freshmatter of roots confirm the greater aggressiveness of M.javanica to variety SP911049, than M. incognita. Among thevarieties tested, SP891115 is the only one resistant to M.incognita and none of them are resistant to M. javanica.



305

Among these, RB855453 is the least susceptible to M.javanica and SP801816 is the most susceptible to the threespecies of nematodes included in the study. Varieties CTC2,SP832847, RB855156, SP803280, CTC9, SP911049,

SP891115 and RB855453 are resistant to P. brachyurus andonly variety SP801816, among the nine varieties tested, issusceptible. Also, the nematode adversely affected the valuesof all variables considered in the evaluations.

36 – VIABILIZAÇÃO DE ÁREAS INFESTADAS PARA O CULTIVO DE CAFÉ ATRAVÉS DA TECNOLOGIA“KIT DE RESISTÊNCIA AOS NEMATÓIDES” [RECUPERATION OF INFESTED AREAS FOR COFFEECULTIVATION USING THE “NEMATODE RESISTANCE KIT”] Ito, D.S.1,2; Sera, T.1; Santiago, D.C.2; Alegre, C.R.1;Kanayama, F.S.1; Del Grossi, L.1; Shigueoka, L.H.1; Rocha, V.P.C.1; Sera, G.H.1 1Instituto Agronômico do Paraná, C. P. 481,86047-902 Londrina, PR, Brazil; 2Universidade Estadual de Londrina, C. P. 6001, 86051-990 Londrina, PR, Brazil. E-mail:[email protected]

A cafeicultura brasileira tem sofrido consideráveis prejuízosdevido à presença dos nematóides, que ocasionam grandesperdas na produtividade, podendo levar à morte da planta.O objetivo deste trabalho é promover a viabilização de áreasinfestadas através do “kit de resistência aos nematóides”,permitindo indicar com rapidez e baixo custo, cultivaresde café suscetíveis para áreas isentas de nematóides ecultivares resistentes ou parcialmente resistentes para áreasinfestadas. Este kit é composto por seis cultivares que serãoindicadas para plantio de acordo com a resistênciaapresentada nas propriedades rurais. A metodologia divide-se em 12 etapas: 1ºos agricultores recebem seis cultivaresde café com possível resistência, junto dos padrõessuscetível (“Mundo Novo”) e resistente (‘Apoatã IAC 2258’),além de quiabo (indicador suscetível). 2º arrancar oscafeeiros em área com alta infestação; 3º fazer um canteirocom as raízes e terra de cafeeiros infestados; 4º plantar cadamaterial em uma linha. Fazer cobertura e manter sempreúmido; 5º semear entre as linhas de café o quiabo; 6º emárea potencial para o cultivo de café da propriedade, semearo quiabo a cada metro de distância. Avaliar visualmente asraízes após três meses. Mapear a propriedade indicandoonde foram constatadas galhas e áreas livres de nematóides;7º na área infestada por nematóides, dividir a área totalpara café em quatro a dez partes. Iniciar imediatamente aredução populacional de nematóides nos primeiros 1/4 a

1/10 com plantio de espécies resistentes a estes nematóidese controlar a erosão e ervas daninhas; 8º após 90 dias doplantio, arrancar 20 das 25 plantas de cada linha. As cincoplantas restantes serão mantidas no local para futurasavaliações; 9º colocar as plantas de cada linha com um poucode terra em sacos plásticos identificados; 10º devolver oscafeeiros e o quiabo para análise em laboratório; 11º seencontrar cultivares resistentes, encomendar mudas; 12ºavaliar a presença de resistência ou suscetibilidade nas cincomudas restantes, comparando-se o vigor, tamanho dasplantas e o sistema radicular dos cafeeiros no 6°e 12º mêstendo como padrão as testemunhas suscetíveis. Foramdistribuídos “kits de resistência” entre novembro edezembro de 2006 a diversos produtores localizados naregião Norte do Paraná. O experimento foi composto por20 repetições, sendo cada cultivar representando umtratamento com parcela mínima de 10 plantas. Os dadosforam submetidos à análise de variância, em blocos ao acasoe as médias comparadas pelo teste de Tukey a 5%. Ascultivares foram avaliadas após seis meses para contagemde galhas e massas de ovos (GO) e volume radicular. Ascultivares IPR 100 e IPR 106 (Coffea arabica) foramestatisticamente iguais ao padrão de resistência ‘ApoatãIAC 2258’ (Coffea canephora), podendo ser indicadas comsucesso para viabilização dessas propriedades com áreasinfestadas.

37 – HOST SUITABILITY OF PEPPER CULTIVARS TO Nacobbus aberrans POPULATIONS FROMARGENTINA [REAÇÃO DE CULTIVARES DE PIMENTÃO QUANTO AO PARASITISMO DE POPULAÇÕESDE Nacobbus aberrans DA ARGENTINA] Lax, P.1; Doucet, M.E.1; Braga, R.2; Kobori, R.F.2 1Centro de Zoología Aplicada,C.C. 122, 5000 Córdoba, Argentina; 2Sakata Seed Sudamerica Ltda, SP, Brazil, Cxp. 12906-840, Bragança Paulista, SP,Brazil. E-mail: [email protected]

In several localities of the American continent, N.aberrans produces severe damage to pepper crops in fieldand greenhouses. Host suitability of three pepper cultivars(carrying genes resistant to Meloidogyne spp.) to N. aberranspopulations from Argentina was evaluated. The nematodes

were from the localities of Río Cuarto (RC) and LisandroOlmos (LO), Córdoba and Buenos Aires, respectively. Thecultivars considered were: AF 8724, AF 8765 (both carryingthe Me 1 gene) and AF 2739 (carrying the Me 7 gene);tomato Platense, which is susceptible to the nematode

306 Vol. 33(4) - 2009


species, was used as control. The experiment was conductedin greenhouse conditions at a mean temperature of 25 °C;six replications per cultivar were performed. Each plantwas inoculated with 100 second-stage juveniles at planting.The nematode Reproduction Factor (RF=final density/initial density) was estimated 100 days after inoculation.Both populations reproduced abundantly on all peppercultivars (RF ranging between: 25.1-30.4 for RC and 22.8-36.9 for LO). In the case of LO population, AF 8765 and

AF 2739 yielded RF values higher than those obtained fortomato. No significant differences between populationswere observed in the different cultivars analyzed (includingthe control one) or between cultivars for a single nematodepopulation. The genes Me 1 and Me 7 did not conferresistance to infection by the nematode populationsconsidered. Because N. aberrans is polyphagous and has highreproductive potential, encouraging research aimed atselecting resistant cultivars is of great importance.

38 – VIRULENCE IN Meloidogyne AND HOST RESISTANCE [VIRULÊNCIA EM Meloidogyne E RESISTÊNCIADE HOSPEDEIROS] Robertson, L.2; López Pérez, J.A.3; Díez-Rojo, M.A.1; González López, M.R.1; Castro Lizazo, I.4;Arcos, S.C.1; Lopéz Borrego, M.M.1; Martínez, C.1; Bello, A.1 1Departamento Agroecología, Centro de CienciasMedioambientales, CSIC, Madrid, Spain; 2Dpto Biodiversidad y Biología Evolutiva, Museo Nacional de Ciencias Naturales,CSIC, Madrid, Spain; 3Centro Agrario de Marchamalo, JCCM, Guadalajara, Spain; 4Universidad Agraria de La Habana“Fructuoso Rodríguez Pérez”, San José de Las Lajas, Cuba. E-mail: [email protected]

The characterization of virulence in Meloidogyne populationsis based mainly on the use of biotests, the most widelyutilized being the North Carolina differential host test ofHartman & Sasser (1985). A modification of the biotest,with the inclusion of resistant tomato cv Euphrates, carryingthe Mi gene and resistant pepper cv Atlante containing theN gene has allowed us to better characterize the virulencein M. incognita, M. javanica, M. arenaria & M. hapla populationsfrom Spain. A total of 27 biotypes have so far been foundin Spain: 21 M. incognita, 2 M. javanica, 4 M. arenaria. None

of the M. javanica populations were found to parasitizesusceptible or resistant pepper cultivars tested in Spain. Thesecretions of plant parasitic nematodes have beenimplicated in penetration of host plant roots, movementof the nematode through the plant, protection from activeoxygen species, feeding site induction, feeding sitemaintenance and are thought to contain virulence factors;therefore, the characterization of Meloidogyne populationsand model plant systems are seen as a pre-requisite for futuremolecular and biochemical studies.

39 – DINÂMICA NUCLEAR DE CÉLULAS GIGANTES INDUZIDAS POR Meloidogyne mayaguensis EMRAÍZES DE MELANCIA [NUCLEAR DYNAMICS OF GIANT CELLS INDUCED BY Meloidogyne mayaguensis INWATERMELON ROOTS] Pontes, M.F.C.1; Pedrosa, E.M.R.1; Guimarães, L.M.P.1; Chaves, A.1 1Universidade FederalRural de Pernambuco, Rua Dom Manoel de Medeiros s/n, Dois Irmãos, 52.171-900 Recife, PE, Brazil. E-mail:[email protected]

A região Nordeste é atualmente um dos grandes produtoresde frutas do país e o Submédio do Vale do São Francisco,devido às condições climáticas favoráveis e à irrigação,destaca-se como um grande produtor de cucurbitáceas,principalmente, melão (Cucumis melo) e melancia (Citrullusvulgaris). O assinalamento e rápida disseminação deMeloidogyne mayaguensis nessas áreas representam significativaameaça para o cultivo de cucurbitáceas devido à severidadede danos, inexistência de cultivares resistentes e de medidasde controle efetivas. Em estudos preliminares, seis genótiposde melancia 92-0221, 92-0223, PI244019, 92-385 (PI-10A) e 92-0228, pertencentes ao grupo Citrullus lanatus var.

Citroide, e Tra 2, pertencente ao grupo Citrullus lanatus var.lanatus apresentaram baixos índices de galhas e número deovos por sistema radicular. O presente estudo teve comoobjetivo examinar o número de núcleos em células gigantesdesses genótipos e a taxa na qual eles aumentam aos 5, 10,15 e 20 dias após a inoculação, aferindo a fecundidade eprodução de ovos. A cultivar Crinsom Sweet foi usada comopadrão de susceptibilidade. Os genótipos 92-0221 ePI244019 apresentaram as mais baixas taxas de reproduçãodo nematóide e, consistentemente, menor número denúcleos por células gigantes, confirmando reação deresistência.



307

40 – EFFECT OF THE MI GENE ON REPRODUCTION OF Meloidogyne hispanica ON TOMATOGENOTYPES [EFEITO DO GENE MI NA REPRODUÇÃO DE Meloidogyne hispanica EM GENÓTIPOS DETOMATEIRO] Maleita, C.M.1; Curtis, R.H.C.2; Abrantes, I.M.O.1 1IMAR, CMA and Departamento de Zoologia, Faculdadede Ciências e Tecnologia, Universidade de Coimbra, 3004-517 Coimbra, Portugal; 2Nematode Interactions Unit, PlantPathology and Microbiology Department, Rothamsted Research, Harpenden, Hertfordshire, AL5 2JQ, United Kingdom.E-mail: [email protected]

Tomato resistance against root-knot nematodes (RKN) hasbeen investigated and the Mi gene was found to be themost effective and environmentally safe method to controlthe three most common Meloidogyne spp.: M. arenaria, M.incognita and M. javanica. In the 1940s the RKN resistancegene was introgressed into the cultivated tomato from thewild species Solanum peruvianum L. The objectives of thisstudy were to screen the RKN resistance Mi gene in twentytomato genotypes, by amplification of marker REX 1 as aSCAR; and evaluate the ability of M. hispanica to reproduceon these tomato genotypes. Amplification of REX-1 markergave a DNA fragment of 750 bp and restriction of theamplified PCR products from each tomato genotype withTaqI enzyme resulted in one (mimi), two (MiMi) or three(Mimi) bands of approximately 750, 570 and 160 bp,indicating the absence or presence of the Mi gene. Ten

heterozygous tomato genotypes (Mimi), ten homozygous(MiMi) at the Mi locus and six lacking the Mi gene forresistance to RKN were identified. Host suitability wasassessed 60 days after inoculation with 5000 eggs/second-stage juveniles on the basis of root gall index (GI) andreproduction factor (Rf). Easypeel was used as a control.Only the genotype Rapit (Mimi) was consideredhypersensitive; the nematode induced galls on the roots(GI>2), but often could not complete the life cycle, withRf<1. The Rf values of M. hispanica for remaining MiMi,Mimi and mimi genotypes were more than one, whichindicates a “good host” status. However, reproduction ofthe nematode was higher on genotypes lacking the Mi geneand heterozygous than on homozygous genotypes. M.hispanica is virulent to Mi gene in tomato and limits theirusefulness to manage this nematode.

41 – RESPONSE OF WHITE CLOVER CV. UFWC-5 TO FOUR ROOT-KNOT NEMATODE SPECIES[RESPOSTAS DO TREVO BRANCO CV. UFWC-5 A QUATRO ESPÉCIES DO NEMATÓIDE DE GALAS] Mendes,M.L.1; Ostmark, E.R.2, Dickson,D.W.1 1Entomology and Nematology Department; 2Agronomy Department, Universityof Florida, Gainesville, FL 32611, USA

Root-knot nematodes (RKN) (Meloidogyne spp.) are the mostimportant nematode pathogens of white clover (Trifoliumrapens L.). These nematodes greatly limit its production inthe southern region of the United States, where clover isgrown as a major forage crop. The objective of this studywas to compare the response of ‘UFWC-5’, a RKN tolerantcultivar, to Meloidogyne hapla, M. javanica race 3, M. mayaguensis,and M. floridensis. The latter three are recently reportedspecies in Florida. The experiment was carried out in anenvironmental growth room. The experiment was acompletely randomized design with 12 replications. Tomatocv. Rutgers was included as a susceptible host for all fourRKN. The plants were grown in cone tubes (20 cm height

× 4 cm diameter) each filled with autoclaved sand. Fiveweeks after germination the plants were inoculated with1,000 eggs and/or second-stage juveniles of each of thefour nematodes. Seventy days after the inoculation theplants were uprooted to determine the amount ofnematode galling and reproduction. All four species ofRKN reproduced on the clover cultivar but Meloidogynehapla produced the largest final population density andreproduction factor (77.57) as well as the highest numberof gal ls and eg g masses (both over 100). Thereproductive factor for the three other species is asfollows M. javanica at 18.22, M. mayaguensis at 5.94, andM. floridensis at 2.89.

42 – REACTION OF MARIGOLD GENOTYPES TO THREE NEW ROOT-KNOT NEMATODESOCCURRING IN FLORIDA [REAÇÃO DE GENÓTIPOS DE CRAVO DE DEFUNTO A TRÊS NOVASESPÉCIES DO NEMATÓIDE DE GALHAS] Mendes, M.L.1; Kaur, R.1; Dickson, D.W.1 1University of Florida,Entomology and Nematology Department, Gainesville, FL, USA.

The host status of 20 marigold (Tagetes erecta and T. patula)genotypes to Meloidogyne mayaguensis, M. floridensis and M.

javanica race 3 were evaluated under greenhouse conditions.The experiment was carried out in a completely randomized

308 Vol. 33(4) - 2009


43 – RESPONSE OF SOYBEAN CULTIVARS TO Meloidogyne javanica IN TUCUMÁN, ARGENTINA[RESPOSTA DE CULTIVARES DE SOJA A Meloidogyne javanica EM TUCUMAN, ARGENTINA] Coronel, N.1; Devani,M.1 1Estación Experimental Agroindustrial Obispo Colombres, C.P. T4101XAC Tucumán, Argentina. E-mail:[email protected]

Soybean [Glycine max. (L.) Merr.] is severely damaged byroot-knot nematodes (Meloidogyne spp.) in Tucumán,Argentina. This pest has been found in several plots of thisprovince causing low yields in commercial soybeans. Croprotation with nonhost crops and the use of resistant varietiesare current tactics to control this nematode. Theinformation on the response of soybean cultivars to root-knot nematodes is limited in this area. Therefore, theobjective of this study was to evaluate the reaction ofcommercial cultivars of soybean to a population of M.javanica. Six seedlings of each cultivar were inoculated with500 eggs and juveniles of a population of M.javanica from

La Invernada, Tucumán. The seedlings were maintained ingreenhouse at 25 ± 5ºC. Forty-five days after inoculationthe plants were removed and the roots were carefullywashed. The number of root galls were counted and thegall index(GI) was assessed according to a (0-5) scale. Thecultivars of soybean were considered resistant when thegall index was ≤ 2. All cultivars tested were susceptible toM. javanica, gall index ranged between 2.7 and 4.7. Additionalresearch is required to evaluate other soybean cultivars toattack of root-knot nematode. This information could beuseful to advise growers on the choice of cultivars to beused in fields infested with this nematode.

44 – AVALIAÇÃO DA RESISTÊNCIA DE GENÓTIPOS DE SOJA (Glycine max) AO NEMATÓIDEPratylenchus brachyurus [EVALUATION OF RESISTANCE IN SOYBEAN GENOTYPES (Glycine max) TO THENEMATODE Pratylenchus brachyurus] Ribeiro, N.R.1; Barbosa, L.B.2; Silveira, T.F.1; Lima, C.P.1; Silva, C.S.1; Silva, A.P.L.11Associação dos Produtores de Sementes de Mato Grosso, C. P. 81 78745-420 Rondonópolis,MT, Brazil; 2Centro deEnsino Superior de Rondonópolis, Anhanguera 78740-185, Rondonópolis, MT. E-mail:[email protected]

Nas últimas safras, o nematóide das lesões radiculares(Pratylenchus brachyurus) tornou-se um grande problema nacultura da soja na Região Centro-Oeste do Brasil. Uma dasmedidas de menor custo e de maior aceitação pelosagricultores é a utilização de cultivares resistentes.Entretanto cultivares de soja com alto nível de resistênciaainda não foram identificadas. Este trabalho teve comoobjetivo a avaliação da resistência de genótipos de soja a P.brachyurus. A reprodução de P. brachyurus, foi estudada em16 genótipos. O experimento foi conduzido em casa-de-vegetação da Aprosmat, em Rondonópolis-MT, no ano de2008. Os genótipos foram semeados em areia, e cerca detrês dias após a emergência as plântulas foram transferidaspara vasos de argila com capacidade para 1000 ml de solo,contendo a seguinte mistura de solo: areia (1:3), previamente

autoclavada. Uma semana depois do transplante cadaplântula foi inoculada com 600 espécimes do nematóide.O delineamento foi inteiramente casualizado com 6repetições. A avaliação ocorreu aos 90 dias após ainoculação e consistiu em determinar o fator dereprodução (FR) do nematóide em cada um dosgenótipos. Nenhum dos genótipos avaliados mostrou-se resistente (FR<1,0) ao nematóide. Porém, observou-se variabilidade entre os mesmos, com FR variando de2,2 a 9,9. Diversas cultivares recomendadas para a regiãoCentro Oeste como M-SOY 8757, BRS-Valiosa, MG-BR-46 Conquista, Esperança e M-SOY 8360RRapresentaram bons níveis de tolerância. Genótipos comníveis mais baixos no FR devem ser preferidos para asemeadura em áreas infestadas.

design with five replicates. ‘Rutgers’ tomato (Solanumlycopersicon) was included as a susceptible host to eachnematode species. The inoculum consisted of 10,000 eggsand/or second-stage juveniles of M. mayaguensis, M. floridensisand M. javanica race 3 per plant. Sixty-five days afterinoculation the plants were harvested and the number ofgalls and egg masses per root system recorded. All marigoldgenotypes were immune to M. mayaguensis and either

immune or highly resistant to M. floridensis and M. javanicarace 3. The size of galls induced by the latter two nematodeswas unusually inconspicuous. The average number of galland egg mass ranged from 0.4 to 1.4 for M. floridensis, onsix genotypes, and from 0.2 to 1.0 for M. javanica race 3, onfour genotypes. Tomato roots were heavily infected by allthree nematode species with each having mean gall andegg mass ratings greater than 100.



309

45 – AVALIAÇÃO DA RESISTÊNCIA DE GENÓTIPOS DE MILHO (Zea mays L.) AO NEMATÓIDEPratylenchus brachyurus [EVALUATION OF RESISTANCE IN CORN GENOTYPES (Zea mays L.) TO THENEMATODE Pratylenchus brachyurus] Ribeiro, N.R.1; Bezerra, F.F.2; Silveira, T.F.1; Lima, C.P.1; Silva, C.S.1; Silva, A.P.L.11Associação dos Produtores de Sementes de Mato Grosso, C. P. 81 78745-420 Rondonópolis, MT, Brasil; 2Centro deEnsino Superior de Rondonópolis, Anhanguera 78740-185 Rondonópolis, MT, Brasil. E-mail: [email protected]

Nos últimos anos, em função do monocultivo de cultivaressuscetíveis e ou de rotação/sucessão mal planejadas, temsido freqüente nas lavouras de soja brasileiras a ocorrênciade danos causados pelo nematóides das lesões Pratylenchusbrachyurus. A identificação de cultivares de milho que nãomultipliquem P. brachyurus é fundamental para asrecomendações de manejos. O presente trabalho teve comoobjetivo a avaliação da resistência de genótipos de milho aP. brachyurus. A reprodução de P. brachyurus foi estudada em17 genótipos de milho. O ensaio foi conduzido em casa-de-vegetação, na APROSMAT, em Rondonópolis-MT, noano de 2008. Os genótipos foram semeado em vaso decerâmica contendo substrato esterilizado(3 partes de areiae uma de solo), e inoculado com 600 espécimes por vaso.

Plantas de quiabeiro e Crotalaria spectabilis foram utilizadaspara confirmar a viabilidade do inóculo. O delineamentofoi inteiramente casualizado com 6 repetições. A avaliaçãoda reprodução dos nematóides foi feita aos 90 dias após ainoculação, através da contagem do número de ovos nosistema radicular das plantas de cada genótipo, calculando-se o Fator de Reprodução (FR=PF/PI, sendo PF apopulação final de nematóides e PI a população inicial).Nenhum dos genótipos de milho avaliados mostrou-seresistente (FR<1,0) ao nematóide. Entretanto, observou-se variabilidade entre os mesmo, com FR variando de 3.08a 16) para fins de controle do nematóide, os genótipos comFR menores são os mais adequados para semeadura emáreas infestadas.

46 – AVALIAÇÃO DA RESISTÊNCIA DAS CULTIVARES IPR 100, IPR 106 E TUPI IAC 1669-33 ÀS DIVERSASCONCENTRAÇÕES DE INÓCULO DE Meloidogyne paranaensis [EVALUTION OF RESISTANCE OF COF-FEE CULTIVARS IPR 100, IPR 106 AND TUPI IAC 1669-33 USING DIFFERENT Meloidogyne paranaensis INOCU-LUM CONCENTRATIONS] Ito, D.S.1,2; Sera, T.1; Santiago, D.C.2; Alegre, C.R.1; Sera, G.H.1; Shigueoka, L.H.1 1InstitutoAgronômico do Paraná, C.P. 481, 86047-902 Londrina, PR, Brazil; 2Universidade Estadual de Londrina, C.P. 6001, 86051-990, Londrina, PR, Brazil. E-mail: [email protected]

A redução da produção brasileira de café devido à açãodos fitonematóides do gênero Meloidogyne é estimada em 15%. As espécies mais prejudiciais são M. exigua, pela ampladistribuição geográfica, e M. paranaensis e M. incognita pelaintensidade dos danos que causam. Fontes de resistência aM. incognita e M. paranaensis vêm sendo encontradas emgenótipos de Coffea canephora e C. congensis . Em híbridosinterespecíficos derivados do cruzamento entre C. arabicae C. canephora como em plantas do germoplasma Icatu,Sarchimor e Catimor têm sido constatadas fontes deresistência a M. paranaensis e M. exigua. O objetivo destetrabalho foi avaliar a resistência das cultivares de café IPR100, IPR 106 e Tupi IAC 1669-33 ao nematóide M.paranaensis em diferentes concentrações de inóculo. Oexperimento foi instalado em casa de vegetação no IAPAR,em agosto de 2007, no esquema fatorial 1 x 6 em blocoscasualizados, quatro repetições e cinco tratamentosformados pelas cultivares IPR 100; IPR 106 e Tupi IAC1669-33. Como padrão resistente, foi utilizada a ‘ApoatãIAC 2258’ e padrão suscetível a cultivar Ouro Verde. As

sementes das cultivares foram germinadas em areia erepicadas no estádio “palito de fósforo” para copos plásticosde 700 mL, totalizando uma planta por parcela em cadacopo. A inoculação ocorreu 40 dias após a repicagem, emseis níveis, sendo: nível 1 = controle ausente de inoculação;nível 2 = 750 ovos; nível 3 = 2250 ovos; nível 4 = 3250ovos; nível 5 = 4500 ovos; e nível 6 = 7000 ovosaproximadamente, distribuídos ao redor das plantas. Aavaliação foi realizada 240 dias após as inoculações, atravésda contagem de massas de ovos (Os). Foi utilizada umaescala de notas de 1 a 6, sendo: nota 1 = ausência de Os;nota 2 = 1 a 2 Os; nota 3 = de 3 a 10 Os; nota 4 = de 11 a30 Os; nota 5 = de 31 a 100 Os; nota 6 = mais de 100 Os.Os dados obtidos foram transformados e submetidos àanálise de variância, sendo as médias comparadas pelo testede Tukey a 5 % de significância. Foi possível verificar aresistência parcial das cultivares IPR 106, Apoatã IAC 2258e IPR 100 em altas concentrações de inóculo, podendo a‘IPR 106’ ser indicada para plantio em áreas infestadas comalta densidade populacional de M. paranaensis.

310 Vol. 33(4) - 2009


47 – HISTOPATOLOGIA DE GALHAS INDUZIDAS POR Ditylenchus gallaeformans EM FOLHAS DEMiconia ibaguensis [HISTOPATHOLOGY OF GALLS INDUCED BY Ditylenchus gallaeformans IN Miconia ibaguensisLEAVES] Santin, A.M.1; Oliveira, R.D.L.1; Seni, D.J.1; Azevedo, A.A.2 1Universidade Federal de Viçosa, Deptos. deFitopatologia, 36570-000 Viçosa MG, Brasil; 2UFV, Biologia Vegetal, E-mail: [email protected]

Ditylenchus gallaeformans causa deformações e galhas emfolhas e inflorescências de Melastomatáceas. Desde 2005,sua ocorrência foi observada em Miconia ibaguensis em Viçosa(MG), mas sua distribuição já é conhecida em outras regiõesdo Brasil e da Costa Rica. Sob condições controladas e nocampo, ele foi capaz de reproduzir-se em plantas de Clidemiasp., Leandra sp. e Miconia spp. O desenvolvimento dossintomas em M. calvescens no campo, uma importanteinvasora de ecossistemas nas ilhas do Pacífico, mostra queo nematóide pode reproduzir-se neste hospedeiro e poderádisseminar-se espontaneamente por áreas infestadas, emcaso de uma possível introdução para o controle biológicoda mesma. Devido a esse potencial de biocontrole,objetivou-se esclarecer as alterações na anatomia de folhasde micônia provocadas pelo ataque deste nematóide. Mudasde M. ibaguensis com aproximadamente 30 cm de altura,foram inoculadas com 10.000 nematóides (adultos ejuvenis), obtidos de plantas naturalmente infectadas. Ainoculação foi realizada na região apical utilizando-se adeposição da suspensão sobre pedaços de algodão. As

avaliações foram realizadas a cada cinco dias a partir dadata de inoculação. Do quinto ao vigésimo dia, a regiãoamostrada foi o meristema apical e do vigésimo quinto aotrigésimo quinto dia, as amostras foram coletadas das folhasjovens em expansão. Para cada período de avaliação foramcoletadas amostras de plantas sadias no mesmo estádio dedesenvolvimento para realizar as comparações anatômicas.As amostras foram fixadas, estocadas e incluídas emparafina. A análise comparativa dos cortes indicou que asgalhas foliares induzidas por D. gallaeformans eram originadasda hiperplasia de células do meristema fundamental nosprimórdios foliares. Essas galhas apresentavam cavidadesonde os nematóides habitavam, as quais eram ligadas aoambiente externo. Estas cavidades apresentavam em seuentorno, camadas de células com conteúdo celular denso,responsável pelo fornecimento de alimento para osnematóides. Não foi observada hipertrofia de células e nema formação de células especiais de alimentação. A formaçãode galhas só foi possível quando a infecção ocorria nosprimórdios foliares. (Apoio: FAPEMIG)

48 – HISTOLOGICAL MECHANISM OF THE RESISTANCE CONFERRED BY THE Ma GENE FROMMYROBALAN PLUM TO THE ROOT-KNOT NEMATODE Meloidogyne incognita [MECANISMOHISTOLÓGICO DA RESISTÊNCIA CONFERIDA PELO GENE Ma DA AMEIXEIRA AO NEMATÓIDE DASGALHAS, Meloidogyne incognita] Khallouk, S.1; Voisin, R.2; Van Ghelder, C.2; Engler, G.2; Amiri, S.1; Esmenjaud, D.2; 1EcoleNationale d’Agriculture, Mèknès; Morocco; 2Inra, UMR Interactions Biotiques et Santé Végétale, 06903 Sophia-Antipolis,France. E-mail: [email protected]

The Ma gene from Myrobalan plum confers a high-levelresistance to all root-knot nematodes of major economicimportance including M. incognita, M. javanica, M. arenariaand M. mayaguensis. A study was conducted to identify thehistological mechanism of the Ma resistance to M. incognitain the resistant (R) Myrobalan plum clonal accession P.2175carrying the Ma1 R allele (Ma1/ma). The susceptible (S)Myrobalan accession P.2032 (ma/ma) was used as susceptiblecontrol. Artificial inoculations of second-stage juveniles(J2s) were conducted in soil substrate on micropropagatedplantlets grown in mini-containers or 50-ml plastic tubesunder controlled conditions at 25°C in a growth chamber.Nematode penetration into the roots occurred in both Rand S accessions and confirmed results from a previous

study about the dynamics of penetration by Voisin et al.(1999). J2s moved via similar routes: they penetrated allalong the elongation zone, migrated downwards in thedirection of the apex until the meristematic apical region,then turned up and colonized the vascular cylinder (stele).In P.2175, a hypersensitive-like reaction (HR) blocking thenematode at the filiform second stage was observed.Necrotic cells surrounding the nematode were observed inthe vascular cylinder, the apical meristem and less frequentlyin the cortex. Under high nematode infestation, the apicalroot meristematic tissues were destroyed in the resistantaccession, which seemed to induce the development of sub-terminal newly-formed lateral rootlets replacing damagedterminal apices.



311

49 – REACTION OF ‘CONILON’ COFFEE PLANTS TO DIFFERENT POPULATIONS OF Meloidogynespp. [REAÇÃO DE CAFEEIROS ‘CONILON’ A DIFERENTES POPULAÇÕES DE Meloidogyne spp.] Carneiro,R.M.D.G.1; Santos, D.F.1; Costa, S.B.1; Sousa, F.R.1; Almeida, M.R.A.1; Santos, M.F.A.1; Siqueira, K.M.S.1; Tigano, M.S.1;Fonseca, A.F.A.2 1Embrapa Recursos Genéticos e Biotecnologia, C. P. 02372, 70849-970 Brasília, DF, Brazil; 2EmbrapaCafé, Incaper. C. P. 40315, 70770-901 Brasília, DF, Brazil. E-mail: [email protected]

The root–knot nematode, genus Meloidogyne, causes greateconomic impact on the production of coffee in Brazil. Inthe states of Paraná, São Paulo, Minas Gerais and Rio deJaneiro, Meloidogyne exigua, M. paranaensis and M. incognitacause the greatest yield losses and are the limiting factorfor coffee cultivation in certain areas in Brazil. The mostrecommended methods of control for these pathogens areresistant varieties, crop rotation or organic matterapplications. The objective of this study was to evaluatethe resistance of Coffea canephora clones group “ConilonVitória - Incaper 8142 and the clone 14 (drought resistant)and 22 (not drought resistant) to different populations ofMeloidogyne spp. (M. paranaensis, M. incognita races 1 and 3and avirulent and virulent populations of M. exigua) fromdifferent regions of coffee in Brazil. The cultivar CatuaíVermelho (IAC 81) was used as control. The plants wereinoculated with 5,000 eggs/plant. The evaluation was done8 months after inoculation, and the number of galls, eggmasses and the reproduction factor (RF) were evaluated.

The criteria used to evaluate resistance were RF <1.0 andsusceptibility, RF = 1.0. The results indicated for M.paranaensis that clonal varieties 2V, 3V, 6V, 7 V, 13 V andclone 14 were highly resistant. For M incognita race 3(Londrina), only cultivar clone 14 was considered highlyresistant. Concerning M. incognita race 1 (Avilândia), sevenvarieties were highly resistant (2V, 3V, 6V, 8V, 13V and clone14). For avirulent Meloidogyne exigua, several clones werehighly resistant, with the exception of clones 10V and 13V, although RF presented low resistance when comparedwith control. For the virulent M. exigua, some of theclones were resistant (1V, 2V, 4V, 5V, 7 V, 9V, 11v, 12Vand clone 14) and six clones were susceptible (3V, 6V,8V, 10V, 13V and 22). It was concluded that there aresources of genetic resistance in the varieties of groupConilon to M. paranaensis, M.exigua and one populationof M. incognita. Clone 14 was resistant to all species andpopulations of Meloidogyne from coffee evaluated in thisstudy.

50 – REAÇÃO DE CULTIVARES DE SOJA A Pratylenchus brachyurus EM ÁREA NATURALMENTEINFESTADA [REACTION OF SOYBEAN CULTIVARS TO Pratlylenchus brachyurus IN A NATURALLY INFESTEDFIELD] Ferreira, A.D.¹; Rocha, M.R.¹; Alves, T.G.¹; Ferreira, C.S.¹; Barbosa, K.A.G.¹; Teixeira, R.A.¹; Santos, L.C.¹¹Universidade Federal de Goiás, 74690-900, Goiânia, GO, Brasil. E-mail: [email protected]

Dentre as estratégias de manejo de nematóides, a utilizaçãode resistência é, sem dúvida, uma das alternativas maisdesejáveis, considerando sua compatibilidade com outraspráticas de manejo e por não ser prejudicial ao meioambiente. O objetivo deste trabalho foi avaliar a reação decinquenta cultivares de soja a Pratylenchus brachyurus em áreanaturalmente infestada no município de Vicentinópolis, GO.O experimento foi conduzido na safra 2008\09 emdelineamento em blocos ao acaso com oito repetições emesquema de parcelas subdivididas no tempo, com avaliaçõesaos 30 e 60 dias após emergência (DAE). As raízescoletadas foram processadas utilizando-se o método deextração de Coolen & D’Herde (1972), sendo osresultados expressos por 10 gramas de raízes. Das

cultivares avaliadas, 12 apresentaram interação com asépocas de avaliação, sendo que dez delas apresentaramredução na densidade populacional aos 60 DAE variandode 45% a 70% de redução. As cultivares ‘BRSGOLuziânia RR’, ‘BRS Juliana RR’, ‘M-Soy 7211RR’, ‘M-Soy 8411’, ‘TMG 103 RR’ e ‘Emgopa 316 RR’ sedestacaram com reduções na densidade populacional deP. brachyurus de 70%, 62%, 61%, 58%, 58% e 57%,respectivamente. Apesar de não apresentar diferençasignificativa, as cultivares ‘BRSGO Jataí’, ‘BR\Emgopa314’, ‘BRS Gisele RR’, ‘BRS Indiara’, M-Soy 7908 RR’,‘BRSGO Silvania RR’, ‘Emgopa 313’ e ‘TMG 103 RR’se destacaram por apresentar menores densidadespopulacionais nas épocas de avaliação.

312 Vol. 33(4) - 2009


51 – REAÇÃO DE GENÓTIPOS DE FEIJOEIRO (Phaseolus vulgaris L.) AO NEMATÓIDE DAS LESÕESRADICULARES [REACTION OF COMMON BEAN (Phaseolus vulgaris L.) GENOTYPES TO ROOT-LESIONNEMATODE] Ferreira, A.D.¹; Rocha, M.R.¹; Barbosa, K.A.G.¹; Alves, T.G.¹; Ferreira, C.S.¹; Lobo Junior, M.²; Teramoto,A.¹ ¹Universidade Federal de Goiás, 74690-900, Goiânia, GO, Brazil; ²Embrapa Arroz e Feijão, 75375-000 Santo A. deGoiás, GO, Brazil. E-mail: [email protected]

Com o objetivo de avaliar a reação de genótipos de feijão(Phaseolus vulgaris L.) à Pratylenchus brachyurus, instalou-se umensaio em condições de casa de vegetação no período deoutubro a novembro de 2008. Foram utilizados trinta e doisgenótipos de feijoeiro recomendados para a região centraldo Brasil. O delineamento experimental foi inteiramentecasualizado, com 32 tratamentos e seis repetições. As plantasforam semeadas diretamente em vasos plásticos e umasemana após a emergência, procedeu-se o desbaste e ainoculação de cada plântula com 2000 espécimes donematóide. Aos trinta e dois dias após a inoculaçãorealizaram as avaliações de peso do sistema radicular edensidade populacional, obtendo-se o fator de reprodução(FR). Todos os genótipos avaliados apresentaram FR

inferiores a um. Com relação ao número total denematóides, observou-se a existência de grande variabilidadeentre os genótipos (56,4 a 2976,6), sendo que ‘IPR Chopin’,‘BRS Uirapuru’, ‘ BRS Timbó’, ‘ BRS Horizonte’ e ‘BRSMajestoso’, ‘BRS Grafite’, apresentaram as maiores médiaspopulacionais por 10 gramas de raízes e os genótipos‘CNFC 10408’, ‘BRS Cometa’, ‘BRS Esplendor’, ‘IPR Juriti’,‘BRS Estilo’, ‘BRS Requinte’, ‘BRS Executivo’, BRSRadiante’, ‘Iapar 81’ foram os que apresentaram as menoresmédias. Até o momento não se conhece fonte de resistênciaaos nematóides das lesões radiculares em germoplasma defeijoeiro. Portanto, novas avaliações sob condiçõesambientais controladas deverão ser realizadas para umamelhor discriminação dos genótipos mais promissores.

52 – REAÇÃO DE PLÂNTULAS ORIUNDAS DE SEMENTES DE CANA-DE-AÇÚCAR A PARTIR DECRUZAMENTOS CONTROLADOS EM RELAÇÃO A Meloidogyne incognita [REACTION OF SUGARCANESEEDLINGS ORIGINATING FROM CONTROLLED CROSSES TO Meloidogyne incognita] Teixeira, R.A.1; Santos,L.C.1; Araujo, F.G.1; Alves, T.G.1; Ferreira, C.S.1; Rezende Neto, U.R.1; Rocha, M.R.1; Reis, A.J.S.1 1Universidade Federal deGoiás, Escola de Agronomia e Eng. de Alimentos, C.P. 131, 74001-970 Goiânia, GO, Brazil. E-mail:[email protected]

A cultura da cana-de-açúcar tem especial significadoeconômico para o Brasil, mas é atacada por vários patógenosentre eles, estão os nematóides do gênero Meloidogyne,reduzindo a produtividade da cultura. Este trabalho avaliouprogênies oriundas de seis cruzamentos de cana-de-açúcar,no que concerne à reação de plântulas a nematóides daespécie Meloidogyne incognita. As plântulas utilizadas foramobtidas de sementes dos diferentes cruzamentos. Oscruzamentos fazem parte do Programa de MelhoramentoGenético da Cana-de-açúcar da UFG, e foi realizado emcasa-de-vegetação. Foram avaliados os cruzamento:RB72454 x ?; RB825317 x RB867515; RB867515 xRB855046; RB945961 x SP81-3250; SP81-3250 xRB815627; SP81-3250 x RB945961. Cada cruzamento foirepresentado por 64 progênies, que foram mantidasindividualizadas em sacos de polietileno preto (15 x 20 cm)e inoculadas com 4.000 ovos e juvenis de segundo estágio(J2) de M. incognita, sete dias após o transplantio. Após

sessenta dias da inoculação, foi realizada a extração dosnematóides e avaliação do peso fresco de raízes e dapopulação final do nematóide. Assim, determinaram-se ofator de reprodução e a porcentagem de inibição donematóide em comparação com o padrão de suscetibilidadeencontrado. Em seguida, foi feita a classificação de cadaindividuo em: altamente suscetível, suscetível, poucoresistente, moderadamente resistente, resistente e altamenteresistente. Em todas as famílias, observou-se maiorporcentagem de indivíduos classificados comomoderadamente resistentes. Ao compararmos as médiasde contagem de nematóides, o cruzamento RB72454 x ?,foi o único que não diferiu do cruzamento padrão desuscetibilidade (RB825317 x RB867515), sendo entãoclassificados como altamente suscetíveis. No entanto, pelofator de reprodução médio de cada cruzamento, todos oscruzamentos, exceto RB825317 x RB867515, foramclassificados como resistentes, apresentando Fr < 1.



313

53 – REAÇÃO DE PROGÊNIES DE CANA-DE-AÇÚCAR ORIGINADAS DE CRUZAMENTOSCONTROLADOS EM RELAÇÃO À Meloidogyne incognita [REACTION OF SUGARCANE PROGENIES FROMCONTROLLED CROSSES TO Meloidogyne incognita]. Teixeira, R.A.1; Santos, L.C.1; Araujo, F.G.1; Ferreira, C.S.1; Alves,T.G.1; Rezende Neto, U.R.1; Rocha, M.R.1; Reis, A.J.S.1 1Universidade Federal de Goiás, Escola de Agronomia e Eng. deAlimentos, C. P. 131, 74001-970 Goiânia, GO, Brazil. E-mail: [email protected]

Dentre os nematóides já identificados nas raízes e em soloscultivados com cana-de-açúcar, os do gênero Meloidogynepodem causar severos danos e reduções da produção. Esteestudo teve como objetivo avaliar a reação de progênies decana-de-açúcar, originadas de cruzamentos controlados,quanto à resistência a M. incognita. O trabalho foi conduzidoem condições de casa-de-vegetação, utilizando plântulasobtidas gemas de cana-de-açúcar provenientes de camposexperimentais T1 (primeira fase experimental), e que sãoutilizados pelo Programa de Melhoramento Genético daCana-de-açúcar da Universidade Federal de Goiás. Ostratamentos consistiram de doze famílias (RB935940 x ?;H839998 x ?; RB947506 x ?; RB93509 x RB863129;RB72454 x SP70-1078; RB928064 x RB813804; RB865547x RB855156; CP70-330 x ?; IAC862210 x SP70-1078;RB872601 x ?; RB855598 x SP79-1011; SP77-5181 x SP79-1011) e uma variedade comercial (RB72454) de cana-de-açúcar. As progênies de cada tratamento foram inoculadasartificialmente com 4.000 ovos e juvenis de segundo estágio

de M. incognita, sete dias após a germinação das plântulas.Após sessenta dias da inoculação, foi realizada a extraçãodos nematóides e avaliação do peso fresco de raízes e dadensidade populacional do nematóide, determinando ofator de reprodução e porcentagem de inibição donematóide em comparação com o tratamento padrão desuscetibilidade encontrado. Em todas as famílias observou-se maior porcentagem de indivíduos classificados comomoderadamente resistentes. No entanto, pela comparaçãode médias de contagem de nematóides, o único cruzamentoa diferir da variedade RB72454, que é tida como suscetívelem condições de campo, e neste experimento comportou-se como moderadamente resistente, foi o cruzamentoRB855598 x SP79-1011, que teve uma maior multiplicaçãode nematóides (6.511 ovos e J2/10 g de raiz) em comparaçãoa variedade, que obteve 1.1916 ovos e J2/10 g de raiz.Quanto ao fator de reprodução médio de cada cruzamento,todos os cruzamentos e a variedade comportaram-se comoresistente, apresentando Fr < 1.

54 – REAÇÃO DE VARIEDADES DE MILHO A Pratylenchus sp. EM ÁREA NATURALMENTE INFESTADA[REACTION OF CORN VARIETIES TO Pratylenchus sp. IN A NATURALLY INFESTED FIELD] Ferreira, A.D.¹;Rocha, M.R.¹; Barbosa, K.A.G.¹; Alves, T.G.¹; Santos, L.C.¹; Araújo, F.G.¹; Teixeira, R.A.¹; Machado, A.S.² ¹UniversidadeFederal de Goiás, 74690-900 Goiânia, GO, Brazil; ²Instituto Federal Goiano 76303 -970, Ceres, Goiânia, GO, Brazil. E-mail: [email protected]

O milho, comumente utilizado em rotação ou sucessão coma cultura da soja, é suscetível ao nematóide das lesõesradiculares (Pratylenchus sp.). O uso de variedades resistentesou tolerantes de milho pode ser uma das estratégias demanejo desse nematóide em áreas de plantio de soja ondese tem observado elevadas populações. O objetivo destetrabalho foi avaliar a reação de trinta e oito variedades demilho, a Pratylenchus brachyurus em área naturalmenteinfestada no município de Edéia, Go. O experimento foiconduzido na safra 2008\09 em delineamento em blocosao acaso com dez repetições em esquema de parcelassubdivididas no tempo, com avaliações aos 30 e 60 diasapós emergência (DAE). As raízes coletadas foramprocessadas utilizando-se o método de extração de Coolen

& D’Herde (1972), sendo os resultados expressos por 10gramas de raízes. Das cultivares avaliadas, 17 apresentaraminteração com as épocas de avaliação, sendo que 16 delasapresentaram aumento na densidade populacional aos 60DAE. As variedades que apresentaram as menores médiaspopulacionais das duas avaliações foram: ‘P30S31’ (1037),‘AS1575’ (1012), ‘DKB 499’ (875), ‘BRS 1010’(833), ‘P30F80’ (747,08), ‘DG 501’ (662,18), ‘GNZ 2500’ (609,8),‘DKB 350’ (476,02), ‘NK Impacto’ (412,83). As variedadesque proporcionaram menores densidades populacionaisdevem ser preferidas para semeadura em áreas infestadas,embora mais pesquisas sejam necessárias visandoidentificação de variedades que multipliquem menos onematóide P. brachyurus.

314 Vol. 33(4) - 2009


55 – REACTION OF LETTUCE CULTIVARS TO Meloidogyne javanica [REAÇÃO DE CULTIVARES DEALFACE A Meloidogyne javanica] Cunha, T.P.L.1; Chiamolera, F.M.1; Dias-Arieira, C.R.1; Cosmo, D.A.1; Puerari, H.H.1;Sassaki, T.C.1; Mattos, R.M.1 1Universidade Estadual de Maringá, Campus Regional de Umuarama, C.P. 65, 87501-970Umuarama, PR, Brazil. E-mail: [email protected]

Lettuce (Lactuca sativa L.) is a leafy vegetable of greateconomic importance in Brazil, mainly when consumed innatura. This vegetable is highly susceptible to infestationsof root knot nematodes (Meloidogyne spp.), but it is necessaryto know the behavior of different cultivars to thesepathogens. Thus, the objective of this work was to evaluatethe susceptibility of different lettuce cultivars to Meloidogynejavanica. For this, previously germinated seedlings weretransplanted to pots with a capacity of one liter containingmixture of soil: sand (2:1), previously autoclaved. After threedays the plants were inoculated with a suspension containing4000 eggs + juveniles of the nematode. The treatmentswere crisp type (Isabela, Vera and Vanda), American (LucyBrown, Maurem and Tania), loose leaf (Elisabeth and Elisa),

roman (Branca de Paris and Mirella) and mimosa (SaladBowl) lettuce. The control was the tomato cv. Santa Cruz.The experiment was completely randomized in fourreplications. Data were submitted to analysis of varianceand results were compared to Tukey test 5%. Sixty daysafter inoculation the plants were removed and the rootsystem was evaluated in the number of galls and eggs/juveniles. There wasn’t any reaction of immunity for thevarieties evaluated. The number of galls statisticallyhigher than control and highest RF were observed forMimosa type ‘Salad Bowl’. The cultivars loose leaf and‘Vera’ (Crisp) also showed FR>1. In general, lower FRwas observed for the varieties of American and Romantype.

56 – REACTION OF Vitis spp. ROOTSTOCKS TO Meloidogyne incognita [REAÇÃO DE PORTA-ENXERTOSDE VIDEIRA A Meloidogyne incognita] Somavilla L¹, Gomes C.B.², Naves R.L³. ¹Universidade Federal de Pelotas, C.P. 354,Pelotas, RS, Brazil; ²Embrapa Clima Temperado, C.P. 403, 96001-970 Pelotas, RS, Brazil; ³Embrapa Uva e Vinho, Jales, SP,Brazil. E-mail: [email protected]

The root-knot nematode (Meloidogyne spp.) is a seriousproblem for viticulture worldwide. In the attacked grapes,this pathogen may cause galls on the roots of infectedgrapes, besides reducing plant growth. The use of resistantrootstocks is the most feasible control to reduce the damage.In order to evaluate the reaction of 11 rootstocks and twogrape (Vitis spp.) cultivars to Meloidogyne incognita (Est. I2),individual seedlings, maintained in pots with sterilized soil,were inoculated with 10,000 eggs + J2 of the nematodeper plant. The experiment was carried out under greenhouseconditions in a completely randomized design, using sixreplications/genotype. Seedlings of tomato ‘Rutgers’ were

used as control. Eight months after the inoculation, theplants were evaluated by counting the number of galls andeggs/plant. The rootstocks’ resistance was estimated by thereproduction factor (RF= final population / initialpopulation). Among the tested genotypes, the rootstocks‘Harmony’, ‘Salt Creek’, ‘1103 Paulsen’, ‘IAC572-Jales’,‘K55BB’, ‘IAC 313-Tropical’ and ‘SO4’ were considered asresistant (RF<1,00) to M. incognita. The rootstocks ‘420A’,‘106-Traviú’, ‘ Rupestris du Lot’, ‘IAC 766-Campinas’ andthe ‘Chardonnay’ and ‘Niagara Rosada’ cultivars weresusceptible (FR>1,00). Support: CAPES, CNPq,EMBRAPA.

57 – REACTION OF THE ROOTSTOCKS OF GRAPEVINE TO Meloidogyne javanica [REAÇÃO DE PORTA-ENXERTOS DE VIDEIRA A Meloidogyne javanica] Puerari, H.H.2; Dias-Arieira, C.R.2; Moura, M.F.2; Tecchio, M.A.2;Cunha, T.L.P.1; Biela, F.1; Mattos, R.M.1; Cosmo, D.A.1; Sassaki, T.C.1 1Universidade Estadual de Maringá, Campus Regionalde Umuarama, C.P. 65, 87501-970 Umuarama, PR, Brazil; 2Agência Paulista de Tecnologia dos Agronegócios, InstitutoAgronômico, 13214-820, Jundiaí, SP, Brazil. E-mail: [email protected]

Root-knot nematodes, Meloidogyne spp., are one of themain problems in vineyards. From indicated methods ofmanagement of these pathogens, the usage of resistantrootstock is the most advantageous, as it provides thepermanent control of nematodes. Therefore, the objectiveof this research was to evaluate, under controlled conditions,

the reaction to Meloidogyne javanica nematode of tenrootstocks of grapevine produced by the program ofMelhoramento Genético de Videiras do Centro APTA deFrutas Instituto Agronômico de Campinas. For thispurpose, seedlings were inoculated with 4000 eggs-juvenilesof nematode. After 60 days, the root systems were collected



315

to evaluate the number of galls and eggs per root system.The behavior of rootstocks was determined through thecalculation of reproduction factor (RF). The biotest wasalso carried out through plantation of ‘Santa Cruz’ tomato.They remained in pots for 30 days, and then the numberof galls and their eggs were evaluated. The experiment was

carried out in completely randomized designs with sixrepetitions. The rootstocks ‘101-14’, ‘Telek-5C’, ‘IAC 313’,‘IAC 766’, ‘IAC 571-6’, ‘IAC-572’, ‘Kober 5BB’ and ‘Ripáriado Traviu’ were immune to the nematode, while ‘R99’ and‘420-A’ presented resistance to it, with RF of 0.0018 and0.0016, respectively. The RF of control was 7.3.

58 – REAÇÃO DE PORTA-ENXERTOS E HÍBRIDOS DE PEPINO (Cucumis sativus) À Meloidogynemayaguensis [REACTION OF CUCUMBER (Cucumis sativus) HYBRIDS AND ROOTSTOCKS TO Meloidogyne mayaguensis]Wilcken, S.R.S.1; Westerich, J.N.1; Rosa, J.M.O.1 1FCA, UNESP, Departamento de Produção Vegetal, Defesa Fitossanitária,C.P. 237, 18610-307 Botucatu, SP, Brazil. E-mail: [email protected]

A ocorrência de fitonematóides do gênero Meloidogyne écomum em áreas destinadas ao cultivo de olerícolas. Entreas culturas mais prejudicadas por esses nematóides está acultura do pepino. A enxertia é uma técnica alternativa,frequentemente recomendada para esta cultura em áreasinfestadas com nematóides das galhas. Porém, o fator dereprodução desses nematóides ainda é desconhecido nosdiferentes porta-enxertos recomendados. O presentetrabalho teve como objetivo determinar o fator dereprodução de Meloidogyne mayaguensis em seis porta-enxertospara pepino (Abóboras: Menina Brasileira, MorangaExposição, Shelper, Tetsukabuto, B8-A Tetsukabuto eExcite Ikki KY) e quatro híbridos de pepino tipo japonês(Yoshinari, Kouki, Taisho KY e Tsuyataro).. O experimentofoi conduzido em casa-de-vegetação, sendo cada parcelaconstituída de uma planta por vaso contendo 2 litros de

substrato autoclavado, na proporção de 1:2:1 (solo: areia:matéria orgânica). A infestação do substrato foi realizadacom 5.000 ovos e eventuais juvenis de segundo estádio deM. mayaguensis/vaso, dois dias após o transplante das mudas.Tomateiros ‘Rutgers’ foram utilizados como padrão deviabilidade do inóculo. O delineamento experimental foiinteiramente casualizado, com seis repetições portratamento. A avaliação do peso fresco da raiz, númerototal de nematóides presentes no solo e na raiz, númerode nematóides/g de raiz e fator de reprodução foirealizada 60 dias após a inoculação. As abóboras ‘Shelper’e ‘Excite Ikki KY’ proporcionaram baixo fator dereprodução de M. mayaguens i s (1,01 e 1,17,respectivamente), enquanto as demais abóboras ehíbridos de pepino proporcionaram fator de reproduçãomais elevados.

59 – RESPUESTA DE UN HÍBRIDO DE ORÉGANO A Meloidogyne incognita Y Nacobbus aberrans ENARGENTINA [RESPONSE OF A HYBRID OF OREGANO TO Meloidogyne incognita AND Nacobbus aberrans INARGENTINA] Tolocka, P.A.1; Doucet, M.E.1; Bima, P.J.2 1Laboratorio de Nematología, Centro de Zoología Aplicada,Universidad Nacional de Córdoba, C.C. 122, 5000 Córdoba, Argentina; 2Laboratorio de Biotecnología Vegetal, Facultadde Ciencias Agropecuarias, Universidad Nacional de Córdoba, C.C. 509, 5000 Córdoba, Argentina. E-mail:[email protected]

Se ha señalado que el orégano puede ser atacado pornematodos del género Meloidogyne y por la especie N. aberrans,con el consecuente perjuicio para sus sistemas radicales yproducción. Actualmente la información sobre el particulares muy limitada en el ámbito del país. Se realizó unaexperiencia destinada a evaluar la reacción del híbridoOriganum x majoricum (uno de los de mayor calidad en cuantoa aroma y color) frente a una población de M. incognita(proveniente de la provincia de Corrientes) y otra de N.aberrans (originaria de la provincia de Córdoba). El testigoutilizado fue el cultivar de tomate Platense, muy susceptiblea ambos nematodos. Las raíces de plántulas de tomate yorégano, provenientes de cultivo in vi tr o fueroninoculadas, en suelo estéril, con 100 larvas de segundo

estadio e incubadas en cámara de cultivo a 25-30°C. Serealizaron 15 repeticiones por tratamiento. Transcurridos90 días en condiciones de invernáculo, las plantas fuerondescalzadas y sus raíces analizadas en busca de agallas.El tomate, según lo esperado, fue susceptible a ambasespecies mostrando valores de índices de agallas degrados 3 (entre 11-30 agallas por planta), 4 (entre 31-100 agallas) y 5 (más de 100 agallas). Por el contrario,ninguna de las dos poblaciones de nematodosconsiderados parasitó al orégano. Se destaca el interésde analizar las relaciones nematodo-hospedador queexplique ese comportamiento por parte del híbrido yencarar nuevas experiencias considerando diferentespoblaciones de esas especies.

316 Vol. 33(4) - 2009


60 – ESTUDO COMPARATIVO DOS CICLOS BIOLÓGICOS DE Meloidogyne mayaguensis E Meloidogynejavanica EM TOMATEIROS RESISTENTES A MELOIDOGINOSE [COMPARATIVE STUDY OFBIOLOGICAL CYCLES OF Meloidogyne mayaguensis E Meloidogyne javanica ON RESISTANT TOMATO PLANTS]Westerich, J.N.1; Rosa, J.M.O.1; Wilcken, S.R.S.1 1FCA/UNESP, Departamento de Produção Vegetal, Defesa Fitossanitária,C.P. 237, 18.610-307 Botucatu, SP, Brazil. E-mail: [email protected]

A espécie Meloidogyne mayaguensis (Rammah e Hirschmann)foi relatada pela primeira vez no Brasil em 2001 porCarneiro e colaboradores. Assumiu grande importância porapresentar alta taxa de reprodução e ser altamente virulentaa diversas espécies vegetais, inclusive algumas resistentes ameloidoginose. O presente trabalho visou conhecer arelação parasito hospedeiro de M. mayaguensis em plantascom resistência a nematóides das galhas. Para isso, estudoscomparativos dos ciclos biológicos de M. mayaguensis e M.javanica em tomateiros com o gene Mi foram conduzidos.O experimento seguiu o delineamento inteiramentecasualisado, composto de quatro tratamentos [dois porta-enxertos de tomateiro (Magnet e Dr. K) e duas espécies denematóides das galhas (M. mayaguensis e M. javanica)], comcinco repetições, sendo 20 parcelas avaliadas a cada setedias, num total de cinco avaliações realizadas ao final doexperimento. Cada parcela foi constituída por um copoplástico contendo uma única planta. As plantas foram

inoculadas com 500 juvenis infectantes (J2) de M. mayaguensise M. javanica. Posteriormente, essas plantas foram mantidasem B.O.D. a 26ºC. O tomateiro ́ Rutgers‘ foi utilizado comopadrão de suscetibilidade para verificação da viabilidadedo inóculo. Em cada avaliação, foram retiradas ao acaso,cinco parcelas. As plantas tiveram as partes aéreasdescartadas e os sistemas radiculares após seremcuidadosamente lavados, foram secados em papelabsorvente, pesados e separados em duas partes. Uma daspartes foi submetida à coloração com Fucsina Ácida edissecada sob microscópio estereoscópico para a localização,classificação e contagem dos diferentes estádios dedesenvolvimento de M. mayaguensis e M. javanica presentesnas raízes. Os resultados obtidos mostraram que ambas asespécies foram capazes de penetrar as raízes dos tomateiros.Porém, somente M. mayaguensis conseguiu desenvolver-senormalmente e completar seu ciclo, aproximadamente 24dias após a inoculação.

61 – ECLOSÃO DE JUVENIS INFECTANTES DE Meloidogyne javanica EM DIFERENTESTEMPERATURAS E CONCENTRAÇÕES DE OVOS [ECLOSION OF INFECTIVE JUVENILES ATDIFFERENT TEMPERATURES AND EGG CONCENTRATIONS] Westerich, J.N.1; Rosa, J.M.O.1, Wilcken, S.R.S.11FCA/UNESP, Departamento de Produção Vegetal,Defesa Fitossanitária, C. P. 237, 18.610-307 Botucatu, SP, Brazil. E-mail: [email protected]

Em estudos nematológicos é freqüente a necessidade deseparar ovos de juvenis infectantes de Meloidogyne (J2)utilizando câmaras de eclosão (método de Baermannadaptado). Entretanto, a baixa porcentagem de eclosãonessas condições limita a obtenção de grande quantidadede J2. O conhecimento dessa porcentagem a partir de umdeterminado número de ovos colocados na câmara deeclosão em condições específicas poderia colaborar noplanejamento de experimentos que necessitam de grandequantidade de inóculo. Sabendo-se que inúmeros fatoresafetam a eclosão e que em laboratório aspectos comoquantidade de ovos dispostos por recipiente, tipo derecipiente, de papel e de peneira utilizados, temperatura dearmazenamento e período de coleta também interferem nataxa de eclosão, uma série de experimentos se faz necessáriopara a determinação da condição adequada para a obtençãoda maior taxa de eclosão. Devido ao exposto, o presente

trabalho teve por objetivo determinar a temperatura e aquantidade de ovos que proporcionam maior porcentagemde eclosão de J2 de M. javanica num determinado períodode tempo. O experimento seguiu o delineamentointeiramente casualizado, composto de quatro tratamentos(duas temperaturas, 28ºC e 30ºC, e duas quantidades deovos, 1.000 ovos e 5.000 ovos), com sete repetições. Asuspensão recolhida após as primeiras 6 horas da instalaçãodo experimento foi descartada para evitar a inclusão dos J2

eclodidos durante o processo de extração. Em seguida,procederam-se avaliações diárias. O número de J2 presentesna suspensão obtida em cada avaliação foi determinadocom o auxílio da lâmina de Peters sob microscópio óptico.Os resultados obtidos mostraram que o tratamento queresultou em maior porcentagem de eclosão foi o quecontinha concentração de 1.000 ovos, a 30ºC após 48 horas(3,67%), assim como após oito dias (65,60%).



317

62 – PORCENTAGEM DE ECLOSÃO DE JUVENIS INFECTANTES DE Meloidogyne mayaguensis[PERCENTAGE OF ECLOSION IN INFECTIVE JUVENILES OF Meloidogyne mayaguensis] Westerich, J.N.1; Rosa,J.M.O.1, Wilcken, S.R.S.1 1FCA,UNESP, Departamento de Produção Vegetal,Defesa Fitossanitária, C. P. 237, 18.610-307Botucatu, SP, Brazil. E-mail: [email protected]

Devido à espécie Meloidogyne mayaguensis assumir grandeimportância em diversas partes do mundo, por ser altamentepatogênica a diversas culturas de interesse econômico esabendo-se da dificuldade de obtenção de grandequantidade de juvenis de 2º estádio (J2) a serem utilizadosem diversos tipos de experimentos, o presente trabalho tevepor objetivo determinar qual a temperatura e a quantidadede ovos que permitam a obtenção da maior porcentagemde eclosão de J2 de M. mayaguensis, em câmaras de eclosão(método de Baermann adaptado). O experimento seguiu odelineamento inteiramente casualizado, composto de quatrotratamentos (duas temperaturas, 28ºC e 32ºC, e duasquantidades de ovos, 1.000 e 5.000 ovos), com seterepetições. Após as primeiras 6 horas da instalação do

experimento, a suspensão obtida foi recolhida e descartadapara evitar a inclusão dos J2 eclodidos durante o processode extração. As avaliações foram realizadas 24, 48 e 72 horasapós a montagem do experimento e o número de J2

presentes na suspensão obtida em cada avaliação foideterminado com o auxílio da lâmina de Peters sobmicroscópio ótico. Para a determinação do porcentual dejuvenis eclodidos foi considerada a relação entre o númerode juvenis eclodidos e o número total de ovos aferido noinício do experimento, por parcela, e, o resultado expressoem porcentagem foi submetido ao Teste de Tukey a 5% deprobabilidade. A maior porcentagem de eclosão foi obtida24 horas após a montagem do experimento a 32ºC, naconcentração de 1.000 ovos (3,53 %).

63 – ALTERAÇÕES HISTOPATOLÓGICAS CAUSADAS POR Meloidogyne mayaguensis EM TOMATEIRORESISTENTE A MELOIDOGINOSE [HISTOPATHOLOGICAL CHANGES CAUSED BY Meloidogyne mayaguensisIN RESISTANT TOMATO PLANTS] Westerich, J.N.1; Rosa, J.M.O.1; Rodella, R.A.2; Wilcken, S.R.S.1 1Faculdade deCiências Agronômicas de Botucatu,UNESP, C. P. 237, 18.610-307 Botucatu, SP, Brasil; 2Instituto de Biociências de Botucatu,UNESP, C. P. 510, 18.618-000 Botucatu, SP, Brasil. E-mail: [email protected]

Recentemente, a espécie Meloidogyne mayaguensis foi relatadaem cultivos de olerícolas do Estado de São Paulo, causandogrande preocupação para o setor. Em tomateiro, aresistência a M. incognita, M. javanica e M. arenaria, conferidapela presença do gene Mi, não contempla a espécie M.mayaguensis. Devido ao exposto, é de grande interesse oconhecimento da relação parasito-hospedeiro de M.mayaguensis e cultivares de tomateiros. O presente trabalhoteve por objetivo verificar as alterações histopatológicascausadas por esse nematóide no sistema radicular detomateiro com o gene de resistência Mi. O delineamentoexperimental utilizado foi inteiramente casualisado,constituído por um porta-enxerto de tomateiro (‘Magnet’)e uma espécie de nematóide das galhas (M. mayaguensis),com 5 repetições. As plantas foram inoculadas com 500juvenis infectantes (J2) de M. mayaguensis e avaliadas no 24ºdia, após a inoculação. Segmentos de 1,0 cm decomprimento de raízes infectadas, contendo galhas, foram

fixados em FAA50 por 72 horas e conservados em álcool70%. A seguir, foram desidratados em uma série alcoólica,incluídos em historresina e colados em blocos de madeiracom cola “Araldite”, para, posteriormente, seremseccionados transversalmente em micrótomo rotatório. Oscortes obtidos, com aproximadamente 8 µm de espessura,foram corados com Floxina B por 15 minutos e depoiscom Azul de Toluidina 0,05% em tampão acetato pH 4,7por 3 minutos, sendo as lâminas montadas em resinasintética. Com auxílio de microscópio de luz, observou-seno cilindro vascular a formação de mais de um sítio dealimentação, constituídos pela presença de várias célulasnutridoras, caracterizadas pela ocorrência de parede celularespessa, citoplasma denso e granuloso, multinucleadas e comvários vacúolos de pequeno tamanho. Os tecidos vascularesapresentaram-se comprimidos e desorganizados,observando-se também hipertrofia de células doparênquima cortical.

318 Vol. 33(4) - 2009


64 – RESISTANCE OF SOYBEAN CULTIVARS TO Scutellonema brachyurus [RESISTÊNCIA DE CULTIVARESDE SOJA A Scutellonema brachyurus] Soares, P.L.M.1; Santos, J.M.1 1Professores de Nematologia, UNESP, FCAV, Câmpus deJaboticabal, Departamento de Fitossanidade, Laboratório de Nematologia. E-mail: [email protected]

In the 2005/2006 harvest, samples of soil and roots ofsoybean from the Project to Monitor Transgenic Soybean‘Roundup Ready’ at Monsanto Brazil in Rolândia, regionof Londrina-(Paraná state), were sent for nematologicalanalysis to the Laboratory of Nematology, PhytosanitaryDepartament, UNESP/FCAV, Câmpus de Jaboticabal. Inthem, we found a relatively high subpopulation ofScutellonema brachyurus (Steiner) Andrassy. So it was decidedto evaluate the reaction of five conventional soybeancultivars (M-Soy 8211; MG/BR-46 Conquista, M-Soy 8001;BRSMG-68 Vencedora and EMGOPA-316) and fivetransgenic ones with Roundup Ready (RR) technology =(CD 219 RR, BRS Baliza RR; BRS Valiosa RR, M-Soy 8000RR and M-Soy 7908 RR) to the nematode, with a view toobtaining data on the potential of this nematode as apathogen of soybeans, as well as the use of resistant cultivarsas a management system. The study was conducted in agreenhouse of the Laboratory of Nematology, in clay potsof 5 liters. The seeds of the cultivars were sown inpolystyrene trays containing organic matter. About 15 daysafter sowing, one plant of each cultivar in substrate

Plantimax â was transplanted per pot (replicate) and wasinoculated with 2,000 active forms of S. brachyurus perplant. Ten replications per cultivar (treatment) wereproduced, each consisting of one plant/5-liter-pot, fiveinoculated and five non-inoculated to measure the effectof the nematode on the development of plants. Thetreatments were distributed in a completely randomizeddesign. At 90 days after inoculation the plants werecollected, the root system was used for the extractionof the nematode population and the number ofspecimens/root were estimated. Samples of the substrateof each pot were collected for extraction and estimationof the rhizosphere nematodes. The reproduction factor(RF) was then calculated. The cultivars that had RF < 1were considered resistant, namely: M-Soy 8001 (0.60),BRSMG-68 Vencedora (0.50), EMGOPA-316 (0.40),BRS Baliza RR (0.70), BRS Valiosa RR (0.90) and M-Soy7908 RR (0.40). The cultivars that showed RF > 1 wereconsidered susceptible, namely: M-Soy 8211 (2.30), MG/BR-46 Conquista (1.70), CD 219 RR (2.30) and M-Soy8000 RR (1.30).

65 – CONCENTRATION OF 20E ON SUSCEPTIBLE AND RESISTANT ACCESSIONS OF Pfaffia glomerataINFECTED WITH Meloidogyne incognita AND HISTOLOGICAL CHARACTERIZATION OFRESISTANCE [CONCENTRAÇÃO DE 20E NOS ACESSOS RESISTENTE E SUSCEPTIVEL DE Pfaffia glomerataINFECTADOS COM Meloidogyne incognita E CARACTERIZAÇÃO HISTOLOGICA DA RESISTENCIA] Gomes,A.C.M.M.1; Nicole, M.2; Mattos, J K.3; Pereira, S.I.V.4; Pereira, P.4; Silva, D.B.1; Vieira, R.F.1; Capdeville, G.1; Carneiro,R.M.D.G.1 1EMBRAPA Recursos Genéticos e Biotecnologia, C. P. 02372, 70849-979 Brasília, DF, Brazil; 2DGPC, IRD,Montpellier - cedex 5, France; IRD - UMR-186 IRD-Cirad-UM2 “Résistance des Plantes aux Bioagresseurs” Montpellier- Cedex5, France; 3Universidade de Brasília, 70000-000, Brasília, DF, Brazil; 4Universidade de Ribeirão Preto Unidade deBiotecnologia, 14 096-900 Ribeirão Preto, SP, Brazil. Email:[email protected]

Pfaffia glomerata (Spreng) Pedersen is a medicinal plant widelydistributed in Brazil that is considered the world’s greatestsupplier of P. glomerata roots. Among active ingredientscontained in this plant, the steroid β—ecydisone (20 E) isthe most important compound extracted from roots. Thissteroid presents therapeutic properties in the treatment ofdiabetes and hemorrhoids, besides having bioenergetic, anti-tumor, tonic and aphrodisiac effects. Root-knot nematodes,Meloidogyne spp., are a major limiting factor in rootproduction. Recent studies showed resistance of accessionsof P. glomerata to the species M. incognita. The aims of thiswork were: i) to correlate the concentration of 20 E withresistance and susceptibility of P. glomerata accessions toM. incognita in inoculated and non-inoculated plants; ii) tostudy the effect of the parasitism of M. incognita on the

concentration of the steroid 20 E in the roots and iii) toclarify resistance mechanisms of one highly resistantaccession (UFV) compared with a highly susceptible one(Farm). The concentration of 20 E in the healthy susceptible(Farm) accession was significantly higher than in the healthyresistant (UFV) accession, showing that the resistancemechanism was not related to 20 E concentrations. Plantsof the (Farm) accession infected with M. incognita showedhigher levels of 20 E as compared to the non-inoculatedcontrol. Resistance of (UFV) to the root-knot nematodeM. incognita was associated with unidentified factors thatlimited nematode penetration and with post-penetrationresponses, including the hypersensitive response. Giant cellswere sometimes found in the resistant cultivar, but displayeda highly vacuolated and degraded cytoplasm with thinner



319

cell walls when compared with the control. Microscopeobservations under UV light showed a strong

autofluorescence, suggesting that phenolic compounds maybe involved in ginseng ‘UFV’ resistance.

66 – PROGRAMA DE MELHORAMENTO DE Capsicum DA EMBRAPA: AVALIAÇÃO DE GENÓTIPOSPARA REAÇÃO A Meloidogyne mayaguensis [Capsicum BREEDING PROGRAM AT EMBRAPA: EVALUATIONOF GENOTYPES FOR REACTION TO Meloidogyne mayaguensis] Pinheiro, J.B.1; Reifschneider, F.J.B.1; Amaro, G.B.1;Lopes, C.A.1; Silva; Pereira, J.S.1 1Embrapa Hortaliças. C. P. 218. 70359-970 Brasília, DF, Brazil. E-mail:[email protected]

As pimentas e pimentões (Capsicum spp.) podem ter suasafra prejudicada pelo ataque de patógenos, com destaquepara os fitonematóides. Dentre estes organismos, oscausadores de galhas pertencentes ao gênero Meloidogyne,especialmente Meloidogyne incognita e Meloidogyne javanica, sãoos mais nocivos para as hortaliças. Em hortaliças, outraespécie de nematóide das galhas, Meloidogyne mayaguensis, vemcausando prejuízos à cultura. Esta espécie de nematóidefoi detectada pela primeira vez, parasitando o porta-enxertode pimentão ‘Silver’ e tomateiros resistentes àmeloidogynose (cv. Andrea e Débora) no Estado de SãoPaulo. Assim, avaliou-se o comportamento de genótiposde Capsicum do programa de melhoramento da EmbrapaHortaliças para resistência a M. mayaguensis. Foram avaliados

56 genótipos de Capsicum para resistência a M. mayaguensis.Mudas de genótipos de Capsicum do tipo Habanero eMurupi, mantidas em vaso, em casa-de-vegetação, foraminoculadas com 5000 ovos de M. mayaguensis/planta.Tomateiro cultivar Rutgers inoculado com a espécie denematóide foi ut i l izado como testemunha. Oexperimento foi conduzido em del ineamentointeiramente casualisado, com seis repetições. Oitenta equatro dias após a inoculação, os genótipos foramavaliados quanto ao índice de galhas e de massa de ovos.Observou-se que os genótipos CNPH 0060, CNPH0578, CNPH 3454, CNPH 3272 e CNPH 4159apresentaram menor índice de galhas e de massa de ovospara M. mayaguensis.

67 – NEW SOURCES OF COTTON RESISTANCE TO Meloidogyne incognita RACE 3 [NOVAS FONTES DERESISTÊNCIA DO ALGODOEIRO A Meloidogyne incognita RAÇA 3] Mota, F.C.1; Peixoto, J.R.2; Mattos, V.S.4; Sousa,F.R.4; Silva, J.G.P.4; Giband, M.3;Carneiro, R.M.G.D.4 1Departamento de Fitopatologia, UnB, 70910-900 Brasília, DF,Brazil; 2Departamento de Agronomia, UnB, 70910-900 Brasília,DF, Brazil. Email: [email protected]; 3Embrapa Algodão,Rua Oswaldo Cruz 1143, Centenário, C. P. 174, 58428-098 Campina Grande, PB, Brazil; 4Embrapa Recursos Genéticos eBiotecnologia, Parque Estação Biológica, Av. W5 Norte, C. P. 02372, 70770-900 Brasília, DF, Brazil; E-mail:[email protected]

Root-knot nematode Meloidogyne incognita is widespread andrecognized as a major pathogen of cotton (Gossypiumhirsutum) in producing regions of the world. This nematodehas been also reported in almost all producing regions inBrazil, with race 3 being the most important. The use ofgenetic resistance is the most economically viable andeffective method of control. However, the sources ofresistance in Brazil are derived from the cultivar Auburn56, whose resistance can be overcome by virulent M.incognita. The aim of this study was to evaluate the resistance

or susceptibility response of 29 cultivars of cotton fromthe Embrapa germplasm bank to M. incognita race 3. Theplants were inoculated with 5000 eggs and all the treatmentswere replicated 8 times and arranged in a randomized blockdesign. The assay was evaluated three months afterinoculation. Among the cultivars evaluated, Wild MexicanJack Jones, F1 AS 0110 1 X M315, LARN 1032, M315,Auburn 56, Del Pais nº 3, Guazuncho 2, Fai Mui and SemiAspero Huanuco were considered resistant to the nematode,presenting Reproduction Factor <1.0.

68 – REACTION OF ACCESSIONS OF PASSIONFRUIT (Passiflora spp.) to Meloidogyne mayaguensis[REAÇÃO DE ACESSOS DE MARACUJAZEIRO (Passiflora spp.) A Meloidogyne mayaguensis] Silva, J.G.P.1; Sousa, M.G.1;Sousa, F.R.1; Carneiro, R.M.D.G.1 1Embrapa Recursos Genéticos e Biotecnologia, C. P. 02372, 70770-917 Brasília, DF,Brazil. E-mail: [email protected]

Meloidogyne mayaguensis has been reported in some states ofBrazil causing severe damage on commercial guava crops.Considering the widespread distribution and losses caused

by this nematode in different regions and crops, theobjective of this work was to evaluate the host reactions ofseven accessions of passionfruit (Passiflora setacea, P. coccinea,

320 Vol. 33(4) - 2009


P. nitida, interspecific hybrid of the species P. coccinea x P.setacea- ‘Estrela do cerrado’, Passiflora edulis f. flavicarpa-‘Vermelhinho pequeno’, Passiflora edulis f. flavicarpa- GA2,Passiflora edulis f. flavicarpa- EC2) to M. mayaguensis.Seedlings of each accession were inoculated with 5,000eggs /plant cultivated in pots containing three liters ofsoil. Tomato variety ‘Santa Cruz’ was used to check theinoculum viability. Three months after nematodeinoculation, the rating index number of root-knot galls,

egg-masses, final population densities and reproductionfactors (RF=Final population/5000) were determined.The gall index for different accessions varied from 0.0to 2.5, the egg-mass index ranged from 0 to 1 and theRF <1.0. The RF for the susceptible tomato was about35. All passionfruit accessions tested were resistant toM. mayaguensis and may be suitable plants for croprotation in fields that have previously been infested withM. mayaguensis.

69 – REACTION OF Psidium spp. TO Meloidogyne mayaguensis AND THEIR GRAFTING COMPATIBILITYWITH P. guajava CV. PALUMA [REAÇÃO DE Psidium spp. A Meloidogyne mayaguensis E COMPATIBILIDADE DEENXERTIA COM P. guajava CV. PALUMA] Sousa, M.G.1; Freitas, V.M.2; Matos, J.K.A.2; Silva, J.G.P.1; Resende, F.O.1;Texeira, R.R.1; Carneiro, R.M.D.G.1 1Embrapa Recursos Genéticos e Biotecnologia, C. P. 02372, 70849-970 Brasília, DF,Brazil; 2Universidade de Brasília, C.P. 4364, 70919-970 Brasília, DF, Brazil. E-mail: [email protected]

Meloidogyne mayaguensis Rammah and Hirschmann, 1988 hasbeen reported in some states of Brazil causing severedamage on guava (Psidium guajava L. ). This nematode ismaking cultivation of guava unfeasible in the infested areas,causing serious economic problems to the growers and theeconomy of the region. Accessions of Psidium spp. andAcca sellowiana Berg. were grown from seed in plastic bags(3 L) and, when they reached 15-20 cm in height, they wereinoculated with 5,000 eggs/plant of M. mayaguensis. Eightmonths after inoculation, the different accessions wereevaluated for resistance or susceptibility to the nematode

by reproduction factor (RF). All 39 accessions of P guajavawere highly susceptible to M. mayaguensis. A. sellowiana, oneaccession of P. guineensis Sw. (100) and P. cattleyanum Sabine(63) were considered immune to the nematode (FR=0.0).When used as rootstock, only P. cattleyanum was compatiblewith guava cv Paluma. This rootstock together with P.friedrichsthalianium (Accession Costa Rica ), P. clatteyanum(Acessions: Leodoro, Red Araçá and Ya-cy) also compatiblewith guava cv Paluma were planted in field conditions toevaluate a plant performance in an area naturally infestedby M. mayaguensis.

70 – AVALIAÇÃO DE LINHAGENS AVANÇADAS DE TOMATEIRO INDUSTRIAL PARA REAÇÃO AONEMATÓIDE DAS GALHAS [EVALUATION OF ADVANCED LINEAGES OF INDUSTRIAL TOMATO FORREACTION TO THE ROOT-KNOT NEMATODE] Pinheiro, J.B.1; Furumoto, O.1; Lopes, C.A.1; Boiteux, L.S.1; Silva,G.O.1; Pereira, J.S.1 1Embrapa Hortaliças. C. P. 218. 70359-970 Brasília, DF, Brasil. E-mail: [email protected]

Apesar da existência de cultivares de tomateiros resistentes,as espécies de nematóide das galhas prevalecentes no Brasil,ainda causam prejuízos nessa cultura e algumas espéciespossuem a habilidade de quebrar a resistência conferidapelo gene Mi. Desta forma, faz-se necessário prosseguir nabusca de novas fontes de resistência a populações deMeloidog yne que infectam tomateiros no Brasil. Oexperimento foi conduzido em casa-de-vegetação e noLaboratório de Nematologia da Embrapa Hortaliças. Mudasde tomateiro industrial, mantidas em vasos, em estufaplástica, foram inoculadas com 6000 ovos das seguintesespécies: uma mistura populacional (M. incognita e M. javanica)e M. mayaguensis isoladamente. Foi utilizado o DIC, emesquema fatorial 25x2 com quatro repetições. TomateirosRutgers e Nemadoro foram utilizados como testemunhas

susceptível e resistente, respectivamente. Quarenta e cincodias após a inoculação, as raízes de cada planta foramavaliadas em relação à resistência ao nematóide dasgalhas. As seguintes variáveis nematológicas foramavaliadas: índice de massa de ovos, índice de galhas, ovospor grama de raiz e fator de reprodução. Para a misturapopulacional de M. incognita e M. javanica observou-semenor fator de reprodução nas linhagens: 512(OP)Mi,512(OP)PST, 548(OP)Mi, 629(F7)Mi, 639(F8)Mi e634(F7). Menores valores para esta variável em relaçãoà M. mayaguensis foram verificados nas linhagens512(OP)Mi, 548(OP)Mi, 562(F8)Mi, 629(F7)Mi,633(F8)Mi, 639(F8)Mi, 640(F7)Mi, 641(F8)Mi,512(OP)PST, 523(OP), 528(F9), 536(F9), 551(F8),552(F8), 569(F8), 571(F8), 609(F7).



321

71 – HOST STATUS OF SOME SELECTED BRAZILIAN RICE CULTIVARS TO Meloidogyne incognitaAND Rotylenchulus reniformis [REAÇÃO DE HOSPEDABILIDADE DE ALGUNS CULTIVARES DE ARROZSELECIONADOS A Meloidogyne incognita E Rotylenchulus reniformis] Araújo filho, J.V.1; Machado, A.C.Z.2; Borges, D.C.1;Ferraz, L.C.C.B1 1Departamento de Entomologia, Fitopatologia e Zoologia Agrícola, ESALQ,USP, C. P. 09, 13418-900Piracicaba, SP, Brazil; 2Monsanto do Brasil, Rod. BR 153, km 643, 75650-000 Morrinhos, GO, Brazil. E-mail:[email protected]

Rice (Oryza sativa) is nowadays one of the main alternativesfor crop rotation with soybean and cotton in the largeproducing-areas of the central region of Brazil. However,the host status of most Brazilian cultivars currently usedfor planting in relation to Meloidogyne incognita race 4 andRotylenchulus reniformis has not been investigated and stillremains unknown. Therefore, this study dealt with theassessment of the reaction (resistance or susceptibility) ofsome selected Brazilian rice cultivars to these nematodesunder greenhouse conditions. The host reaction for eachtested interaction was based on data of nematodereproduction factor (RF) and number of nematodes per

gram of roots. Two initial experiments (1 and 2) with M.incognita included 14 cultivars (Cirad 141, Monarca,Primavera, Cambará, Pepita, Curinga, Sertaneja, IAPAR 9,IAPAR 62, IAPAR 63, IAPAR 64, IAPAR 117, IAC 201,IAC 202) inoculated with 4,000 eggs/plant and 18 cultivars(the same ones of experiment 1 plus Maravilha, Talento,Ecco, Bonança) inoculated with 800 eggs/plant,respectively, which allowed all tested cultivars to be rated assusceptible (mean RF values ranged from 1.09 to 12.56). In athird experiment with R. reniformis (Pi = 1,800), which includedthe same cultivars as experiment 1, all cultivars were rated asresistant (mean Rf values ranged from 0.01 to 0.29).

72 – STUDY OF ROOT LESION NEMATODE (Pratylenchus zeae) PARASITISM ON EIGHT COFFEEGENOTYPES [ESTUDO DO PARASITISMO DO NEMATÓIDE DAS LESÕES (Pratylenchus zeae) EM OITOGENÓTIPOS DE CAFEEIRO] Kubo, R.K.1; Fuzita, A.T.1; Kanazawa, T.Y.1; Souza, L.A.B.1; Ferreira, P.H.A.1; Oliveira,C.M.G.1 1Instituto Biológico, C. P. 70, 13001-970 Campinas, SP, Brazil. E-mail:[email protected]

The experiments were carried with the objective to verifythe host reaction of eight coffee genotypes to Pratylenchuszeae, as well as its pathogenicity on these different genotypes.Eight experiments were carried concomitantly, usingcompletely randomized design. Each experiment wascomprised of a coffee genotype and two initial populationdensities of root lesion nematode (Pi= 0 and 500 nematodesper plant). The genotypes Catuaí Vermelho IAC 144, TupiIAC1669-33, Obatã IAC 1669-20, Ouro Amarelo IAC 4397,Ouro Bronze, Mundo Novo IAC 515, Bourbon AmareloIAC 127 and Icatu Amarelo IAC 2944 were used. Theinoculation of coffee plants was carried 200 days after

seedling transplant by the inoculation of 500 nematodesper plant. After 300 days of inoculation, the plant height,root fresh weight and the shoot dry weight were evaluated.Also, the nematode final population (Pf) was estimated bycounting nematodes extracted from roots and substrate.The coffee plants Catuaí Vermelho IAC 144, Tupi IAC1669-33, Obatã IAC 1669-20, Ouro Amarelo IAC 4397, OuroBronze, Mundo Novo IAC 515, Bourbon Amarelo IAC127 and Icatu Amarelo IAC 2944 were poor hosts toPratylenchus zeae population from Jaú, SP. Moreover, thisnematode did not cause damages to the roots and to thedevelopment of the studied plants.

73 – REACTION OF FIVE PEACH ROOTSTOCKS TO Meloidogyne incognita [REAÇÃO DE CINCO PORTA-ENXERTOS DE PESSEGUEIRO A Meloidogyne incognita] Paula, L.A.1; Bianchi, V.J.2; Fachinello, J.C.3; Gomes, C.B.4 1FAEM/UFPEL, C. P. 354, 96010-900 Pelotas, RS, Brazil; 2Departamento de Botânica, Instituto de Biologia,UFPel, 96010-900Pelotas, RS, Brazil; 3Departamento de Fitotecnia, FAEM, UFPel, C. P. 354, 96010-900 Pelotas, RS, Brazil; 4Embrapa ClimaTemperado, Pelotas, RS, Brazil. E-mail: [email protected]

Root-knot nematodes (Meloidogyne spp.) are very commonin peach orchards of Rio Grande do Sul State - Brazil,causing damages and reducing the yield of the plants. Theuse of resistant rootstocks is the most effective andeconomical way to avoid damages caused by this pest inthe orchards. In order to evaluate the reaction of the peach

rootstocks ‘Okinawa’, ‘Flordaguard’, ‘Nagano Wild’, andthe selection ‘UFPel 0402’ (seedling from an openpollination population of Okinawa) and ‘NR-0080407’ (F1seedling from a cross breeding Capdebosqc x Flordaguard)to Meloidogyne incognita, plants obtained by softwood cuttings,maintained in 10 liter plots with sterilized soil, were

322 Vol. 33(4) - 2009


inoculated with 10,000 eggs+J2 of M. incognita (Est.I2) perplant. Seedlings of tomato ‘Santa Cruz’ inoculated in thesame way were used as control and to determine theinoculum viability. The experiment was carried out undergreenhouse conditions and the experimental design wascompletely randomized, with five replications/genotype.Six months after inoculation, the plants were pulled out bythe roots, washed and evaluated for the number of galls aswell as number of eggs per root. The nematodereproduction factor (RF= final population/initialpopulation) was also determined. In spite of galls being

found in the roots of ‘Nagano Wild’, no nematodemultiplication was observed in it. On the other hand, nogalls or reproduction were registered in ‘Okinawa’,‘Flordaguard’, ‘UFPel-0402 Selection’ and ‘RN-0080407Selection’ root systems, showing that these rootstocks areeffective in suppressing the reproduction of M. incognita ascompared to the control (RF=56,77). All the testedgenotypes were considered immune (RF=0.00) to thisspecies of the root-knot nematode and may be used asalternative rootstocks in new orchards or as a source ofresistance to genetic improvement of peach rootstock.

74 – REAÇÃO DE GENÓTIPOS DE MILHO A Meloidogyne ethiopica [REACTION OF CORN GENOTYPESTO Meloidogyne ethiopica] Dias, W.P.1; Silva, J.F.V.1; Ribeiro, N.R.2; Carneiro, R.M.D.G.3 1Embrapa Soja, C. P. 231, 86001-970Londrina, PR, Brazil; 2Universidade Estadual de Londrina, Rodovia Celso Garcia Cid, km 380, C. P. 6001, 86051-990Londrina, PR, Brazil; 3Embrapa Recursos Genéticos e Biotecnologia, C. P. 02372, 70849-970 Brasília, DF, Brazil. E-mail:[email protected]

Recentemente, Meloidogyne ethiopica foi detectada parasitandoquivi no Rio Grande do Sul e soja em São Paulo. Foiintroduzida a partir do Chile, onde causa sérios prejuízosem videiras. Outras culturas (feijão caupi, alface, fava, batata,acácia, abóbora, repolho, pimentão, fumo, cisal, algodão esoja) também têm sido relatadas como hospedeiras. Oobjetivo deste trabalho foi avaliar, em casa-de-vegetação, areação de genótipos de milho a M. ethiopica. Os experimentos(2) foram conduzidos na Embrapa Soja, em Londrina, PR,nos períodos de 08/10 a 11/12/07 e de 04/01 a 05/03/08. O delineamento experimental foi o inteiramentecasualisado, com sete repetições. Além do milho, tambémforam incluídos nos experimentos dois padrões desuscetibilidade (tomateiro ‘Santa Cruz’ e soja ‘Embrapa 20’).

No momento do desbaste (milho) ou do transplantio (sojae tomate), cada planta foi inoculada com 5.000 ovos. Aavaliação aconteceu aos 60 dias após a inoculação e consistiuem determinar o fator de reprodução (FR) do nematóideem cada um dos genótipos. Genótipos com FR<1,0 foramclassificados como resistentes. Ao contrário, eram tidoscomo suscetíveis. Em ambos os experimentos, os FRencontrados na soja (32,4 e 15,6) e no tomateiro (70,5 e32,6) foram altos, mostrando que os inóculos utilizadoseram de boa qualidade. Em milho, os FR variaram de 0,4 a17,8 e de 0,2 a 6,4, nos primeiro e segundo experimentos,respectivamente. De 39 genótipos de milho avaliados,apenas três (‘NB 7361’, ‘GNX 1020’ e ‘GNX 3010’)mostraram resistência a M. ethiopica.

75 – REAÇÃO DE GENÓTIPOS DE MILHO A Meloidogyne mayaguensis [REACTION OF CORNGENOTYPES TO Meloidogyne mayaguensis] Dias, W.P.1; Silva, J.F.V.1; Ribeiro, N.R.2; Carneiro, R.M.D.G.3 1Embrapa Soja, C.P. 231, 86001-970 Londrina, PR, Brazil; 2Universidade Estadual de Londrina, Rodovia Celso Garcia Cid, km 380, C. P.6001, 86051-990 Londrina, PR, Brazil; 3Embrapa Recursos Genéticos e Biotecnologia, C.P. 02372, 70849-970 Brasília,DF, Brasil. E-mail: [email protected]

No Brasil, Meloiodgyne mayaguensis foi descrito, pela primeiravez, em Petrolina, PE, e em Curaçá e Maniçoba, BA,causando perdas elevadas em plantios comerciais degoiabeira. Além da goiabeira, este nematóide pode parasitarolerícolas, ornamentais, fumo, café, mamão, acerola, araçáe soja. O objetivo deste trabalho foi avaliar, em casa-de-vegetação, a reação de genótipos de milho a M. mayaguensis.Os experimentos (2) foram conduzidos na Embrapa Soja,em Londrina, PR, nos períodos de 08/10 a 11/12/07 e de04/01 a 05/03/08. O delineamento experimental foi ointeiramente casualisado, com sete repetições. Além dos

milhos, também foram incluídos nos experimentos, doispadrões de suscetibilidade (tomateiro ‘Santa Cruz’ e soja‘Embrapa 20’). No momento do desbaste (milho) ou dotransplantio (soja e tomate), cada planta foi inoculada com5.000 ovos. A avaliação aconteceu aos 60 dias após ainoculação e consistiu em determinar o fator de reprodução(FR) do nematóide em cada um dos genótipos. Genótiposcom FR<1,0 foram classificados como resistentes. Em casocontrário, eram tidos como suscetíveis. Em ambos osexperimentos, os FR encontrados na soja (86,7 e 51,8) e notomateiro (89,1 e 36,5) foram altos, mostrando que os



323

inóculos utilizados eram de boa qualidade. Em milho, osFR variaram de 0,3 a 13,8 e de 0,3 a 3,2, nos primeiro esegundo experimentos, respectivamente. De 37 genótipos

de milho avaliados, apenas seis (‘NB 7361’, ‘SHS 5080’,‘GNX 1020’, ‘GNX 3010’, ‘BRS 1031’ e ‘BM 1115’)comportaram-se como resistentes a M. mayaguensis.

76 – HOST STATUS OF SOME SELECTED BRAZILIAN SOYBEAN CULTIVARS TO Pratylenchusbrachyurus [REAÇÃO DE HOSPEDABILIDADE DE ALGUNS CULTIVARES DE SOJA A Pratylenchus brachyurus]Machado, A.C.Z.1 1Monsanto do Brasil, Rod. BR 153, km 643, 75650-000 Morrinhos, GO, Brazil. E-mail:[email protected]

Pratylenchus brachyurus is a worldwide pathogen which hascaused frequent and extensive losses to important crops inBrazil, such as cotton and soybean. The host status of mostBrazilian cultivars currently used for planting or breedingprograms in relation to P. brachyurus has not been adequatelystudied. Therefore, two greenhouse trials were conductedin order to assess the reaction (resistance or susceptibility)of 42 selected Brazilian soybean cultivars to this nematode:M8360RR, M8378RR, M8925RR, M7639RR, M8001,M6101, M9056RR, M7908RR, M7211RR, M7578RR,M8849RR, M8867RR, M9144RR, M8336RR, M8527RR,M8787RR, TMG 103RR, TMG 117RR, BRSGOChapadões, and P98Y11RR in experiment 1, and FT-Cometa, BRS 133, BRS GO Caiapônia, Anta 82 RR, V-Max RR, BMX Apolo RR, BRS Valiosa RR, Cristalina, BRSMT Pintado, FMT Tucunaré, Xingu, Goiânia, Mineiros, BRSFavorita RR, FMT Kaiabi, MG BR 46 Conquista,

M8199RR, AS7307RR, and the PIs 90763, 88788, Pickett,and Peking, in experiment 2. Okra (Abelmoschus esculentus)and Crotalaria spectabilis were the susceptible and the resistantstandards, respectively. The initial population inoculated was1,000 nematodes and eggs/plant. Evaluation was done 67and 62 days after inoculation, in experiments 1 and 2,respectively, and was based on data of nematodereproduction factor (RF) and number of nematodes pergram of roots. All cultivars tested were rated as susceptible(mean RF values ranged from 1.37 to 43.04), but from apractical point of view, at least five (M7639RR, M8925RR,M8360RR, M8378RR, and BRSGO Chapadões) could beused in infested areas with P. brachyurus in order to maintainor slightly increase the population, due to the lower RFfound for these cultivars (RF values ranged from 1.37 to2.59), if associated with other management practices, suchas crop rotation with non-hosts.

77 – RESPOSTA DE DEFESA DO CAFEEIRO À Meloidogyne exigua EM CULTIVAR RESISTENTE EPLANTA NÃO HOSPEDEIRA. [DEFENSE RESPONSES OF COFFEE TO Meloidogyne exigua IN RESISTANTCULTIVAR AND NON HOST PLANT] Silva, R.V.1; Oliveira, R.D.L.2; Ferreira, P.S.2; Ferreira, A.O.2; Pereira, A.A.3 1IFGoiano, Campus Morrinhos, 75650-000 Morrinhos, GO, Brazil; 2Depto. Fitopatologia, UFV, 36570-000 Viçosa, MG,Brasil; 3EPAMIG, 36570-000 Viçosa, MG, Brazil. E-mail: [email protected]

Sabe-se que a resistência do cafeeiro a Meloidogyne exigua éconferida por um gene dominante, denominado Mex 1.Entretanto, os mecanismos envolvidos nessa resistênciaainda necessitam de esclarecimentos. Com o objetivo deelucidar tais mecanismos estudou-se a penetração, odesenvolvimento e a reprodução de duas populações dessepatógeno nas cultivares Catuaí Vermelho IAC 44 e ApoatãIAC 2258, suscetível e resistente, respectivamente. Apopulação 1 do nematóide foi coletada em cafeeiro (raça2) e a 2 em seringueira (raça 3). Inocularam-se 2000 juvenisde segundo estádio (J2) de M. exigua em mudas de cafeeirocom 3-4 pares de folhas. Uma maior quantidade de J2 dapopulação 1 penetrou nas raízes da cultivar suscetível,enquanto que para a população 2, não houve diferença entreas duas cultivares. O desenvolvimento do nematóidetambém foi mais rápido no cafeeiro suscetível. Poucosindivíduos atingiram o estádio de fêmea adulta e

reproduziram no cafeeiro resistente, mesmo assim sóquando a inoculação foi feita com a população 1. O númerode galhas e de ovos produzidos pela população 1 de M.exigua , na cultivar suscetível, foi de 76 e 5460,respectivamente. Em raízes de cafeeiro ‘Apoatã’, apesar deter formado algumas poucas galhas, não houve reproduçãodo nematóide. A população 2 do nematóide não induziu aformação de galhas e nem a produção de ovos nas duascultivares de cafeeiro. Pela análise histopatológica,observaram-se eventos relacionados com a resposta dehipersensibilidade (HR), células deformadas e necrosadas,condensação do citoplasma e grande acúmulo de compostosfenólicos. No entanto, outras respostas de defesa da planta,pré e pós-penetração, também foram observadas a M. exigua,as quais não necessariamente provocaram a morte dos J2,mas inibiram a formação do sítio de alimentação,provocaram a emigração dos J2 e causaram atraso ou

324 Vol. 33(4) - 2009


inibição do desenvolvimento e da reprodução do nematóide.Conclui-se que a resistência do cafeeiro a M. exigua não édevida apenas a HR, como sugerido em estudos anteriores,

mas existe um conjunto de respostas de defesa, tantoconstitutivas quanto induzidas após a penetração donematóide. Financiado: PNP&D/Café e FAPEMIG.

78 – BIOCHEMICAL RESPONSES OF RESISTANT COFFEE TO Meloidogyne exigua MEDIATED BYSILICON [RESPOSTAS DE DEFESA DO CAFEEIRO A Meloidogyne exigua POTENCIALIZADAS PELO SILÍCIO]Silva, R.V.1; Oliveira, R.D.L.2; Nascimento, K.J.T.2; Rodrigues, F.Á.2 1IF Goiano, Campus Morrinhos, 75650-000 Morrinhos,GO, Brazil; 2Department of Plant Pathology, Federal University of Viçosa, 36570-000 Viçosa, MG, Brazil. E-mail:[email protected]

This study aimed to evaluate the effect of silicon (Si) onthe capacity of M. exigua reproduction on coffee roots andthe biochemical mechanisms feasibly involved with anincrease in resistance mediated by this element. Plants fromcultivars Catuaí 44 and IAPAR 59 susceptible and resistant,respectively, to M. exigua were grown in plastic potscontaining Si-deficient soil amended with either calciumsilicate (+Si) or calcium carbonate (-Si). The number ofgalls (NG) and the number of eggs (NE) per root system,the concentration of total soluble phenolic (TSP) and lignin-thioglycolic acid (LTGA) derivatives, and the activity ofperoxidases (POX), polyphenoloxidases (PPO), andphenylalanine ammonia lyases (PAL) were determined.There was an increase of 152 and 100%, respectively, in Sicontent in root tissue of plants from both cultivars in the+Si treatment (+Si T) as compared to the -Si treatment (-SiT). There was no significant difference between Si T forCa content on root tissue, so it can be concluded thatvariations in Si accounted for differences in the level ofresistance, especially for the susceptible cultivar, to M. exigua.The NG and NE significantly decreased in the presenceof Si only for cultivar Catuaí 44. The NG and NE weresignificantly lower for cultivar IAPAR 59 regardless of the

Si T. There was no significant difference between Si T andcultivars for the concentration of TSP. The concentrationof LTGA derivatives significantly increased in roots ofinoculated plants of cultivar Catuaí 44 in the +Si T and inroots of inoculated plants of cultivar IAPAR 59 regardlessof the Si T. The concentration of LTGA derivatives alsosignificantly increased in roots of plants from cultivar Catuaí44 inoculated or not inoculated with M. exigua and only inroots of inoculated plants from cultivar IAPAR 59. ThePOX, PPO, and PAL activities significantly increased inroots of inoculated plants as compared to roots from non-inoculated plants, regardless of the cultivars and Si T. ThePOX and PPO activities in roots of inoculated plantsfrom both cultivars were significantly higher in thepresence of Si. The PAL activity in roots of non-inoculated plants from both cultivars was significantlyhigher in the presence of Si. Results of this study clearlysuggest that supplying Si to coffee plants can increaseresistance to M. exigua by decreasing the reproductivecapacity of this nematode on roots in association withan enhanced production of lignin and high activities ofPOX, PPO, and PAL, especially for the susceptiblecultivar. (FAPEMIG/PNP&D Café)

79 – MANEJO DE Meloidogyne incognita RAÇA 3 UTILIZANDO SILÍCIO COMO POTENCIALIZADORDE RESISTÊNCIA [MANAGEMENT OF Meloidogyne incognita RACE 3 WITH SILICON AS RESISTANCEINDUCER] Fonseca, S.O.1; Belan, L.L.1; Moraes, W.B.1; Araujo, G.L.1; Alves, F.R.1; Souza, A.F.1; Jesus Júnior, W.C.11Laboratório de Fitopatologia, Centro de Ciências Agrárias, UFES, 29500-000 Alegre, ES, Brasil. E-mail:[email protected]

Dentre os principais patógenos que reduzem a produçãode pepino (Cucumis sativus L.), os nematóides das galhas(Meloidogyne spp.) se destacam, pois, ao parasitarem o sistemaradicular, acarretam o subdesenvolvimento das plantas,sintomas de deficiência nutricional e baixo peso dos frutos.Vários métodos de controle são utilizados para a reduçãopopulacional desses patógenos, porém, tais métodos nãosão praticáveis em todas as áreas de cultivo e nem sempreapresentam níveis de controle satisfatórios. Por isso, táticasalternativas de manejo, a exemplo da utilização de

potencializadores de resistência, como o silício, devem serestudadas. O experimento foi conduzido em casa devegetação no Centro de Ciências Agrárias da UniversidadeFederal do Espírito Santo (CCA-UFES) em delineamentointeiramente casualizado com sete tratamentos e oitorepetições. Objetivou-se avaliar o efeito de doses crescentesde silício (0; 0,5; 0,75; 1; 1,25; 1,5; 1,75 g de Agrossilício/dm3 de solo), adicionados a um solo contendo 5 mg/dm3

de silício, no manejo de M. incognita raça 3 parasitando acultura do pepino. Para cada tratamento foram adicionados



325

óxido de cálcio e óxido de magnésio ao solo, em quantidadesequivalentes aos teores de cálcio e magnésio dos referidostratamentos, a fim de neutralizar o efeito destes elementossobre os nematóides. Posteriormente, o solo foi incubadopor um período de 60 dias. Durante esse período, a umidadedo solo foi mantida constante a 60% da capacidade de

campo. Três semanas após o plantio, cada planta foiinoculada com 5.000 ovos do nematóide. Quarenta diasmais tarde, foram determinados o número de galhas,número de massas de ovos e a população final dosnematóides. Não se observou efeito do silício na reduçãopopulacional do nematóide para as condições experimentais

80 – SUSCEPTIBILITY OF LETTUCE CULTIVARS TO Meloidogyne incognita [SUSCETIBILIDADE DECULTIVARES DE ALFACE A Meloidogyne incognita] Chiamolera, F.M.1; Cunha, T.P.L.1; Dias-Arieira, C.R.1; Puerari, H.H.1;Cosmo, D.A.1; Mattos, R.M.1; Sassaki, T.C.1, Biela, F.1 1Universidade Estadual de Maringá, Campus Regional de Umuarama,C.P. 65, 87501-970 Umuarama, Paraná, Brazil. E-mail: [email protected]

Currently, lettuce is one of the most consumed vegetablesin Brazil. The area planted with this plant has been growingconstantly in Paraná, including the northwest. Among thefactors affecting the production of lettuce are root knotnematodes. However, different genotypes may have variablebehavior to these pathogen populations. Thus, the objectiveof this work was to evaluate the susceptibility of differentlettuce cultivars to Meloidogyne incognita. For this, seedlingspreviously germinated in substrate were transplanted to potswith a capacity for one liter containing soil: sand (2:1),previously autoclaved. After three days the plants wereinoculated with a nematode suspension containing 4000

eggs + juveniles. The treatments were crisp lettuce type:Isabela and Vera, American type: Maurem, Loose Leaf type:Elisabeth and Elisa, Roman type: Branca de Paris and Mirellaand Mimosa type: Salad Bowl. The control was the tomatocv. Santa Cruz. The experiment was completely randomized,with four replications. Data were submitted to analysis ofvariance and means were compared by Tukey test 5%. Sixtydays after inoculation the plants were removed and the rootsevaluated for the number of galls and juveniles. Only thecultivar Vera showed fewer galls than the control, but allhad a lower number of eggs than the tomato. There was noreaction of immunity among the cultivars evaluated.

81 – PRIMEIRO RELATO DA OCORRÊNCIA DE Meloidogyne paranaensis EM CAFEEIRO NO ESTADODO ESPÍRITO SANTO, BRASIL [FIRST REPORT OF THE OCCURRENCE OF Meloidogyne paranaensis IN COFFEEPLANTS IN ESPIRITO SANTO STATE, BRAZIL]. Barros, A.F.1; Oliveira, R.D.L.1; Zambolim, L.1; Ferreira, A.O.1;Araújo, E.O.1 1Universidade Federal de Viçosa, Departamento de Fitopatologia, 36570-000 Viçosa, MG, Brazil. E-mail:[email protected]

Meloidogyne paranaensis é a espécie mais recente, dentre osnematóides das galhas, relatada parasitando o cafeeiro noBrasil, e se apresenta tão destrutiva a essa cultura quantoM. incognita. No Brasil, M. paranaensis já foi detectado nosEstados de Minas Gerais, Goiás, São Paulo e Paraná. Nessesdois últimos, se encontra amplamente disseminadocausando grandes prejuízos. Recentemente, em lavouracafeeira (Coffea arabica var. Catucai) do Estado do EspíritoSanto, município de São Gabriel da Palha, observaram-se plantas amareladas com crescimento retardado, asraízes mais grossas apresentando engrossamentoslocalizados, sem caracterizar a formação de galhas típicas.

Era comum a ocor rência de escamações(descorticamento) nessas raízes, mas escamações e galhasnão eram observadas nas radicelas. Para a diagnose,coletaram-se amostras de solo e raízes na área de projeçãoda copa de plantas afetadas, as quais foram encaminhadaspara o laboratório de Nematologia da UFV. Aidentificação foi realizada por meio da eletroforese deisoenzimas e coloração do gel para esterase, que resultouno fenótipo P1, típico de M. paranaensis. Ressalta-se aimportância de medidas de exclusão para evitar adisseminação do patógeno. Apoio financeiro: CBP&DCafé e FAPEMIG

Section 3 - Detection and Ecology of Nematodes

326 Vol. 33(4) - 2009


82 – OCORRÊNCIA DE Pratylenchus brachyurus EM POMARES DE GOIABEIRA NO ESTADO DE SÃOPAULO [OCCURRENCE OF Pratylenchus brachyurus IN GUAVA ORCHARDS IN SÃO PAULO STATE] Ruas, A.R.1;Barbosa, B.F.F.2; Becaro, C.K.2; Almeida, E.J.2; Soares, P.L.M.2; Santos, J.M.2 1Bioenergia Sucroalcooleira FATEC, 14884-900 Jaboticabal, SP, Brazil; 2UNESP, Faculdade de Ciências Agrárias e Veterinárias, 14884-900 Jaboticabal, SP, Brazil. E-mail: [email protected]

A goiabeira, Psidium guajava L., é uma fruteira tropicalpertencente à família das Myrtaceae, possui grande valorcomercial e nutricional uma vez que a polpa dos frutos érica em sais minerais e vitamina C, sendo esta utilizada emgrande escala pela indústria alimentícia. A cultura, no Brasil,enfrenta problemas de natureza fitossanitária entre os quaisse destaca a susceptibilidade ao nematóide de galhaMeloidogyne mayaguensis. Recentemente, foram inspecionadospomares de goiabeira nos municípios de Itápolis, Bauru eMatão – SP, do cultivar Paluma exibindo sintomas dedepauperamento. Foram coletadas amostras de solo e raízesem plantas que apresentavam severos sintomas de redução

no crescimento, folhas menores e em menor densidade,arroxeadas e raízes sem galhas, exibindo áreas necróticas.Alíquotas das amostras de solo e raízes foramprocessadas no Laboratório de Nematologia doDepartamento de Fitossanidade da UNESP/FCAV.Foram encontrados 9540 espécimes de Pratylenchusbrachyurus por 10 gramas de raízes e 20 por 100 cm3 dasamostras de solo. Conquanto os sintomas se assemelhemaos causados por Meloidogyne mayaguensis, em goiabeira,os danos foram atribuídos a P. brachyurus e esse constituio primeiro registro de danos a essa cultura, causado poresse nematóide.

83 – WILL Meloidogyne minor BECOME A THREAT TO OUR AGRICULTURE? [Meloidogyne minor SETORNARÁ UMA AMEAÇA PARA A NOSSA AGRICULTURA?] Van Der Sommen, A.T.C.1; Van Gastel A.W.2; Visser,J.H.M.2; Den Nijs, L.J.M.F.1; Korthals, G.W.2 1Plant Protection Service, Division Diagnostics, PO BOX 9102 6700 HCWageningen, the Netherlands; 2Applied Plant Research, PO BOX 430 8200 AK Lelystad, the Netherlands. E-mail:[email protected]

M. minor is a recently described nematode (Karssen et al,2004). It has been found in the UK and the Netherlandson sport fields, golf courses, and more recently also inpotato growing fields. A Pest Risk Analysis (PRA, October2006) was carried out, which showed a lack of informationon the damage thresholds on arable crops. Therefore, aproject was started with the aim of resolving this lack ofknowledge. In 2008, a naturally infested field was subjected

to a variety of crops (maize, rye, Italian Ryegrass, potato,sugar beet, black fallow) to achieve various densities of M.minor in the soil. In Spring 2009 two potato cultivars will beplanted in these plots with different M. minor densities.Damage on the yields will be recorded in combination withthe final population densities, which should make it possibleto quantify the impact of this nematode on potatoes. Theresults will be used for finalizing the PRA.

84 – VERTICAL DISTRIBUTION OF NEMATODES AFTER TEN YEARS UNDER DIFFERENT SOILMANAGEMENT SYSTEMS [DISTRIBUIÇÃO VERTICAL DE NEMATÓIDES APÓS DEZ ANOS SOBDIFERENTES SISTEMAS DE MANEJO DO SOLO] Goulart, A.M.C.1; Sá, M.A.C.1; Santos Junior, J.D.G.1; Ferreira,E.A.B.1; Resck, D.V.S.1 1Embrapa Cerrados, BR 020, Km 18, 73010-970 Planaltina, DF, Brazil. E-mail:[email protected]

Little information is available concerning the effects ofmanagement systems on vertical distribution of nematodesin tropical soils, especially in the Brazilian Savanna. Theobjective of this study was to determine the verticaldistribution of plant-parasitic nematodes in an Oxisol underdifferent management systems. The vertical distribution ofnematodes down to a depth of 40 cm in a Savanna Oxisol(Rhodic Haplustox) was studied after 10 years of sixcontrasting soil management systems: 1) native savanna; 2)Brachiaria brizantha grass pasture; 3) continuous soybean

sowed after soil tillage with a heavy disk harrow implement;4) continuous soybean sowed after soil tillage with a diskplow; 5) soybean/corn rotation sowed after soil tillage witha chisel plow; 6) soybean/corn rotation cultivated in no-tillsystem. The study was carried out in a long-term fieldexperiment at Embrapa Cerrados (Planaltina, DF, Brazil).In 1996, after the removal of the native savanna, theexperiment was started in order to evaluate different soilmanagement systems, including soil tillage and crop rotationsystems. The experiment was established in a randomized



327

complete block design, with three replications. In February2007, at crop flowering time, three soil composite sampleswere taken from five soil layers (0-5, 5-10, 10-20, 20-30and 30-40 cm) from each treatment. After extraction bythe Jenkins method, nematodes were quantified andidentified at genus or species level. The following plant-parasitic nematode genera were found in field experimentalplots: Helicotylenchus, Meloidogyne, Mesocriconema, Paratrichodorus,Paratylenchus and Pratylenchus. The number of nematodesper 50 g of soil were related to different soil layers and datawere analyzed using polynomial regression (P<0.05 orP<0.01). Significant equations with high determinationcoefficients were obtained for the following nematodegenera: Helicotylenchus, Mesocriconema, Paratrichodorus andPratylenchus. Helicotylenchus showed different types ofdistribution in the soil profile, according to the soil

management system. Mesocriconema was found only in thenative savanna. Regarding Pratylenchus and Paratrichodorus,significant equations were obtained only for the pasturesystem. This study showed that: i) Helicotylenchus dihysterahad different vertical distributions under differentmanagement systems, showing high numbers in upper soillayers in no-till and pasture systems, and high numbers inthe second and third soil layers (5-10 and 10-20 cm) in theother treatments; ii) Mesocriconema sp. was found down to30 cm, only in the native savanna and always with highnumbers in upper soil layers; iii) in pasture, Helicotylenchusdihystera, Pratylenchus spp. (P. brachyurus and P. zeae) andParatrichodorus minor showed different vertical distributions;iv) P. minor was the only one that showed high numbers indeep soil layers (10-20 cm) in pasture. Acknowledgement:FAPDF, for financial support.

85 – VERTICAL DISTRIBUTION OF NEMATODES AFTER 28 YEARS UNDER DIFFERENT SOILMANAGEMENT SYSTEMS [DISTRIBUIÇÃO VERTICAL DE NEMATÓIDES APÓS 28 ANOS SOBDIFERENTES SISTEMAS DE MANEJO DO SOLO] Goulart, A.M.C.1; Sá, M.A.C.1; Santos Junior, J.D.G.1; Ferreira,E.A.B.1; Resck, D.V.S.1 1Embrapa Cerrados, BR 020, Km 18, 73010-970 Planaltina, DF, Brazil. E-mail:[email protected]

Little information is available concerning the effects of soilmanagement systems on vertical distribution of nematodesin tropical soils, especially in the Brazilian Savanna. Theobjective of this study was to determine the verticaldistribution of dominant genera of plant-parasiticnematodes under different soil management systems in anOxisol. The vertical distribution of plant-parasiticnematodes down to a depth of 40 cm in a Savanna Oxisol(Rhodic Haplustox) was studied after 28 years of fivecontrasting soil management systems, including nativesavanna. The study was carried out in a long-term fieldexperiment at Embrapa Cerrados (Planaltina, DF, Brazil).In 1979, the experiment was started in order to evaluatesoil tillage systems. In the first year of the experiment, halfof the area was prepared with disk plow and the other halfwas prepared with moldboard plow. In the second year,two types of tillage were established in the area preparedwith disk plow: disk plow after harvesting and beforeplanting (DP); no-till system (NT-DP). In the same year,also two types of tillage were established in the areaprepared with moldboard plow: moldboard plow afterharvesting and before planting (MP); no-till system (NT-MP). In March 2008, at corn (Zea mays) flowering time,three soil composite samples were taken from five soil layers(0-5, 5-10, 10-20, 20-30 and 30-40 cm) from each treatment(including adjacent native savanna). At sampling time, all

the experiment had been carried out in a legume-grassannual rotation for 28 years. After extraction by the Jenkinsmethod, nematodes were quantified and identified at genusor species level. The following plant-parasitic nematodegenera were found in field experimental plots: Helicotylenchus,Meloidogyne, Mesocriconema, Paratrichodorus, Paratylenchus andPratylenchus. The number of nematodes per 200 g of soilwere related to different soil layers and data wereanalyzed using polynomial regression (P<0.05 orP<0.01). Significant equations with high determinationcoefficients were obtained for the following nematodegenera: Helicotylenchus, Mesocriconema, Paratrichodorus andPratylenchus. Helicotylenchus and Paratrichodorus showeddifferent types of distribution in the soil profile,according to the soil management system. RegardingMesocriconema and Pratylenchus, significant equations wereobtained only for MP and NT-MP, respectively. Thisstudy showed that: i) Helicotylenchus dihystera andParatrichodorus minor had different vertical distributionsunder different soil management systems, but always withhigh numbers in upper soil layers; ii) Mesocriconema sp.was the only one that showed high numbers in deep soillayers (20-30 cm) in MP, but not in savanna; iii)Pratylenchus spp. (P. brachyurus and P. zeae) showed highnumbers in upper soi l layers in NT-MP.Acknowledgement: FAPDF, for financial support.

328 Vol. 33(4) - 2009


86 – NEMATODE DIVERSITY AND ABUNDANCE IN OXISOL UNDER NATIVE SAVANNA ORSUBMITTED TO DIFFERENT MANAGEMENT SYSTEMS: LONG-TERM EXPERIMENT EVALUATIONAFTER TEN AND ELEVEN YEARS [DIVERSIDADE E ABUNDÂNCIA DE NEMATÓIDES EM LATOSSOLOSOB CERRADO NATIVO OU SUBMETIDO A DIFERENTES SISTEMAS DE MANEJO: AVALIAÇÃO DEEXPERIMENTO DE LONGA DURAÇÃO APÓS DEZ E ONZE ANOS] Goulart, A.M.C.1; Sá, M.A.C.1; SantosJunior, J.D.G.1; Ferreira, E.A.B.1; Resck, D.V.S.1 1Embrapa Cerrados, BR 020, Km 18, 73010-970 Planaltina, DF, Brazil. E-mail: [email protected]

Little information is available concerning the effects of soilmanagement systems on diversity and abundance ofnematodes and their potential as indicators ofenvironmental disturbances and soil quality, especially inBrazilian soils. The objective of this study was to evaluatediversity and abundance of plant-parasitic and some free-living nematodes in an Oxisol under different soilmanagement systems and to investigate the potential ofnematodes as bioindicators of soil quality in the BrazilianSavanna region. The diversity and abundance of nematodesdown to a depth of 40 cm in a Savanna Oxisol (RhodicHaplustox) were studied after 10 and 11 years of sixcontrasting soil management systems: 1) native savanna; 2)Brachiaria brizantha grass pasture; 3) continuous soybeansowed after soil tillage with a heavy disk harrow implement;4) continuous soybean sowed after soil tillage with a diskplow; 5) soybean/corn rotation sowed after soil tillage witha chisel plow; 6) soybean/corn rotation cultivated in no-tillsystem. The study was carried out in a long-term fieldexperiment at Embrapa Cerrados (Planaltina, DF, Brazil:15º 35’ 30" S, 47º 42’ 00" W). In 1996, after removal of thenative savanna, the experiment was started in order toevaluate different soil management systems, including soiltillage and crop rotation systems. The experiment wasestablished in a randomized complete block design, with

three replications. In February 2007 and March 2008, atcrop flowering time, three soil composite samples weretaken from five soil layers (0-5, 5-10, 10-20, 20-30 and 30-40 cm) from each treatment. After extraction by the Jenkinsmethod, nematodes were quantified and identified at genusor species level. The following plant-parasitic nematodegenera were found in field experimental plots: Helicotylenchus,Meloidogyne, Mesocriconema, Paratrichodorus, Paratylenchus,Pratylenchus and Xiphinema. Some fungivorous or plant-associated nematodes (Aphelenchoides, Aphelenchus, Ditylenchusand Tylenchus) were also identified and quantified, besidesthe total number of free-living nematodes. The analyzedvariables were the following nematode abundances: total,plant-parasitic, free-living and key-genera. The averageswere compared using Duncan’s Test (P<0.05). The resultssuggest that different soil management systems affectdiversity and abundance of nematodes. In both years (2007and 2008) of evaluation, there were differences betweentreatments regarding the abundances of the following keygenera: Mesocriconema; Paratrichodorus ; Paratylenchus ;Helicotylenchus; Aphelenchus. Relative abundances of plant-parasitic nematodes and free-living ones, as well as absoluteabundances of Criconematoidea, are potential indicatorsof environmental disturbances and soil quality.Acknowledgement: FAPDF, for financial support.

87 – POPULATION DYNAMICS OF Meloidogyne incognita ON FIG TREES TREATED WITHMANIPUEIRA, IN WESTERN PARANÁ, BRAZIL [DINÂMICA POPULACIONAL DE Meloidogyne incognita EMFIGUEIRAS TRATADAS COM MANIPUEIRA NA REGIÃO OESTE DO PARANÁ, BRASIL] Formentini, H.M.1;Furlanetto, C.2; Cruz, M.I.F.1; Estevez, R.L.1; Casagrande, C.Jr.1; Dildey, O.1 1Universidade Estadual do Oeste do Paraná,Centro de Ciências Agrárias, Marechal Cândido 85.960-000 Rondon, PR, Brazil; 2Universidade de Brasília, Departamentode Fitopatologia, 70.910-900 Brasília, DF, Brazil. E-mail: [email protected]

Meloidogyne incognita is one of the main parasites of fig cropsin Brazil. Manipueira is a liquid residue produced by theprocessing of cassava roots and a potent nematicide.Considering the potential of this residue in the control ofthis nematode, this work aimed to study the populationfluctuation of M. incognita on five-year-old fig trees cv. Roxode Valinhos. The field experiment was carried out in acompletely randomized design with 4 treatments (controlwater, manipueira 10%, manipueira 25% and manipueira

50%) and 5 replications. Each replication was composedof single fig plants. Manipueira was applied monthly onsoil (4 L m-2) under the target trees. Soil samples werecollected in the projection area of fig canopies (0-20 cmlayer) for the 12 months of the experimentation period andbefore each application of manipueira. Afterwards, the J2were extracted from 100 cc soil samples and quantified.The results showed that M. incognita population decreasedin dry and cold periods and increased during warm and



329

moist periods for all the treatments. A higher concentrationof nematodes in soil was detected on control plants thanon plants treated with manipueira, during the

experimentation period. Manipueira 25% and 50% werethe most effective for reduction of M. incognita J2 in soil.Research supported by CNPq.

88 – Meloidogyne SPECIES DETECTED IN SUGARCANE FIELDS IN THE STATE OF PERNAMBUCO,BRAZIL [ESPÉCIES DE Meloidogyne DETECTADAS EM CANAVIAIS DO ESTADO DE PERNAMBUCO, BRASIL]Moura, R.M.1; Almeida, M.R.A.2; Costa, M.B.1; Lima, S.T.S.1; Carneiro, R.M.D.G.2 1UFPE, Centro Acadêmico de Vitória,Laboratório de Microbiologia e Imunologia, rua Alto do Reservatório, s/n, 55.608-680, PE, Brazil; 2Embrapa RecursosGenéticos e Biotecnologia, C. P. 02372, 70770-917 Brasília, DF, Brazil. E-mail: [email protected]

As reported by international and national literature, root-knot nematodes (Meloidogyne spp) are widespread all overthe world where sugarcane is grown commercially. In theNortheast of Brazil, a large sugarcane producing area, root-knot species are responsible for high losses. Previoussurveys in sugarcane low yield areas detected M. incognitaand M. javanica. The identification was made on the basisof perineal patterns. In this study, enzyme phenotypes,specifically esterases (EST) were used to characterizedifferent species of Meloidogyne from sugarcane. For thissurvey two geographic areas were considered: North andSouth of State of Pernambuco and the industries locatedalong the costal rainforest area. In order to reproduce

Meloidogyne spp. for esterase characterization, tomatoes wereused as a biological indicator after a period of 30-60 days.The species M. arenaria (EST A2, Rm: 1.2, 1.3), M. incognia(EST I2, Rm: 1.0, 1.1; EST I1, Rm:1.0), M. mayaguensis (EstM4, Rm: 0.7, 0.75, 0.9,0.95), M. javanica (EST J3, Rm:1.0,1.25,1.4) and M. hispanica (Hi3, Rm:0.8, 0.9, 1.05) wereidentified. The species of Meloidogyne are frequently mixedin the samples and in terms of percentage of occurrencefor region North and South: M. arenaria (46.3, 44.5), M.incognita (31.7, 7.4), M. mayaguensis (12.1, 33.3), M. javanica(2.4, 0), M. hispanica (0, 3.7) and atypical phenotypes (7.3,0). It is the first report of M. arenaria and M. mayaguensisdetection on sugarcane in Brazil.

89 – ALTERAÇÕES NA COMUNIDADE DE NEMATÓIDES DEVIDO A COMPACTAÇÃO CAUSADA PORMÁQUINAS [CHANGES IN THE NEMATODE COMMUNITY DUE TO COMPACTION CAUSED BYMACHINERY] Baida, F.C.1; Santiago, D.C.1; Guimarães, M.F.1; Colombano, L.P.1; Arieira, G.O.1; Pereira, R.F.G.1; Sbrussi,C.A.G.1; Stroze, C.T.1 1Universidade Estadual de Londrina, Departamento de Agronomia, C. P. 6001, 86051-990 Londrina,PR, Brazil. E-mail: [email protected]

O manejo inadequado causa compactação do solo, sendo aintensidade do tráfego e as características da máquina asprincipais causas. Atualmente, tem-se observadocompactação superficial, devido ao uso de máquinas maispesadas e ao manejo realizado sem o controle da umidade.Este manejo do solo diminui a quantidade de formas devida presentes neste ambiente. A avaliação da qualidade dosolo pode ser realizada pelo monitoramento de seusatributos ou por características biológicas. Os nematóidesse enquadram nesses critérios, pois respondem com rapideza perturbação. Assim, o objetivo deste trabalho foi avaliaro efeito de três cargas de máquinas sobre a comunidade denematóides, em áreas sob Sistema de Semeadura Direta(SSD). O experimento foi conduzido em um LatossoloVermelho distroférrico (LVd) argiloso, no município deLondrina, PR, há dezessete anos em SSD. O solo, com altaumidade, foi submetido à passagem de máquinas comdiferentes cargas (trator médio tracionando uma semeadoradireta com oito linhas e carga no eixo de 3,8 Mg; tratorpesado tracionando uma semeadora de dez linhas e carga

no eixo de 7,2 Mg e, colhedora com carga no eixo de 10,2Mg), para promover diferentes níveis de compactação. Após,em cada tratamento, foram coletadas amostras de solo emseis monólitos, distanciados 10 metros entre si. As amostrasforam processadas e clarificadas em laboratório e osnematóides extraídos foram analisados ao microscópioótico. Houve, em todas as áreas, uma baixa diversidade denematóides, sendo encontrados oito gêneros. A área comcarga de 10,2 Mg foi a que apresentou maior abundância denematóides, embora, tenha apresentado redução na populaçãode todos os gêneros de predadores/onívoros. Independenteda carga aplicada ao solo, as áreas foram dominadas pornematóides bacteriófagos da família Rhabditidae, sendoRhabdtis sp. e Cruznema sp. os gêneros mais abundantes. Entreos fitófagos, foi encontrado Helicotylenchus dihystera em baixaquantidade. A via de decomposição de matéria orgânica foi,em todas as áreas, essencialmente bacteriófaga. A cargaaplicada foi diferenciada apenas na população de nematóidespredadores/onívoros, talvez por esses serem mais sensíveisa distúrbios e relacionados a comunidades mais estáveis.

330 Vol. 33(4) - 2009


Entretanto, a baixa diversidade de nematóides indica quequalquer que seja a carga, implica na redução da diversidadedos nematóides, devido ao fato de que a maior parte dos

danos causados pela compactação ocorre logo nas primeiraspassadas das máquinas e implementos, variando poucoquanto ao tipo de máquina utilizada.

90 – ALTERAÇÕES NA ESTRUTURA TRÓFICA DA COMUNIDADE DE NEMATÓIDES EM ÁREAS DECANA-DE-AÇÚCAR EM FUNÇÃO DO TEMPO DE CULTIVO [CHANGES IN TROPHIC STRUCTURE OFTHE NEMATODE COMMUNITY IN SUGARCANE AREAS IN FUNCTION OF CULTIVATION TIME] Baida,F.C.1; Santiago, D.C.1; Guimarães, M.F.1; Peñuela, J.E.B.2; Arieira, G.O.1; Pereira, R.F.G.1; Sbrussi, C.A.G.1; Stroze, C.T.11Universidade Estadual de Londrina, Departamento de Agronomia, C. P. 6001, 86051-990 Londrina, PR, Brazil. E-mail:[email protected]

Os nematóides que ocorrem no solo são invertebrados,vermiformes e muito pequenos e apresentam grandeabundância e diversidade, participando de todos os níveistróficos da rede alimentar. As funções ecológicas dessesnematóides incluem a decomposição da matéria orgânica,mineralização de nutrientes, degradação de toxinas eregulação da população de agentes causadores de doençasde plantas, podendo, ainda, parasitar as raízes das plantas.As perturbações causadas pelas mudanças no uso do solocausam impactos na fauna, levando a alterações dadensidade e diversidade desta, proporcionando alteraçõesnas propriedades biológicas do solo. Assim, o objetivo destetrabalho foi avaliar alterações na estrutura trófica dacomunidade de nematóides em áreas de cana-de-açúcar emsolo argiloso, de acordo com o tempo de cultivo. Oexperimento foi realizado em Rolândia, PR, em umLatossolo Vermelho eutroférrico (LVef) argiloso. Ostratamentos se compunham de seis áreas (vegetação nativae cinco tempos de instalação da cultura de cana-de-açúcar),sendo realizadas cinco amostras compostas de três sub-amostras de 0-20 cm por área. Estas amostras foramclarificadas por meio do método de flotação centrífuga emsolução de sacarose e analisadas em microscópio ótico. A

partir do terceiro ano de cultivo, a comunidade foi dominadapor nematóides fitoprasitas e bacteriófagos, provavelmente,favorecidos pelo alto nível de predação do primeiro grupotrófico. Apenas na área com 16 anos de cultivo não houvediferença entre os grupos, entretanto, essa área apresentouuma baixa abundância de nematóides em geral. As áreas devegetação nativa e no primeiro corte foram dominadas pornematóides bacteriófagos, como é comum em áreasequilibradas ecologicamente. Entretanto, o gêneropredominante em todas as áreas foi Pratylenchus spp.,inclusive na área de vegetação nativa. Além desse gênero,também foi observada grande ocorrência do gêneroHelicotylenchus, mas apenas no primeiro e terceiro cortes.Houve uma baixa ocorrência de nematóides predadores/onívoros, indicando uma grande influência do cultivoda cana-de-açúcar sobre o ecossistema do solo. A viaprevalente de decomposição de matéria orgânica, emtodas as áreas agrícolas e de vegetação nativa, foi expressapelos nematóides de vida-livre. No primeiro, oitavo edécimo sexto cortes, os micófagos foram os principaisdecompositores. Na área de mata, terceiro e décimoscortes, a via de decomposição foi dominada pelosbacteriófagos.

91 – AN INTEGRATED APPROACH FOR DETECTION AND IDENTIFICATION OF ROOT-KNOTNEMATODES FROM FARM SOIL IN FIJI [UMA ABORDAGEM INTEGRADA PARA A DETECÇÃO EIDENTIFICAÇÃO DOS NEMATÓIDES DE GALHAS A PARTIR DO SOLO DE FAZENDAS EM FIJI] Singh,K.S.1; Khurma, R.1; Lockhart, P.2 1School of Biological and Chemical Sciences, Faculty of Science, Technology andEnvironment, The University of the South Pacific, Suva, Fiji; 2Allan Wilson Center for Molecular Ecology and Evolution,Institute of Molecular BioSciences, Massey University, Palmerston North, New Zealand. Email: [email protected]

The presence of root-knot nematodes was determined usingdirect examination method and bioassay of composite soilsamples collected mainly from vegetable farms in Fiji. Thebioassay method revealed the presence of root-knotnematodes to be higher (41%) than the percentage incidencedetected via direct examination (28%). Direct examinationprovides relatively faster results but for extensive sampling

programs bioassay is recommended due to its sensitivityespecially in detecting low population densities of root-knot nematodes. The propagation of the root-knotnematode populations in the bioassay pots also provides agood source of nematode specimens for identification ofroot-knot nematode species. In the current study acombination of molecular and morphological features of



331

the root-knot nematode populations was studied for speciesidentification. DNA was extracted from pooled egg masses(n=10) and amplified using mitochondrial marker (C2F3/1108) and species specific primers for M. incognita (MIF/MIR), M. arenaria (Far/Rar) and M. javanica (Fjav/Rjav).Based on the results, most of the Meloidogyne populationswere placed in the three common groups: M. incognita, M.javanica, and M. arenaria. Molecular data allows confirmationof identification of any morphological variants within thesame species. The populations that did not amplify withthe mitochondrial or species specific primers were placed

in the unidentified category. Populations that showedamplification with more than one species specific primerwere considered as mixed populations. Subsequentmorphological examination was used to determine whetherthe species mix was reflected morphologically too. Theintegrated approach combining a rigid sampling strategyand identification protocol using molecular diagnosisfollowed by verification of morphological features hasproved to be a useful approach for determining theprevalence and diversity of root-knot nematodes in thisinvestigation.

92 – ANÁLISIS NEMATOLOGICOS DE PAPA SEMILLA EN EL INTA RAMA CAÍDA: RESULTADOS DELOS ÚLTIMOS 10 AÑOS [NEMATOLOGICAL ANALYSIS OF POTATO SEEDS IN THE. INTA RAMA CAÍDA:RESULTS FROM THE LAST 10 YEARS] Picca, C.1; Porcel, L.1 1INTA, Estación Experimental Agropecuaria RamaCaída, Centro Regional Mendoza-San Juan. Calle el Vivero s/n, C. P. 5600, San Rafael, Mendoza, Argentina. E-mail:[email protected]

La producción de semilla básica de papa en Argentinaestá restringida a un cierto número de zonasproductoras diferenciadas. El régimen de Fiscalizaciónestablecido por el Estado (basado principalmente enla condición sanitaria de los tubérculos semilla), asícomo la producción de los mismos en las áreassemilleras, permiten evitar la dispersión de algunasplagas y enfermedades y lograr simiente de calidadpara iniciar los cultivos comerciales de papa. En ellaboratorio de Protección Vegetal de la EstaciónExperimental Agropecuaria (E.E.A.) del INTA RamaCaída (Centro Regional Mendoza-San Juan), habilitadopor el INASE, se realizan análisis de nematodos,examinándose durante los últimos 10 años un totalde 6.148 muestras de papa semilla provenientes, en sumayoría, de la zona productora de Malargüe. La mayorparte de las muestras ingresadas en este laboratoriocorrespondieron a la variedad Spunta, y en menormedida a Kennebec, Chieftain y a otras variedades quese han ido incorporando al mercado. Cada muestraestuvo conformada por aproximadamente 100tubérculos (siendo 85 el mínimo admitido), y fueanalizada inicialmente en forma visual a fin de detectary contabilizar tubérculos con síntomas externosvisibles. Posteriormente se realizó la extracción yestimación de los nematodos presentes aplicandotécnicas clásicas de nematologia para observaciones

por microscopía. Durante este período yconsiderando un valor promedio, el 80,0% de lasmuestras analizadas resultó libre de nematodosfitófagos del género Meloidogyne y Nacobbus aberrans.En los casos de muestras infectadas (20,0%) seobservó la presencia de representantes del géneroMeloidogyne, para el cual existen niveles de toleranciaen la normativa de Fiscalización de semilla de papa(hasta 2,0% de los tubérculos enfermoscorrespondería a papa semilla registrada; hasta 5,0%de los tubérculos enfermos correspondería a papasemilla certificada). En este sentido, el 9,3% de lasmuestras presentaron menos del 2% de lostubérculos afectados; el 5,0% mostró entre 2 y 5%de los tubérculos enfermos, y el 6,9% superó el 5%de los tubérculos infectados.En ninguna de lasmuestras analizadas se observó la presencia deNacobbus aber rans . Estos resultados permitenvislumbrar que un gran porcentaje de la semilla depapa producida en el área semillera de Malargüe estálibre de nematodos fitófagos. Esto es consecuenciade la aplicación de un sistema de control de producciónque involucra no solo al Estado, sino también a lospropios productores semilleros que, incorporandoprácticas orientadas a prevenir el incremento de la plagaa nivel regional lograrían mantener la óptima condiciónsanitaria de la semilla producida en la zona.

332 Vol. 33(4) - 2009


93 – OCORRÊNCIA DE FITONEMATÓIDES ASSOCIADOS A Eryngium foetidum (CHICÓRIA)COMERCIALIZADAS NA REGIÃO METROPOLITANA DE BELÉM- PARÁ, BRASIL [OCCURRENCE OFPLANT PARASITIC NEMATODES IN Eryngium foetidum (CHICORY) IN THE METROPOLITAN REGION OFBELÉM, PARÁ, BRAZIL] Vieira, J.G.P.¹; Giese, E.G.1; Santos, J.N.1 1Laboratório de Biologia Celular e Helmintologia,Instituto de Ciências Biológicas, Universidade Federal do Pará, 66.075-110, Belém, PA, Brazil. E-mail:[email protected]/[email protected]/ [email protected]

A espécie Eryngium foetidum L., pertencente a famíliaApiaceae e encontrada em toda região Amazônica, éconhecida como chicória, também denominada de coentroselvagem em diversos países. É uma espécie adaptada aaltas temperaturas, umidade relativa e chuvas, condiçõespredominantes na Amazônia, requerendo solos poucoácidos, com boa disponibilidade de água. É consumidacomo erva condimentar e medicinal, sendo sua utilizaçãoconhecida em vários países. Em face da importância dacultura para a região e a escassez de informações de parasitosassociados à Eryngium foetidum o trabalho objetivou

identificar os gêneros de fitonematóides associados aexemplares de chicória comercializadas nas feiras livrese supermercados da região metropolitana de Belém /PA. As plantas coletadas foram levadas ao laboratóriode Biologia Celular e Helmintologia da Universidadefederal do Pará onde as raízes foram fixadas em formola 5%. As fêmeas de Meloidogyne foram retiradas das raízesutilizando-se um estereomicroscópio e sua identificaçãofoi feita analisando-se a sua região perineal.Foramidentificadas as espécies Meloidogyne javanica e Meloidogyneincognita.

94 – BEHAVIOR OF WINGED BEAN (Psophocarpus tetragonolobus) TOWARDS Pratylenchus brachyurusAND P. zeae NEMATODES [COMPORTAMENTO DE FEIJÃO ALADO (Psophocarpus tetragonolobus) FRENTEAOS NEMATÓIDES Pratylenchus brachyurus E P. zeae] Dias-Arieira, C.R.1; Puerari, H.H.1; Biela, F.1; Cunha, T.L.P.1;Chiamolera, F.M.1; Seabra, Jr.S.2 1Universidade Estadual de Maringá, Campus Regional de Umuarama, C.P. 65, 87501-970Umuarama, Paraná, Brazil; 2Universidade do Estado do Mato Grosso, Departamento de Agronomia, 78200-000 Cáceres,Mato Grosso, Brazil. E-mail: [email protected]

Psophocarpus tetragonolobus is a legume originating from NewGuinea, commonly called winged bean. In Brazil, it hasbeen cultivated and researched in the Amazon. However,there is little information about parasitic nematodes in thisplant. Therefore, the objective of this research was toevaluate the susceptibility of this plant to Pratylenchusbrachyurus and P. zeae nematodes. For this purpose, seedlingswere produced in trays with substrate, and then weretransplanted to plots of one liter. These plots containedsoil and sand in proportion 2:1, autoclaved previously. Threedays after transplanting, the seedlings were inoculated with2 ml of solution containing 300 specimens of P. zeae or200 specimens of P. brachyurus through holes opened in

soil around the plant. As a control, sugarcane “CTC 15”was utilized. After 60 days of inoculation, the root systemswere collected and the nematodes were extracted bycentrifugal flotation method in sucrose solution. After that,under optical microscope, the number of specimens perroot system was evaluated in a Peter’s slide. Thereproduction factor (RF = final population/initialpopulation) was also calculated. Psophocarpus tetragonolobuswas immune to P. zeae (RF equal to zero) while the RFto control was 4.04. The average number of specimensin final population of control was 1,212. The reactionto P. brachyurus was resistant, with RF of 0.14, againstthe RF of 3.98 observed in the control.

95 – AN UNDESCRIBED SPECIES OF Belonolaimus RAU PARASITIZING CITRUS IN SÃO PAULO STATE,BRAZIL [UMA ESPÉCIE NÃO DESCRITA DE Belonolaimus RAU PARASITANDO CITRUS NO ESTADO DESÃO PAULO, BRASIL] Barbosa, B.F.F.1; Santos, J.M.1 1UNESP, Faculdade de Ciências Agrárias e Veterinárias, 14884-900Jaboticabal, SP, Brazil. E-mail: [email protected]

Belonolaimus spp. have been associated with damage indifferent crops around the world, including the citrus crop.There are records that show 5% of areas of citrus in Florida,now infested by Belonolaimus longicaudatus Rau, 1958, ofwhich 4 specimens per 100 cm³ of soil are enough to reduce

productivity. In Brazil, only two species of Belonolaimus havebeen found (B. anama and B. jara), both parasitizingsugarcane. However, there is no record of Belonolaimusspecies as pests of economic importance relevant to anyof our cultures. Recently, an orchard of Pera Rio orange



333

variety on Rangpur lime rootstock, in sandy soil in BaririCounty in São Paulo State, was found exhibiting plants withretarded growth, and very coarse roots due to the smallernumber of lateral roots and thick fibrous roots. The leaveswere chlorotic and the plants with this kind of symptomproduced less than the others without symptoms. Soilsamples from the rhizosphere and roots were collected andtransported to the Laboratório de Nematologia of UNESP/FCAV, Jaboticabal Campus, São Paulo State. Aliquots of100cm³ of soil samples and 10g of roots were processedfor extraction of nematodes, from which were recovered,respectively, 220 and 186 specimens of an amphymiticpopulation of Belonolaimus sp. Morphological andmorphometric studies were performed on ten specimens.The population shows four lines in lateral fields and amongthe 10 valid species in the group only B. loli, B. lineatus, B.brevianulata, B. jara and B. anama have this feature. The labialregion of the females is set off from the body, divided intofour sectors, two ventral-lateral and two dorsal-lateral,without sexual dimorphism in relation to this characteristic.

The lateral fields are completely areolated on the two outerbands and partially areolated on the central one as in B.brevianulata, B. anama and B. jara. Vulva has no lips orschlerotized parts prominent in the vagina. The hemizonidis located anterior to excretory pore, which is locatedafter the seventy-seventh ring of the female body.Between the anus and the end of the tail there are anaverage 39 annules. Males have gubernaculum, bursa andphasmids are asymmetric, the right and left being at 29and 32 annules from the end of the tai l . Themorphometrics of the population are: L = 1.7mm (1.5 -1.9), V%=53.7% (53.6-54.7), a=38.2, b=19.8, b’=6.1,c=22.0, c’=2.2. The body of females is less than 1.9mm,differing from B. lolii (2.0-2.6mm). The stylet of thefemale measured 136.4µm (131.0-144.8). The styletlength of the female is considerably larger than that ofB. lineatus (98-100µm), B. anama (82.9µm), B. jara(65.7µm), B. brevianulata (65.0 µm). These data indicatethat this is an undescribed population of Belonolaimusand probably is a pest of citrus in São Paulo State.

96 – BIOLOGICAL CONTROL OF Scutellonema brachyurus BY Pasteuria penetrans [CONTROLE BIOLÓGICODE Scutellonema brachyrus POR Pasteuria penetrans] Shahbazi, H.1; Mohammad Deimi, A.2; Barooti, S.2 1Department of PlantProtection, Abourayhan Campus, University of Tehran, Tehran, Iran; 2Dep. of Plant Pathology, Faculty of Agricultureand Natural Resources, Science and Res. Branch, Islamic Azad University, P.O. Box 14515-775, Tehran, Iran. E-mail:[email protected]

Some soil, root and corm samples were collected fromornamental plants during 2009. The nematodes wereextracted by centrifugal technique, killed, fixed andtransferred to glycerin, and the nematodes were preparedaccording to the De Grisse method (1969). Morphologicaland morphometrical characters were studied by light

microscope. Scutellonema brachyurus was found in soil andcorm of Sedum (Sedum sp.).To our knowledge, location andhost of the nematode is new in Iran. Pasteuria penetrans wasobserved on body of nematodes. To our knowledge, this isthe first report of Scutellonema brachyurus infection by Pasteuriapenetrans.

97 – PLANT NEMATODE MONITORING IN COFFEE SEEDLINGS [MONITORAMENTO DEFITONEMATÓIDES EM MUDAS DE CAFÉ] Souza, S.E.¹; Santos, A.R.S.²; Alves, J.M.V.2; Neto, A.N.C.³, Neves, A.L.A.4;Oliveira, J.D.M.4 ¹Departamento de Fitotecnia e Zootecnia da Universidade Estadual do Sudoeste da Bahia; ²Laboratóriode Nematologia Agrícola da Universidade Estadual do Sudoeste da Bahia; ³Fiscal Federal da Superintendência de Agriculturada Bahia, MAPA; 4Discente de Agronomia da Universidade Estadual do Sudoeste da Bahia, UESB. E-mail: [email protected]

The use of pathogen-free propagative material is one ofthe guidelines proposed in the technical regulations forintegrated coffee production. This study was carried out toevaluate the absence and/or presence of plant nematodesin coffee seedlings. Monitoring was conducted in 2007/2008 at nurseries registered in the Sistema Nacional de Sementese Mudas – RNSM/MAPA (Seeds and Seedlings NationalSystem), in the Planalto da Conquista and South of Bahiaregions. Eighty-nine root samples were evaluated in 2007,of which 78 were Coffea arabica seedling samples, varietiescatuai, catucai, and acauã; and 11 were C. canephora samples,

varieties Emcapa and Incaper. One hundred and twenty-one samples were analyzed in 2008: 85 of C. arabica and 36of C. canephora. The roots were processed by the Coolen &D’Herde method (1972), and readings were made underoptical microscopy; results were as follows. (I) Absence ofroot-knot nematode Meloidogyne sp; (II) In C. canephoravarieties, the presence of 3.48% Rotylenchus reniformis wasobserved in 2008 only; (III) the presence of 8.5%Pratylenchus sp. was detected in C. arabica varieties; in 2008this percentage increased to 37%. Rotylenchus reniformis wasfound in 2.19%.

334 Vol. 33(4) - 2009


98 – OCURRENCIA DE ESPECIES DE Meloidogyne (NEMATODA) EN EL CULTIVO DE PAPA EN LAQUEBRADA DE HUMAHUACA (JUJUY-ARGENTINA) [ESPÉCIES DE Meloidogyne (NEMATODA) PRESENTESEM CULTIVO DE OCCURRENCE OF Meloidogyne SPECIES (NEMATODA) ON POTATO CULTIVATION IN LAQUEBRADA DE HUMAHUACA (JUJUY-ARGENTINA)] Carrizo, C.1; Muruaga, S.1; Gallardo, C.1 1Facultad de CienciasAgrarias Universidad Nacional de Jujuy, Alberdi 47-San Salvador de Jujuy (Pcia.Jujuy) Argentina. E_mail:[email protected]

El objetivo del presente trabajo fue identificar y caracterizarmorfológicamente los nematodos pertenecientes al GéneroMeloidogyne, provenientes de Solanum tuberosum subsp.andigenum (papa andina) de diferentes localidades de laQuebrada de Humahuaca (Provincia de Jujuy-Argentina),los análisis nematológicos correspondientes se realizaronen los Laboratorios de las Cátedras de Zoología General yZoología Agrícola de la Facultad de Ciencias AgrariasUniversidad Nacional de Jujuy entre los años 2006-2007.El 27,66 % del total de muestras analizadas estabainfectada por Meloidogyne spp. Las especies mas frecuentesfueron M. hapla (36,14%), M. incognita (28,92%), M.sp1(15,66%), M.sp2 (9,64%), M. javanica (4,82%) y M. arenaria

(4,82%).Msp1 y Msp2 presentaron patrones perinealescon diferencias morfológicas poco marcadas,dificultando su identificación. Las hembras de Msp1separadas de muestras de papa de Aparzo, Tilcara y Juella,mostraron semejanzas a M. naasi, pero su determinacióndebe ser verificada. El género Meloidogyne se encontróen los tres departamentos que comprenden la zona de laQuebrada de Humahuaca en la Provincia de Jujuy,Humahuaca, Tumbaya y Tilcara; siendo este último enel que se encontró no solo el mayor número de hembrassino también la presencia simultánea de M. hapla, M.incogni ta , M. javanica y M. ar enar ia , en muestrascorrespondientes a la variedad Collareja.

99 – COLLECTION AND IDENTIFICATION OF PLANT PARASITIC NEMATODES OF BANANA INCHABAHAR [COLETA E IDENTIFICAÇÃO DE NEMATÓIDES PARASITAS DE PLANTA NA BANANA EMCHABAHAR] Shahbazi, H.1; Mohammad Deimi, A.2; Barooti, S.2 1Department of Plant Protection, Abourayhan Campus,University of Tehran, Tehran, Iran; 2Department of Plant Pathology, Faculty of Agriculture and Natural Resources,Science and Res. Branch, Islamic Azad University, P.O. Box 14515-775, Tehran, Iran. E-mail: [email protected]

In order to study the plant-parasitic nematodes ofbanana in Chabahar, the nematodes were extracted bycentrifugal flotation technique, fixed and transferred toglycerin according to the De Grisse method (1969).Morphometrical characters were determined under lightmicroscope, for identification and description ofnematode specimens, species keys and references were

used. In this study 11 species belonging to 9 genera wereidentified as follows:1)Aphelenchus avenae, 2)Aphelenchoidescentralis, 3)Boleodorus thylactus, 4)Ditylenchus kheirii,5)Geocenamus br evidens, 6)Helicotylenchus digonicus,7)Helicotylenchus vulgaris, 8)Hemicriconemiodes mangiferae,9)Praty l enchus thor ne i , 10)Xiphinema amer i canum,11)Xiphinema index.

100 – HOST STATUS OF GRAMINACEOUS COVER CROPS FOR Pratylenchus brachyurus [REAÇÃO DECOBERTURAS VEGETAIS DA FAMÍLIA POACEAE A Pratylenchus brachyurus] Inomoto, M.M.1; Asmus, G.L.2 1EscolaSuperior de Agricultura Luiz de Queiroz, Universidade de São Paulo, 13418-900 Piracicaba, SP, Brazil; 2EmbrapaAgropecuária Oeste, C. P. 661, 79804-970 Dourados, MS, Brazil. E-mail: [email protected]

Taking into account that information about the host statusof cover crops for Pratylenchus brachyurus is scarce orcontradictory, this study was undertaken to assess the hoststatus of selected graminaceous cover crops by estimatingnematode reproduction, and to evaluate their usefulness inreducing nematode density in greenhouse conditions.Furthermore, the reproductive fitness of three P. brachyuruspopulations was assessed for Brachiaria grasses. Silage andforage sorghum (Sorghum bicolor and S. bicolor x S. sudanense)proved to be good hosts to P. brachyurus; consequently, theymust be avoided in fields infested with this lesion nematode,

mainly before suitable crops such as soybean, commonbean, cowpea and cotton. Dictyoneura grass (Brachiariadictyoneura), the pearl millet ‘ADR 300’ (Pennisetum glaucum)and black oat (Avena strigosa) are positioned as poor hoststo P. brachyurus, but as a rule they increase P. brachyurus densityin a long observation period. Consequently, these covercrops might be used in infested fields for only short periods,as they could increase slowly but progressively the P.brachyurus population density. There were differences inreproductive fitness of P. brachyurus populations forBrachiaria; however host status were not affected by them.



335

101 – OCCURRENCE OF NEMATODES IN FRUIT PLANTS IN THE NORTHWEST OF PARANÁ[OCORRÊNCIA DE NEMATÓIDES ASSOCIADOS A FRUTÍFERAS NO NOROESTE DO PARANÁ] Dias-Arieira,C.R.1; Santana, S.M.1; Barizão, D.A.O.1; Biela, F.1; Silva, M.L.1 1Universidade Estadual de Maringá, Campus Regional deUmuarama, C. P. 65, 87501-970 Umuarama, Paraná, Brazil. E-mail: [email protected]

Fruit growing is a choice for a number of farmers in theNorthwest of Paraná; however, sandy soil and hightemperatures are factors which may contribute to theoccurrence of nematodes in these species. Thus, this studyconducts a survey on the nematodes associated with fruitplants in the Northwest of Paraná. Thirty-eight soil samplesand roots from 13 species were collected. In laboratory,the samples were submitted to nematode extraction andassessed with the aid of an optical microscope with respectto their species and amount of nematodes present. Themost recurring nematodes were Helicotylenchus dihystera inavocado, pineapple, banana, guava, mango and grape;

Pratylenchus brachyurus in avocado, pineapple, banana, guava,apple and mango; P. zeae in pineapple and persimmon;Meloidogyne spp. in pineapple, acerola, banana, persimmon,fig and grape. Large Meloidogyne spp. populations werenoticed in fig and persimmon – 852 and 554 specimens/10g of the root system, respectively. The average numberof P. brachyurus within the pineapple root system was708, whereas the largest numbers obtained for H. dihysteraand H. multicinctus in the banana root system were 191and 138, respectively. Presence of phytopathogenicnematodes was not found for coconut, passion fruit andsugar apple.

102 – BEHAVIOR OF COFFEE PLANTS IN AREAS NATURALLY INFESTED WITH Meloidogyne incognita[COMPORTAMENTO DE CAFEEIROS EM ÁREAS NATURALMENTE INFESTADAS POR Meloidogyne incognita]Dias-Arieira, C.R.1,2; Sera, T.3; Biela, F.1; Sassaki, T.C.1; Chiamolera, F.M.1; Mattos, R.M.1; Barizão, D.A.O.1; Arieira, J.O.4,Silva, O.F.5 1Universidade Estadual de Maringá, Campus Regional de Umuarama, C. P. 65, 87501-970 Umuarama, Paraná,Brazil; 3Instituto Agronômico do Paraná, 86001-970 Londrina, Paraná, Brazil; 4Universidade Paranaense, Campus III,87502-150 Umuarama, Paraná, Brazil; 5Emater, 87502-150 Umuarama, Paraná, Brazil. E-mail: [email protected]

Nematodes are among the major constraints on coffeeproduction as a result of problems caused to the crops anddifficulty in controlling. The use of resistant rootstocks, orresistant cultivars, is an economical and environmentallyviable management method. However, the behavior of thegenotypes in the field may differ from that noticed undercontrolled conditions. Therefore, this study aimed atassessing the behavior of genotypes of coffee in soilsnaturally infested with Meloidogyne incognita in the Northwestof Paraná. Seedlings from the varieties IPR 100, IPR 106,Apoatã 2258+Iapar 59 and Iapar 59 were transplanted tothe naturally infested area in 24.30 m2 plots (2.70 betweenlines and 0.75 between plants) in August, 2007. The

experiment was conducted in two blocks with 10 repetitionsfor each treatment per block. After 17 months, soil androot samples were collected, submitted to extraction ofjuveniles and eggs, respectively, and assessed with the aidof an optical microscope. The results showed that thenematode population in the soil was statistically similarfor all treatments (p d” 5); however, the number of eggswas significantly lower for the plots cultivated with IPR106, IPR 100 and Apoatã 2258+Iapar 59, whencompared to Iapar 59 with respective numbers similarto 5.449, 15.779 and 36.414. Lower plant height wasnoticed for Iapar 59 and higher for the graft, Apoatã2258+Iapar 59.

103 – COMUNIDADE DE NEMATÓIDES E NÍVEL DE DANO NAS RAÍZES DE BANANEIRA SOB DOISNÍVEIS DE CALCÁRIO E DIFERENTES COBERTURAS VEGETAIS [NEMATODE COMMUNITY ANDDAMAGE LEVEL IN BANANA ROOTS UNDER TWO LEVELS OF LIME APPLICATION AND COVER CROPS]Ritzinger, C.H.S.P.¹; Fancelli, M.¹; Borges, A.L¹; Souza, L.S.¹; Damasceno, J.C.A.²; Ledo, C.A. S.¹ ¹Embrapa Mandioca eFruticultura Tropical, C. P. 007, 44380-000 Cruz das Almas, BA, Brazil; ²Centro de Ciências Agrárias, Ambientais eBiológicas, UFRB. E-mail: [email protected]

O Brasil é o segundo produtor mundial da bananeira.Contudo, registram-se perdas elevadas devido ao ataquede fitonematóides. A utilização de coberturas vegetais vivastem sido preconizada no manejo dos solos e também. no

manejo de fitonematóides. Este trabalho objetivou avaliara comunidade de nematóides existentes em três épocas(abril, julho e dezembro/2008) e nível de dano nas raízesde bananeira sob dois níveis de calcário e gesso e diferentes

336 Vol. 33(4) - 2009


coberturas vegetais. O trabalho com bananeira ‘Terra’ foidesenvolvido em Tancredo Neves, BA, conduzido emsistema de fileiras duplas, no espaçamento de 4,0 m x 2,0m x 2,5 m. Utilizou-se o delineamento experimental emparcelas subdivididas em quatro blocos casualizados, sendodois tratamentos (T1=100% de calcário e T2= 75% calcário+ 25% de gesso) e seis subparcelas (gramíneas: sorgo emilheto e leguminosas: crotalaria, guandu, feijão-de-porcoe caupi). Foram identificadas populações de Pratylenchus sp.,Rotylenchulus reniformis, Helicotylenchus sp. e nematóides de vidalivre. Não houve diferença significativa entre as populaçõesnos diferentes tratamentos e no nível de dano (P>0,05%).

Contudo, na terceira época, registrou-se a maior populaçãode nematóides em relação a primeira época. Rotylenchulusreniformis de 211 para 588 individuos/100cm3 de solo;Pratylenchus sp. de 8 para 223 individuos/100cm3 de solo;Helicotylenchus sp. de 32 para 94 e nematóides de vida livrede 38 para 166 individuos/100cm3 de solo). Dentro dessacomunidade, o nematóide das lesões, Pratylenchus, poderepresentar risco para a bananeira da ‘Terra´, sobpopulações elevadas. Dentre as coberturas vegetais,feijão-de-porco, sorgo ou guandu, a população dePratylenchus manteve-se baixa (inferior a 10 indivíduos/100/cm3 de solo).

104 – Meloidogyne javanica AND Globodera rostochiensis INTERACTIONS ON POTATO [INTERACÇÕESENTRE Meloidogyne javanica E Globodera rostochiensis EM BATATEIRA] Cunha, M.J.M.1,2; Conceição, I.L.P.M.2; Abrantes,I.M.O.2; Santos, M.S.N.A.2 1Escola Superior Agrária de Coimbra, Bencanta,Coimbra; 2Departamento de Zoologia, Faculdadede Ciências e Tecnologia, Universidade de Coimbra. E-mail: [email protected]

Root-knot nematodes (RKN), Meloidogyne spp., attack a widerange of economically important crops including potato(Solanum tuberosum L.). In Portugal, during the past ten years,RKN damage has been found in some potato-growing areas.In a recent survey, it was clear that RKN infestation ofpotato fields is becoming more widespread. RKN andpotato-cyst-nematodes (PCN) have been found togetherin the same fields. Therefore, the interactions betweenM. javanica (Mj) and G. rostochiensis (Gr), obtained frominfected potato roots, were studied on S. tuberosum cv.Desirée. Pot experiments were conducted in a greenhouseat two temperature intervals (10-20°C and 15-25°C) andsix treatments using second-stage jveniles (J2) as inocula:

1) 50Gr J2 + 50Mj J2; 2) 100Gr J2; 3) 100Mj J2; 4) 500GrJ2 + 500Mj J2; 5) 1000Gr J2; 6) 1000Mj J2. Penetration wasonly affected at the lower temperature when the two specieswere present. Initial inoculum density affected reproductionof both species when alone or in combination, at bothtemperature intervals. In all treatments, higher reproductionrates were obtained for lower inoculum densities. At a highertemperature more M. javanica females developed andreproduced while at a lower tempetrature fewer M. javanicareached the adult stage and reproduced in the treatments withboth nematode species. Considering global climatic changesthis can lead to a replacement of PCN by RKN species as thelatter may be better adapted to warmer temperatures.

105 – RELAÇÕES ENTRE COMUNIDADE DE NEMATÓIDES E CARACTERÍSTICAS QUÍMICAS DOSOLO EM ÁREAS CULTIVADA COM CANA-DE-AÇÚCAR [RELATIONSHIPS BETWEEN NEMATODECOMMUNITY AND CHEMICAL SOIL CHARACTERISTICS IN SUGARCANE GROWING AREAS] Matos, D.S.S.1;Pedrosa, E.M.R.1; Rodrigues, C.V.M.A.1; Medeiros, J.E.1; Barbosa, N.M.R.1 1Universidade Federal Rural de Pernambuco,Rua Dom Manoel de Medeiros s/n, Dois Irmãos, 52.171-900 Recife, PE, Brazil. Email: [email protected]

Diversas medidas para controle de nematóides sãorecomendadas, porém nenhuma tem se mostradosuficientemente efetiva em reduzir as populações iniciais eevitar riscos ambientais. Por outro lado, a aplicação devinhaça tem sido bastante enfatizada, em razão da elevadaquantidade gerada pelas usinas e destilarias, e por serconsiderada altamente poluente devido à alta demanda deoxigênio. O presente estudo tem por objetivo avaliar efeitosda fertirrigação com vinhaça nas comunidades denematóides e propriedades químicas do solo, relacionandoefeitos entre as variáveis analisadas e malha de amostragem.Os experimentos foram conduzidos em área de encosta

cultivada com cana-de-açúcar com e sem aplicação devinhaça. As amostras de solo foram coletadas a 25 cm deprofundidade e, em cada área foram estabelecidas malhasde amostragem quadrangular de 1,00×1,00; 10,00×10,00 e50,00×50,00 m, compostas por 36 pontosgeorreferenciados, cada. Dentre as relações entre taxa danematofauna e propriedades químicas do solo, destacaram-se na área com vinhaça, as correlações de Aphelenchus comsódio (r=0,61) na malha de 1 m; nematóides totais comcarbono e nematóides totais com matéria orgânica (r=0,52e r 0,52, respectivamente) na malha de 10 m, e nematóidestotais com ferro (r=0,55) na malha de 50 m. Na área não



337

irrigada com vinhaça, destacaram-se nematóides totais compotássio (r=-0,46) e Helicotylenchus com sódio (r=-0,46) namalha de 1m; Mononchidae com magnésio (r=-0,78) namalha de 10m e Aphelenchus com capacidade de trocacatiônica (r=0,58) na malha de 50m. Os resultados obtidos

indicaram que a dinâmica populacional dos nematóides édependente das características químicas do solo e,possivelmente, da aplicação de vinhaça, uma vez que o totalde nematóides na área irrigada foi menor do que na áreanão irrigada.

106 – HEAT UNIT REQUIREMENTS FOR DEVELOPMENT OF THREE Meloidogyne spp. UNDERFIELD CONDITIONS [UNIDADES DE CALOR REQUERIDAS PARA O DESENVOLVIMENTO DE TRÊSMeloidogyne spp. EM CONDIÇÕES DE CAMPO] Davila- Negrón, M.1; Mendes, M.L.2; Dickson, D.W.2 1University ofPuerto Rico, P.O. Box 2500, Utuado, Puerto Rico; 2Entomology and Nematology Dept., University of Florida, Gainesville,FL, USA, 32611. E-mail: [email protected]

Information on the thermal-time relationships of plant-parasitic nematodes is necessary to predict geographicaldistributions, nematode population dynamics and resultingpotential crop yield losses. Our objective was to determinethe thermal-time requirement for development ofMeloidogyne arenaria race 1, M. incognita race 4, and M. javanicaunder field conditions. Development was determined onsquash (Cucurbita pepo) (two crops during each spring andautumn season) grown on methyl-bromide-treated drip-irrigated raised beds covered with black and aluminummetalized reflective polyethylene mulch or left bare (non-mulched) during 2003. Plots were arranged in a split-plotdesign with three replicates. Six-thousand nematode eggsand juveniles were pipetted into 24 plant-holes per bedbefore squash was seeded for the first crop. A secondcrop immediately followed on the same beds during eachcrop season. Soil temperature was recorded at fivedepths using a temperature logger. Squash seedlings

were removed every 2 days beginning on day six afterseeding, and the roots cleared and stained to observenematode development. Mulched beds had higher meansoil temperatures, and the number of days required foregg laying was fewer than in non-mulched beds. Therewere no differences in development between black andmetalized mulched beds. The shortest time and lowestdegree days (DD) for development to egg-laying femalesin mulched beds were 19 days and 278 DD, 17 days and297 DD, and 19 days and 311 DD for M. arenaria, M.incognita and M. javanica, respectively. Development ofegg-laying females was delayed ca. 2 days on non-mulched beds compared with mulched beds for allnematode species. This information will be useful forpredicting developmental cycles of the three speciesunder different climatic conditions, and also forestimating the number of generations each species maycomplete on vegetable crops grown in Florida.

107 – EFEITO DO SILICATO DE CÁLCIO E MAGNÉSIO NO CONTROLE DE Meloidogyne javanica EDESENVOLVIMENTO DE BANANEIRA PRATA-ANÃ [EFFECT OF CALCIUM SILICATE ANDMAGNESIUM ON THE CONTROL OF Meloidogyne javanica AND DEVELOPMENT OF BANANA-PRATA ANÃ].Oliveira, R. M.1; Ribeiro, R. C. F. 1; Xavier, A. A.1; Kordonferr2, G. H.; Pegoraro, R. F.1; Rocha, L. S.1; Pimenta, L.1;Lopes, P. S.1; Nietsche, S.1. 1 Departamento de Ciências Agrárias, Unimontes, CP 91, 39440-000 Janaúba, MG, Brasil. E-mail: [email protected], 2 UFU, Instituto de Ciências Agrárias, CEP 38400-902 Uberlândia, MG, Brasil.

Dentre os fatores que reduzem a produtividade de bananeirano Norte de Minas Gerais, destaca-se o fitonematóideMeloidogyne javanica. Seu controle bem como de outrosnematóides é rotineiramente feito por meio da aplicaçãode nematicidas. Devido ao alto impacto ambiental dessesprodutos, pesquisas vêm sendo direcionadas para novasestratégias de controle. Vários trabalhos têm demonstradoo potencial do silício no controle de diversos patógenos desolo e parte aérea. O trabalho teve por objetivos avaliar emcondições de casa de vegetação, o efeito de diferentes dosesde silicato de cálcio e magnésio (SiCaMg) sobre M. javanica,em bananeira Prata-Anã, sobre o desenvolvimento da

cultura e sobre o acúmulo de Si em diferentes partes daplanta. Os tratamentos foram conduzidos em DBC emesquema fatorial 5x2 (cinco doses de silicato de cálcio (0,25, 50, 75 e 100% da necessidade de calagem e ostratamentos patógenos (presença e ausência de M. javanica)) e tratamento adicional com calcáreo dolomítico (100%da recomendação)). O experimento foi montado comquatro repetições, sendo cada parcela composta por trêsvasos. Após 180 dias foram avaliadas as variáveis: númerode galhas, massas de ovos e ovos por raiz e número dejuvenis de segundo estádio de M. javanica/100 cc de solo,diâmetro do pseudocaule, altura, número de folhas, peso

338 Vol. 33(4) - 2009


de matéria seca de folhas, de raízes e de rizoma e o acúmulode silício nas raízes, pseudocaule e folhas pelo métodoAmarelo. Com o aumento das doses de SiCaMg houveredução significativa do número de ovos de M. javanica eredução linear do diâmetro do pseudocaule. Maior matériaseca de folhas foi estimada com a dose de 1,15g/Kg de

solo. Com o aumento das doses, houve aumento do teorde silício no pseudocaule. As plantas da testemunhaapresentaram maior altura, diâmetro de pseudocaule,matéria seca de folhas. Não houve diferença significativana comparação entre o SiCaMg e o calcáreo dolomíticopara as variáveis avaliadas. Apoio Financeiro: FAPEMIG.

108 – ESTIMATIVA DO IMPACTO ECONÔMICO E SOCIAL DIRETO DE Meloidogyne mayaguensis NACULTURA DA GOIABA NO BRASIL [ESTIMATE OF THE ECONOMIC AND SOCIAL IMPACT OF Meloidogynemayaguensis ON THE GUAVA CROP IN BRAZIL] Pereira, F.O.M.1; Souza, R.M.1; Souza, P.M.2; Dolinski, C1; Santos,G.K.1 1Universidade Estadual do Norte Fluminense Darcy Ribeiro,CCTA,LEF, 28015-620 Campos dos Goytacazes, RJ,Brasil; 2Laboratório de Engenharia Agrícola, UENF. E-mail: [email protected]

Este estudo objetivou estimar o impacto causado pelameloidoginose da goiabeira, causada por M. mayaguensis, aosprodutores de goiaba em cinco Estados brasileiros. Atravésda análise de dados da área infestada pelo nematóide, dopadrão de evolução da doença, da produtividade média dospomares infestados e dos coeficientes técnicos da cultura,comparou-se o valor presente líquido (a diferentes taxas dedesconto) e a taxa interna de retorno de pomares sadios eafetados pelo nematóide. Nas regiões produtoras estudadas,o prejuízo direto causado por M. mayaguensis foi estimadoem 112,7 milhões de reais até o ano de 2008, aos quais se

acrescentam o desemprego de 3.703 trabalhadores ruraisem tempo integral devido ao declínio e morte dos pomares.A esses valores somam-se impactos que não puderam sercalculados às atividades econômicas associadas àgoiabicultura, como a redução da produção ecomercialização de insumos, transporte, beneficiamento ecomercialização da produção e recolhimento de impostos.Este estudo evidencia a importância de M. mayaguensis no Brasil,cuja relevância poderá aumentar se outras áreas produtorasde goiaba forem infestadas e/ou, se outras culturas agrícolasforem seriamente afetadas por esse nematóide.

109 – FAUNA OF NEMATODES IN NATURAL AND CULTIVATED AREAS IN THE CITY OF CASCAVEL-PARANÁ [FAUNA DE NEMATÓIDES EM ÁREAS DE RESERVA LEGAL E DE CULTIVO NO MUNICÍPIO DECASCAVEL–PARANÁ] Fiorentin, F.1; Furlanetto, C.2; Casagrande, C.Jr.1; Franzener, G.1; Cruz, M.I.F.1; Dildey, O.11Universidade Estadual do Oeste do Paraná, C. P. 91, 85960-000 Marechal Cândido Rondon, PR, Brazil; 2Universidade deBrasília, Departamento de Fitopatologia, 70910-900 Brasilia, DF, Brazil. E-mail: [email protected]

Nematodes are multicellular organisms naturally occurringin most soils and are important in decomposition andcycling of nutrients. The increase in plant-parasiticnematode communities in soil occurs as a result ofinadequate management in cultivated areas, such as thesowing of a subsequent crop. Some species found incultivated areas of these soils are natural, but many speciesof plant-parasitic nematodes can be introduced throughthe movement of agricultural machinery between propertiesof different regions. This study aimed to identifypopulations of nematodes in soils of native forests andmarginal areas of cultivation in the town of Cascavel -Paraná. Soil samples were collected in five areas of forestand cultivation of marginal fields. The soil samples collectedwere analyzed in the laboratory of Nematology atUNIOESTE, Campus de Marechal Cândido Rondon - PR.

The extraction of nematodes was performed using samplesof 100 cc of soil, the method of screening (20 mesh on400 mesh) and centrifugation in sucrose solution densityof 1.15 g cm-3. After extraction, the nematodes were fixedin Seinhorst solution and subsequently transferred to semi-permanent slides. The nematodes were identified at the levelof genus through the use of keys for classification. Twentygenera were found in forests and 14 genera in crops nearthe town of Cascavel. The genera of nematodes often foundwere Longidorus, Criconemella and Mononchus, and the generaof nematodes identified in areas of cultivation wereLongidorus, Helicotylenchus, Rotylenchus, Mononchus,while thegenus Criconemella was not identified in the samples analyzed.From the results obtained it is possible to conclude thatthere is a similarity between the forest and areas ofcultivation in terms of nematode populations.



339

110 – EFEITO DA MALHA DE AMOSTRAGEM NAS RELAÇÕES ENTRE A NEMATOFAUNA EATRIBUTOS FÍSICOS E QUÍMICOS DO SOLO [EFFECT OF NET SAMPLING ON RELATIONSHIPSBETWEEN NEMATODE COMMUNITY AND PHYSICAL AND CHEMICAL SOIL ATTRIBUTES] Medeiros, J.E.1;Pedrosa, E.M.R.2; Matos, D.S.S.3; Rodrigues, C.V.M.A.4 1Universidade Federal Rural de Pernambuco, Rua Dom Manoelde Medeiros, s/n, Dois Irmãos, 52171-90 Recife, PE, Brazil. E-mail: [email protected]

O presente estudo teve como objetivo avaliar o grau decorrelação entre a nematofauna e atributos físicos equímicos do solo, na presença e ausência de irrigação, emtrês escalas de amostragem, em área de tabuleiro costeirocultivada com cana de açúcar, na Zona da Mata dePernambuco, Brasil. Em cada área foi estabelecida malhade amostragem quadrangular de 2 × 2m, 20 × 20m e 200 ×200m e coletadas 180 amostras a 25 cm de profundidade.Para caracterização dos atributos físicos do solo, foramdeterminados textura e teor de argila natural ou argiladispersa em água (ADA). Na caracterização de atributosquímicos foram determinados pH em água, fósforodisponível (P) e os cátions trocáveis Ca2+, Mg2+ Al3+, Na+ eK+, alumínio trocável, capacidade de troca de cátions (CTC)

e a percentagem de saturação por alumínio (m). Houvepredominância de fitopatógenos nas três malhas estudadasem áreas irrigadas ou não, com destaque para os gênerosPratylenchus sp. e Meloidogyne sp. Os atributos físicos do soloapresentaram um maior número de correlação com anematofauna na área não irrigada, nas três malhas estudadas,destacando-se as correlações de Meloidogyne spp. com areiagrossa e areia fina (46 e 39%, respectivamente) na malhade 2m. Na área irrigada, destacaram-se as correlaçõesentre Helicotylenchus sp. e Ca (75%) e de Pratylenchus sp.com a argila e ADA (51% de e 75%, respectivamente),todas na malha de 2m. As malhas de 200m, em áreairrigada e não irrigada, apresentaram menor número decorrelações.

111 – EFEITO DA APLICAÇÃO DE VINHAÇA NA DISTRIBUÇÃO VERTICAL DA NEMATOFAUNA EATRIBUTOS FÍSICOS E QUÍMICOS DO SOLO [EFFECT OF STILLAGE APPLICATION ON VERTICALDISTRIBUTION OF NEMATODE COMMUNITY AND PHYSICAL AND CHEMICAL SOIL ATTRIBUTES.]Caixeta, L.B.1; Pedrosa, E.M.R1; Rolim, M.M.1; Bebé, F.V.1; Silva, C.V.M.A.1 1Universidade Federal Rural de Pernambuco,Rua Dom Manoel de Medeiros, s/n, Dois Irmãos, 52171-900 Recife, PE, Brazil. E-mail: [email protected]

O presente estudo teve como objetivo avaliar o efeito daprofundidade nos atributos físico-químicos do solo e naestrutura trófica da nematofauna. As áreas foramcaracterizadas de acordo com as diferentes épocas deaplicação de vinhaça, sendo área 1 correspondente a umEspodossolo com aplicação de até 5 anos; área 2,Espodossolo com 5 a 10 anos; área 3, Argissolo Amarelocom mais de 10 anos e área 4, Espodossolo que nuncarecebeu vinhaça. Em cada área delimitaram-se 20 pontosigualmente espaçados em malhas de 10×10m, coletando-se amostras de solo, com utilização de trado, nas

profundidades 0-10, 10-20, 20-40, 40-60 e 60-80 cm,totalizando 400 amostras. O Na, Mg, Ca, K, pH, evoluçãoC-CO2 e

nematóides fitoparasitos correlacionaram-senegativamente com a profundidade, destacando-se ascorrelações de Criconemella com pH, Na, K, condutividadeelétrica e silte nas diferentes profundidades. De maneirageral, as maiores correlações entre fitoparasitos eprofundidade ocorreram na área que recebeu vinhaça porperíodo superior a 10 anos. A aplicação de vinhaça afetoua densidade de Meloidogyne exclusivamente na profundidadede 10-20 cm.

112 – PREVALENCE AND INTENSITY OF Leidynema sp. (THELASTOMATIDAE) INFECTION IN ACOCKROACH OF THE GENUS Blaptica [PREVALÊNCIA E INTENSIDADE DE Leidynema sp.(THELASTOMATIDAE) INFECÇÃO EM BARATA DO GÊNERO BLAPTICA] Lax, P.1; Blanco, M.V.1; Doucet,M.E.1 1Centro de Zoología Aplicada, Universidad Nacional de Córdoba, CC 122, 5000 Córdoba, Argentina. E-mail:[email protected]

Naturally-occurring nematodes inhabit the intestine ofsome cockroach species. Information on this aspect in Ar-gentina is scarce. Twenty-five cockroaches (nymphs andadults) of the genus Blaptica (a species closely related to B.dubia), from Buenos Aires province (Argentina) were evalu-

ated by dissecting the insects and extracting the posteriorportion of the intestine. Nematodes were identified usingdiagnostic morphological features. In the first part of thisintestine portion, adults of Leidynema sp. were present in allcases (prevalence=100%), with a mean intensity of 7.2.

340 Vol. 33(4) - 2009


Nematode females were present in 96% of hosts (meanintensity =6.3) whereas males were detected in 84% ofcockroaches (mean intensity =0.9). The high infection

prevalence of the nematode in Blaptica sp. was noticeable.The genus Leidynema is cited for the first time in this cock-roach in Argentina.

113 – LEVANTAMENTO DE FITONEMATÓIDES EM Coffea arabica NA MICROREGIÃO DO CAPARAÓ,SUL DO ESPIRITO SANTO [SURVEY OF PHYTONEMATODES ASSOCIATED WITH Coffee arabica IN THECAPARAO MICROREGION, SOUTH OF ESPIRITO SANTO STATE, BRAZIL] Belan, L.L.1; Alves, F.R.1; Rabello,L,K.C.1; Rodrigues, A.A.1; Amaral, J.F.T.1; Jesus Júnior, W.C.1; Oliveira, V.P.1 1Universidade Federal do Espírito Santo,Centro de Ciências Agrárias. Alto universitário s/n, Centro, C. P. 16, 29500-000 Alegre, ES, Brazil. E-mail:[email protected]

A cafeicultura é uma atividade de extrema importância parao Estado do Espírito Santo, empregando cerca de 330.000pessoas. Entretanto, muitas vezes a produtividade não chegaa 12 sacas/ha. Muitos fatores podem estar relacionados aessa baixa produtividade, como a ocorrência dosfitonematóides, entre eles Meloidogyne spp. Para se propormedidas confiáveis de manejo, o conhecimento da(s)espécie(s) do nematóide(s) presente(s) na área de cultivo éfundamental. Devido à falta do exato conhecimento dasespécies de fitonematóides associados à Coffea arabica namicroregião do Caparaó, Sul do Espírito Santo, compostapelos municípios de Alegre, Divino de São Lourenço, Doresdo Rio Preto, Guaçuí, Ibatiba, Ibitirama, Irupi, Iúna,Muniz Freire e São José do Calçado, propôs-se estetrabalho, objetivando realizar um levantamento criteriosoe detalhado das espécies de Meloidog yne nas áreas

cultivadas com café arábica nessa microrregião. Otrabalho continua em andamento. O número de amostras,por município, tem sido estabelecido em função daquantidade de áreas cultivadas com café em cada umdos referidos municípios bem como da avaliação dohistórico de ocorrência de fitonematóides nos diferenteslocais. Até o momento, foram feitas análises ecaracterizados os fitonematóides em propriedades dosdistritos de Alegre e Muniz Freire. Amostras dos distritosde Irupi, Iuna e Ibiritama também já foram coletadas eas análises estão sendo realizadas. Após coletadas, asamostras têm sido encaminhadas ao laboratório defitopatologia do CCA-UFES e submetidas ao processoeletroforético para identif icação de espécies deMeloidogyne. Até o momento M. exigua foi a única espéciedetectada nas propriedades amostradas.

114 – LEVANTAMENTO POPULACIONAL DE NEMATÓIDES FITOPARASITAS ASSOCIADOS ACULTIVARES DE BANANEIRA [POPULATION SURVEY OF PLANT PARASITIC NEMATODESASSOCIATED WITH BANANA CULTIVARS] Santos, L.C.1; Oliveira, A.P.1; Teixeira, R.A.1; Araujo, F.G.1; Barbosa,K.A.G.1; Naves, R.V.1; Rocha, M.R.1 1Universidade Federal de Goiás, Escola de Agronomia e Eng. de Alimentos, C. P. 131,74001-970 Goiânia, GO, Brazil. E-mail: [email protected]

Dentre as diversas doenças que atacam a bananeira, aquelascausadas por fitonematóides estão entre as principais,devido ao grande prejuízo e dificuldade de controle. Alemdisso, parasitismo por nematóides em bananeirascaracteriza-se pela infestação simultânea de várias espécies.Seis cultivares comerciais de bananeira, com cinco anos deidade, conduzidas em área experimental da Escola deAgronomia e Engenharia de Alimentos da UniversidadeFederal de Goiás, em Goiânia-GO, tiveram suas raízesamostradas para identificação da ocorrência de nematóidesfitoparasitas. As cultivares BRS Fhia 18, Caipira, IAC 2001,Prata Zulu, Thap Maeo e Tropical foram plantadas emdelineamento experimental em blocos ao acaso com seisrepetições. As amostras foram coletadas na rizosfera decada uma das plantas, por meio da escavação de trincheiras

de 20 cm de largura, 20 cm de comprimento e 20 cm deprofundidade, totalizando 36 amostras. Os nematóidesforam extraídos de 10 g de raízes e observou-se maiorfreqüência de Helicotylenchus sp., Meloidog yne sp. eRadopholus similis, que foram identificados em 100%, 89%e 78% das amostras, respectivamente. O gêneroRotylenchus apareceu em 47% das amostras e Pratylenchussp. em 36% das amostras. As cultivares BRS Fhia 18 ePrata Zulu apresentaram as maiores densidadespopulacionais de Meloidogyne sp. (118 e 205 indivíduospor 10 g de raízes, respectivamente) e Radopholus similis(52 e 36 indivíduos por 10g de raízes, respectivamente).Em geral, as cultivares Tropical e Caipira apresentaramas menores densidades populacionais de nematóides nasraízes.



341

115 – OCORRÊNCIA DE Meloidogyne spp. EM Coffea spp. NO ESTADO DO ESPÍRITO SANTO, BRASIL[SURVEY OF Meloidogyne spp. ON Coffea spp. IN ESPIRITO SANTO STATE, BRAZIL] Barros. A.F.1; Coutinho, R.R.1;Lima, I.M.2; Costa, A.2; Oliveira, E.B.2; Oliveira, R.D.L.1 1Universidade Federal de Viçosa, Departamento de Fitopatologia,36570-000 Viçosa, MG, Brazil; 2Instituto Capixaba de Pesquisa, Assistência Técnica e Extensão Rural, C. P. 62, 29915-140Linhares, ES, Brazil. E-mail: [email protected]

Os nematóides das galhas pertencentes ao gêneroMeloidogyne spp. representam um fator limitante àcafeicultura brasileira onde causam grandes perdas. Estudara ocorrência de Meloidogyne spp. em Coffea spp. no Estadodo Espírito Santo constituiu o objetivo deste trabalho.Amostras de solo e raízes foram coletadas nos seguintesmunicípios: Laranja da Terra, Castelo, Jaguaré, Sooretama,Afonso Cláudio, Venda Nova do Imigrante, Brejetuba,Domingos Martins. A identificação das espécies deMeloidogyne spp. foi realizada pelo fenótipo da isoenzimaesterase. M. incognita, fenótipo I1 e I2, foi detectado nosseguintes municípios: Laranja da Terra, Castelo, Jaguaré,

Sooretama, Afonso Cláudio em lavouras cafeeiras de C.canephora. M. paranaensis, fenótipo P1, foi encontrado emlavouras cafeeiras de C. canephora em apenas umapropriedade do município de Sooretama. Em outras áreasdesta mesma propriedade, ele foi detectado em mistura comM. incognita. M. exigua, fenótipo E1, ocorreu em lavourascafeeiras de C. arabica nos municípios de Afonso Cláudio,Venda Nova do Imigrante, Brejetuba e Domingos Martins.As espécies M. arenaria, fenótipo A2, e M. javanica (J3) foramdetectadas em Laranja da Terra parasitando plantasdaninhas presentes na área, mas não em cafeeiros. Apoiofinanceiro: CBP&D Café e FAPEMIG.

116 – VALOR ESPERADO DE GERAÇÕES DE Meloidogyne chitwoodi EM ALGUMAS LOCALIDADES DOBRASIL COM BASE NA TEMPERATURA AMBIENTE [EXPECTED NUMBER OF GENERATIONS OFMeloidogyne chitwoodi IN SOME PARTS OF BRAZIL BASED ON ENVIRONMENTAL TEMPERATURE] Palhares-Melo, L.A.M.1; Gonzaga, V.1; Tenente, R.C.V.2 1Embrapa Recursos Genéticos e Biotecnologia, Brasília, DF, Brazil; 2EmbrapaRecursos Genéticos e Biotecnologia, Brasília, DF, Brazil. E-mail: [email protected]

O monitoramento estender de pragas, exóticas ou não, éuma atividade que contribui para a minimização de riscosde queda da produtividade agrícola dos países. Diversaspragas agrícolas, tais como os nematóides, são animaispecilotérmicos, isto é, dependem da temperatura ambientepara se desenvolverem. O cálculo de graus-dia acumulados(soma térmica), que se baseia nos valores de temperaturamáxima e mínima diária do ambiente e da temperatura basede desenvolvimento do organismo permite estimar o temponecessário para completar a formação de uma geração dapraga, medido em dias do ano. Experimentalmente, calcula-se para o organismo em questão, uma temperatura base dedesenvolvimento Tb, a partir da qual o mesmo se desenvolve.Também, experimentalmente calcula-se a constante térmicaK, medida em graus-dia, que representa a soma térmicaque o organismo necessita para passar de uma fase a outrade seu ciclo de desenvolvimento. Meloidogyne chitwoodi, entreoutros nematóides, apresenta interesse econômico para oagronegócio por parasitar diversas culturas. Este trabalhoteve por objetivo avaliar preliminarmente a favorabilidadede ocorrência de M. chitwoodi em várias localidades do Brasil,através da variável valor esperado de gerações/ano. Foramselecionadas 170 localidades que correspondem a estaçõesmeteorológicas do INPE que dispõem dos dados datemperatura máxima e mínima diária, necessários ao cálculo

da soma térmica, referentes ao ano de 2006. Foram entãocalculadas as somas térmicas para essas localidades combase nos seguintes parâmetros: temperatura base dedesenvolvimento de M.chitwoodi Tb = 5 oC; constante térmicade desenvolvimento K para a primeira geração e geraçõessubsequentes de 1.000 e 500 graus-dia, respectivamente.Neste trabalho, supôs-se que: (a) no dia 01/01/2006 fêmeasde M. chitwoodi depositaram ovos em cada uma das 170localidades; (b) nas localidades analisadas encontram-sehospedeiras potenciais da praga e não existem predadoresnem programas de manejo da praga; (c) são desconsideradosparâmetros demográficos da praga tais como taxa denatalidade, mortalidade e fecundidade, etc.; e (d) somentea temperatura ambiente influencia o crescimento dapraga. Como resultado, o valor médio esperado degerações, nas 170 localidades, foi de 12,96 gerações/ano,indicando alta favorabi l idade cl imática aoestabelecimento de M. chitwoodi, em diversas áreas, casoesse nematóide seja introduzido no país. O procedimentomostrou-se simples de ser realizado, propiciando ummapeamento, ainda que prel iminar, de áreas defavorabilidade climática de introdução de pragas diversas,entre elas os nematóides, desde que se tenhamdisponibilizados os valores de temperatura base dedesenvolvimento Tb, e da constante térmica K.

342 Vol. 33(4) - 2009


117 – MORPHOANATOMICAL DETAILS UNDER SEM AND LIGHT MICROSCOPE OF ANUNDESCRIBED SPECIES OF Hoploaimus DADAY FROM BRAZILIAN AMAZONIA [DETALHESMORFOANATÔMICOS AO MEV E AO MICROSCÓPIO FOTÔNICO DE UMA ESPÉCIE NAO DESCRITA DEHoplolaimus DADAY DA AMAZONIA BRASILEIRA] Santos, J.M.¹; Moraes, A.J.G.²; Soares, P.L.M.³; Poltronieri, L.S.3

¹,³UNESP,FCAV, Departamento de Fitossanidade, 14884-900 Jaboticabal, SP, Brazil; ²Av. Pedro Paulo de Souza, No.1981, 74.663-520 Goiânia, GO, Brazil; 3Embrapa Amazônia Oriental, 66.095-100 Belém, PA, Brazil. E-mail:[email protected]

Recent studies on the nematophauna of the Amazonrainforest in some counties of Pará State, Brazil revealedthat nematodes of the family Hoplolaimidae are the mostabundant group of tylenchid nematodes in soil of theAmazon biome. The objective of this research was toprepare a detailed documentation under SEM and lightmicroscope of the main differentiating morphoanatomicalcharacters as well as other diagnostic data of a new speciesof Hoplolaimus Daday from an urban area of Belem City,Pará State, Brazil. The new species is characterized by thefollowing details: length of females (10 ) 1.89 mm(1.65-2.03); labial region with massive framework andmarkedly set off, bearing three to four labial annules andthe basal one with 20-25 longitudinal striae; stylet length53.13 µm (52.04-54.30), strong, with prominent basal knobs

tulip-shaped and variable dentate anteriorly; hemizonid43.27 µm (37.51-47.88) below the excretory pore; two lineson lateral fields not areolated; intestinal post-rectal sacpresent; one fasmid (scutella) anterior and the otherposterior to vulva; two ovaries outstretched(amphidelphic); spermatheca round generally with manysperm; tail rounded with 7–15 annules; length of male(6 ) 1.40 mm (1.20-1.78) with conspicuous sexualdimorphism; stylet (n=4) 50.17 µm (49.00-52.26); spiculelength 56.64 µm (55.11-58.37) and no juveni leheteromorphism. Since this data set does not match withothers from any one of the seven valid species of thegroup that has or could have two lines in lateral fields,the population is considered a new species and is beingdescribed.

The production of vegetables in the Provinces of BuenosAires and Rio Negro includes one of the most importanthorticultural areas in Argentina. Horticulture and fruitproduction represents 20% of the gross domestic productof the national agriculture production. The increasingimportance of nematodes has been detected since 2001,coincident with a diminishing use of ethidium bromide.From 940 soil and plant samples sent by farmers and officialorganisms of control and certification since 2003, wepresent the distribution of plant-parasitic nematodes inhorticultural crops from 13 and 14 localities of theProvinces of Buenos Aires and Río Negro, respectively.Four soil sub-samples/1000 m2 and 20 sub-samples/ha at20 cm depth were analyzed. In tomato, pepper, onion, chard

and lettuce 10 plants/ha were taken and in potato 100tubers/ha. In the samples analyzed from Río Negro, apredominance of Meloidogyne incognita and M. hapla (36%)was detected in relation to Nacobbus aberrans (1.0%), whilein the horticultural crops under cover in the southeast ofBuenos Aires Province, N. aberrans was found in 81% andM. incognita and M. hapla in 19% of the samples; M. chitwoodi,M. hapla, M. incognita, D. dipsaci, P.neglectus and P.scribneri werefound in potato fields. M. naasi and Globodera tabacum wereonly found in the soil samples in 37% and 0.1 % of thesamples, respectively. The genera Longidorus (Dorylaimida)and Tigronchus (Mononchida), in Río Negro Province, andIsolaimium (Isolaimida) in Neuquén Province, were reportedfor the first time in Argentina.

119 – NEMATODE COMMUNITIES IN THE RESTINGA OF MARAMBAIA, RJ, BRAZIL [LA COMUNIDADDE NEMATÓIDES EN LA RESTINGA DA MARAMBAIA RJ, BRASIL] Mondino E.A.1; Huertas Tavares, O.C.1; FrançaFigueira, A.1; Souza, N.B.1; Oliveira C.P.1; Berbara, R.L.L.1 1Laboratorio de Biologia do Solo, Universidade Federal Rural doRio de Janeiro, BR 465, km 7, 23890-000 Seropédica, RJ, Brazil. E-mail: [email protected]

Restingas are a group of plant communities, with differentphysiognomies, under sea and fluvial influence. These

communities, distributed in mosaic, are found in areas ofgreat ecological diversity, and are considered edaphic

118 – NEMATODE DISTRIBUTION ON HORTICULTURAL CROPS FROM THE PROVINCES OFBUENOS AIRES AND RIO NEGRO, ARGENTINA [DISTRIBUIÇÃO DE NEMATÓIDES EM HORTALIÇASNOS ESTADOS DE BUENOS AIRES E RIO NEGRO, ARGENTINA] Chaves, E. 1; INTA-EEA Balcarce,1. 1Laboratoriode Nematología, C.C. 276, 7620 Balcarce, Argentina. E-mail: echaves.balcarce.inta.gov.ar



343

communities as they depend more on the nature of thesoil than that of the climate. The nematode community’sstructure offers an important and efficient instrument forbiological evaluation of the quality and functionality ofsoils. Soil nematodes not only reflect the soil processes butalso influence it. Nematode community indices can be usedto monitor the ecological conditions of the soil. Theobjective of this work was to evaluate the nematodecommunity in relation to the different plant formations inthe Restinga ecosystem. The nematologic fauna wasmonitored along the south coast of Rio de Janeiro state(Restinga da Marambaia). The samples were taken in May2008 in three plant physiognomies: (A) open shrubbyflooded, (B) closed shrubby sandy belt (C) sandy strip offorest. Soil samples were collected in zig-zag as compoundsamples (with six points) separately at 0-10 cm and 10-20cm of depth, with three replicates for each representativeplant area. For nematode extraction from soil the flotation-centrifugation method was used. Identification was doneunder the microscope, up to the genera category. The

abundance (number ind.100mL-1), trophic structure andfollowing indices: Shannon (H’), Simpson (D) and Evenness(J´), Maturity (MI), Enrichment (MI2-5) and Parasitism(PPI) were calculated. The mean density (0-20 cm) wassignificantly lower at the B area, with 57, 34 and 72ind.100mL-1 at the A, B and C areas, respectively. However,the lowest density was detected in area A at 10-20 cm ofdepth. Forty-six genera and two families were recorded.On average, 11, 10 and 14 genera were described at A, Band C areas, respectively. No significant differences in theH, D and J indices were detected among areas (0-20 cm).However, the H index was higher in the 0-10 cm than the10-20 cm of soil depth in all areas. Moreover, area C showedthe highest MI, MI2-5 and PPI indices. In conclusion,differences in nematode community indices were inaccordance with differences between different ecologicalconditions of the soil. In particular, the sandy strip of forest(C) area was the most stable environment tested because itshowed both the highest diversity and maturity indices (MI,MI2-5 and PPI).

120 – POPULATION DYNAMICS AND VERTICAL DISTRIBUTION OF CITRUS NEMATODES IN SÃOPAULO STATE, BRAZIL [DINÂMICA DA POPULAÇÃO E DISTRIBUIÇÃO VERTICAL DOS NEMATÓIDESDOS CITROS NO ESTADO DE SÃO PAULO, BRAZIL] Campos, A.S.¹; Santos, J.M.² ¹Phytonema Clínica de Plantas.Rua Sétimo Fracalossi Nº. 138, Bairro Boa Vista, 13486-198 Limeira SP, Brazil; ²UNESP, FCAV, Departamento deFitossanidade, 14884-900 Jaboticabal, SP, Brazil. E-mail: [email protected]

The fact that root-knot nematodes do not infect citrus inBrazil has been a key condition for the success of the citrusbusiness in São Paulo. Currently, the citrus crop and sugar-cane have replaced the coffee crop that was destroyed bythose nematodes in São Paulo State during the last century.Although many species of nematodes have been detectedin orchards of citrus (Citrus spp.) in Brazil, only the citrusnematode (Tylenchulus semipenetrans Cobb) and the citruslesion nematode (Pratylenchus jaehni Inserra et al.) are thekey nematodes for citrus in São Paulo State and thesenematodes do not infect coffee. This research was carriedout with the objectives of studying the population dynamicsof citrus nematodes in two distinct crop environmentalconditions in São Paulo State, and the distribution of thesepests in the soil profile. The tests were carried out in orangeorchards of Monte Alto and Palestina Counties. Samplesof soil and roots were collected monthly during a periodof more than one year in both places and were processedin the Laboratório de Nematologia of the Departamentode Fitossanidade at UNESP/FCAV, Jaboticabal Campus.The monthly average temperature and amount of rain

during the period was also recorded. The fluctuation curvesof Tylenchulus semipenetrans and Pratylenchus jaehni populationswere prepared. The fluctuation of both nematodepopulations during the year adjusts to a quadratic modelwith the lower population levels occurring during the hottestand wettest months, while the peaks occur during the coldestand driest months. However, the application of aldicarbfor the control of nematodes on citrus in São Paulo isusually done at the beginning of the rainy season, inSeptember to November. Although the orchards showimprovement in their general conditions with aldicarbapplications, the data suggest that the best results fornematode control should be obtained with applicationsat the end of the rainy season and not at the beginning.For the study of the nematode vertical distributiontrenches of up to 2m deep in the soil were opened atthe side of infected older plants and soil samples werecollected in 20cm bands at the profile. The highestdensity of citrus nematodes occurs in the first 60cm ofthe soil profile, with higher density between 20 and 40cmdeep.

344 Vol. 33(4) - 2009


121 – VERTICAL FLUCTUATION OF NEMATODE COMMUNITY AND PHYSICAL SOIL ATTRIBUTESAS A RESULT OF HARVEST AND STILLAGE APPLICATION IN SUGARCANE [FLUTUAÇÃO VERTICALDA NEMATOFAUNA E ATRIBUTOS FÍSICOS DO SOLO EM FUNÇÃO DA COLHEITA E APLICAÇÃO DEVINHAÇA EM CANA-DE-AÇÚCAR] Miranda, T.L.1; Pedrosa, E.M.R.1; Rolim, M.M.1; Oliveira, N.J.V.1 1UniversidadeFederal Rural de Pernambuco, Rua Dom Manoel de Medeiros s/n, Dois Irmãos, 52.171-900 Recife, PE, Brazil. Email:[email protected]

Changes in vertical distribution of nematode communityand physical soil attributes resulting from harvest and stillageapplication were evaluated in an area intensively cultivatedwith sugarcane in the coastal rainforest of NortheasternPernambuco, Brazil. Evaluations were based on soilhumidity and density, resistance to compactness, porosity,granulometry, particle density, and trophic structure of thenematode community. Data analyses were carried out beforeand after sugarcane cutting and stillage application.

Horizontally, samples were collected at 42 points within a60×50 m square in each period. Vertically, at each point,samples were collected 0-10, 10-20, 20-30, 30-40, 40-50cm deep. In general, nematode density did not varysignificantly after harvest or stillage application in soil, butdecreased with depth. The higher densities occurred from0 to 20 cm. There was no significant variation in physicalproperties due to depth, except in sand and silt content,which presented inverse response.

122 – IDENTIFICAÇÃO DE ESPÉCIES DE Meloidogyne EM ACEROLEIRAS DE ÁREAS IRRIGADAS DEPETROLINA, PE [IDENTIFICATION OF THE Meloidogyne SPECIES IN ACEROLA PLANTATIONS OF IRRIGATEDAREAS OF PETROLINA, BRAZIL] Castro, J.M.C.1; Santana, T.A.S.1; Santana, M.L.M.P.2; Barbosa, N.M.L.2 1Embrapa Semi-Árido, C.P. 23, 56303-970 Petrolina, PE, Brazil; 2PLANTEC/CODEVASF, Vila CS1, Distrito de Irrigação Projeto SenadorNilo Coelho, 56300-990 Petrolina, PE, Brasil. E-mail: [email protected]

Meloidogyne javanica, M. incognita raças 1, 2, 3 e 4 e M. arenariaraça 2 são nematóides-das-galhas relatados como causadoresde infecções nas raízes de aceroleiras (Malpighia spp.) no Brasil.Em Petrolina, Pernambuco, plantas de acerola de diferentescultivares, com sintomas de amarelecimento foliar, comsubdesenvolvimento, pouco produtivas e com galhas nas raízesvêm sendo observadas em vários cultivos irrigados. Paraidentificar as espécies de Meloidogyne presentes nessas áreas,amostras de solo e raízes foram coletadas e enviadas aoLaboratório de Nematologia da Embrapa Semi-Árido. No solode cada uma das amostras, tomateiro ‘Sta. Clara’ foi cultivadoem casa-de-vegetação para multiplicar a população donematóide e facilitar a identificação das espécies, segundo os

fenótipos de α-esterase revelados em géis de poliacrilamida,submetidos à eletroforese vertical. Espécies de Meloidogyneforam identificadas em 63 das 66 amostras coletadas. Foiidentificado M. mayaguensis em 48 amostras (72,7%), M. arenariaem cinco (7,6%), M. incognita em cinco (7,6%) e M. javanica emquatro (6,1%). Numa amostra (1,5%), detectou-se a misturade M. mayaguenis e M. arenaria. Concluiu-se, com estaprospecção, que espécies de Meloidogyne parecem estardiretamente relacionadas aos sintomas citados. Ressalta-se quea aceroleira não é uma cultura indicada para a substituição degoiabeiras eliminadas, devido à infecção por M. mayaguensis,tendo em vista a suscetibilidade das cultivares comerciaisatualmente disponíveis.

123 – NEMATODOS BACTERIÓVOROS EN SUELOS DE LOS PÁRAMOS DE GUERRERO,Y PNNCHINGAZA, CUNDINAMARCA - COLOMBIA [BACTERIOVORUS NEMATODES IN THE SOIL OF LOSPARAMOS DE GUERRERO AND PNN CHINGAZA, IN CUNDINAMARCA – COLOMBIA] Leguízamo, M.C.1;Parada, J.C.2 1Universidad Nacional de Colombia, Palmira; 2Universidad Nacional de Colombia- Bogotá. E-mail:[email protected]

Se aislaron nematodos de suelos provenientes de sectoresnaturales, de pasturas y cultivados con Solanum spp., eninmediaciones del Páramo de Guerrero en ZipaquiráCundinamarca y en áreas naturales e intervenidas paraextracción de cal en el PNN Chingaza. Los registrosmostraron alta densidad poblacional de nematodosbacterióvoros, en los ordenes Enoplida, Monhysterida,

Araeolaimida, Rhabditida, Diplogasterida, con las familiasPrismatolaimidae, Monhysteridae, Xyalidae, Leptoimidae,Rhabditidae, Rhabditonematidae, Diploscapteridae,Alloionematidae, Cephalobidae, Teratocephalidae,Diplogasteridae, Tylopharyngidae, Odontopharyngidae yCylindrocorporidae, con una notable predominancia de lafamilia Rhabditidae en los dos sitios estudiados (32% y 40%



345

respectivamente) De acuerdo a la clasificación trófica deBongers et al, (1998), predominan los grupos c-p 1 y c-p 3.En cuanto a la distribución por profundidad, los mayoresporcentajes para todas las familias se presentan en los 20cm superficiales del perfil del suelo y en presencia dehorizonte O el cual favorece la presencia de materiaorgánica en proceso de descomposición. Los hábitat conmayor grado de intervención (cultivo de papa y área deexplotación de cal) presentaron el mayor porcentaje denematodos bacteriovoros (43% y 36% respetivamente). Encuanto a textura de suelo la presencia de bacterióvoros sevió favorecida en los suelos AFr probablemente debido alas condiciones de aireación y humedad allí presentes, elpH más indicado se presentó en el rango comprendido entre5.01 y 5.5, el porcentaje de materia orgánica también tuvo

influencia siendo favorable entre 20% y 26% en cada caso.La densidad de bacterióvoros en suelos de bosque, puedeestar favorecida por el porcentaje de materia orgánicaaportada por material vegetal en descomposición en losdos casos. En cultivos o zonas intervenidas, la densidad sefavorece por la alta disponibilidad de nutrientes aportadospor la fertilización artificial y porque al intervenciónaumenta la presencia de organismos colonizadores comobacteriovoros y fumívoros. Finalmente, se puede concluirque el análisis de las poblaciones de bacterióvoros,comparando los dos sistemas de páramo estudiados, permitereconocer suelos en condiciones de inestabilidad de cadenatrófica, en áreas intervenidas antropicamente, respecto alos suelos de bosque, sin embargo la baja diversidad enestos suelos un alto impacto para las dos zonas.

124 – COMUNIDADE DE NEMATÓIDES SOB DIFERENTES CONCENTRAÇÕES DE CO2

ATMOSFÉRICO EM CULTIVO DE ARROZ [NEMATODE COMMUNITY UNDER DIFFERENTATMOSPHERIC CO2 CONCENTRATIONS IN RICE] Ritzinger, C.H.S.P.1; Fancelli, M.1; Ghini, R.2; Ledo, C.A.S.11Embrapa Mandioca e Fruticultura Tropical, C.P. 007, 44380-000 Cruz das Almas, BA, Brazil;²Embrapa Meio Ambiente. E-mail: [email protected]

Os nematóides fitoparasitas promovem a destruição dosistema radicular, impedem as plantas de absorverem águae nutrientes, reduzem a vida útil das plantas e possuemmecanismos para a sua prolongada sobrevivência. Osnematóides de vida livre apresentam efeito benéfico àagricultura por meio de seu hábito alimentar, decompondoresíduos orgânicos e alimentando-se de bactérias, fungos,nematóides e artrópodes no solo. Os índices dascomunidades de nematóides são essenciais para detectarimpactos sobre diferentes tipos de manejo dos solos, bemcomo distúrbios que tais nematóides sofrem. Esse trabalhofoi realizado com o objetivo de identificar a comunidadede nematóides fitoparasitas e de vida livre em solo sobdiferentes concentrações de CO2 atmosférico, em cultivode arroz em condições de estufa de topo aberto (OTC). Ascoletas foram realizadas em OTCs instaladas na EmbrapaMeio Ambiente em Jaguariúna, SP. Cada parcela de 2m dediâmetro recebeu o plantio de mudas de arroz. Os três

tratamentos utilizados foram sem OTC, com OTC seminjeção de CO2 e com OTC com injeção de CO2,casualizados em blocos com três repetições. Após 60 diasda semeadura do arroz, foram feitas as amostras de solo.Cada amostra constituiu-se de duas subamostras porquadrante. As amostras foram enviadas para analise noLaboratório de Nematologia da Embrapa Mandioca eFruticultura Tropical. Não houve diferença significativaentre os blocos mas houve diferença significativa entre ostratamentos. Em todos os tratamentos, a maior população defitonematóides foi de Helicotylenchus sp., seguida de Pratylenchussp. e Rotylenchulus reniformis. Houve baixa população denematóides de vida livre e Tylenchus sp. Registrou-se na OTCsob aplicação de CO2 a maior população de Helicotylenchus sp.,seguida da OTC sem CO2 e sem OTC, respectivamente. Omonitoramento desses nematóides sob os diferentestratamentos e cultivos, com ou sem OTC, poderá servir comoindicativo do impacto das mudanças climáticas.

125 – OCORRÊNCIA DA PRESENÇA CONCOMITANTE DE Pratylenchus brachyurus E Criconemella sp.NA CULTURA DA SOJA [OCCURRENCE OF CONCOMITANT PRESENCE OF Pratylenchus brachyurus ANDCriconemella sp. IN SOYBEAN CROP] Andrade, V.1; Schmidt, J.1; Mafacioli, R.1; Bertan, I.1; Lovato, B.1 1Syngenta, C.P. 585,38405-232 Uberlândia, MG, Brasil. E-mail: [email protected]

Os prejuízos à agricultura, causados por fitonematóides,têm sido elucidados, mas a grande maioria dos estudosdesconsidera a interação entre diferentes espécies dessespatógenos. O nematóide das lesões radiculares (NLR)

Pratylenchus brachyurus tem se destacado, no cenário agrícola,por ser um parasita agressivo, polífago e de difícil controle.Por não necessitar de um sítio específico de alimentação,como ocorre com nematóides de outras espécies, o

346 Vol. 33(4) - 2009


desenvolvimento de germoplasmas resistentes se torna maiscomplexo, o que maximiza a importância desse patógeno.No caso de Criconemella sp. são poucos os estudos sobresua patogenicidade à soja, embora tenha grande importânciapara as culturas do milho, amendoim, banana, quiabo, dentreoutras. O Brasil atua no cenário agrícola mundial como omaior exportador do complexo soja (grão, farelo e óleo) esegundo maior produtor de grãos, sendo esta a cultura maisimportante para a economia nacional. O objetivo destetrabalho foi avaliar os danos causados à soja pela infestaçãoconjunta dos nematóides fitoparasitas P. brachyurus eCriconemella sp. A presença concomitante foi constatada emárea agrícola localizada na região de Uberlândia-MG.Procedeu-se a coleta de solo da rizosfera e de raízes desoja, a partir dos quais foram extraídos e identificados osnematóides. A confirmação dos parasitas nas raízes foirealizada pela coloração dos tecidos radiculares, pelométodo da fucsina ácida e observação em microscópio

óptico; a extração foi feita pelo método de centrifugaçãoem solução de sacarose, e a quantificação foi feita pelométodo da contagem direta em câmara de Peters. Aidentificação foi realizada através do uso da Chave deIdentificação de Nematóides Fitoparasitas (MAI &MULLIN, 1996). Os resultados da quantificação em solode rizosfera foram: P. brachyurus = 112 /150cm3; Criconemellasp. = 3 /150cm3. Constatou-se que a sintomatologiavisualizada a campo, de acentuada redução no crescimentoda cultura da soja (nanismo) e clorose, é causada pelapresença de fitonematóides. O grande número de indivíduosde P. brachyurus encontrados, aliado à sua agressividade,resultam em danos expressivos à cultura. Os dadospreliminares apontam ainda a presença de Criconemella sp.no interior do sistema radicular das plantas, como indíciode sua afinidade. No entanto, estudos sobre apatogenicidade desse nematóide, em soja, ainda sãonecessários.

126 – OCORRÊNCIA DE Pratylenchus brachyurus EM SOJA NA REGIÃO DO TRIÂNGULO MINEIRO -MG [OCCURRENCE OF Pratylenchus brachyurus IN SOYBEAN IN THE TRIÂNGULO MINEIRO REGION – MG]Andrade, V.1; Schmidt, J.1; Lovato, B.1; Mafacioli, R.1; Bertan, I.1 1Syngenta, C. P. 585, 38405-232 Uberlândia, MG, Brazil.E-mail: [email protected]

O nematóide das lesões radiculares (NLR) Pratylenchusbrachyurus, patógeno emergente de extrema agressividade edifícil controle, causa perdas significativas em produtividadenas mais diversas culturas. Por ser um parasita polífago, setorna de grande importância no cenário agrícola nacional.Enfocando a região em estudo, o uso da rotação soja xmilho, ambos hospedeiros do NLR, tem causado danoseconômicos expressivos na cultura da soja. A presença dofitoparasita no sistema radicular da soja causa umescurecimento da mesma, em virtude do rompimento enecrose do córtex da raiz. Na parte aérea da planta, ocorresintomatologia de clorose e nanismo, em função dadeficiência nutricional causada pelo dano no sistemaradicular. A soja, Glycine max, atualmente é a cultura agrícolamais importante no Brasil, ocupando mais de 20 milhõesde hectares. O Triângulo Mineiro (T.M.) apresenta-se comouma das regiões de economia mais dinâmica do Estado deMinas Gerais, com ênfase para o setor agrícola. Nestetrabalho objetivou-se identificar a ocorrência natural do P.brachyurus em lavouras produtoras de soja no T.M., na safrade verão 2008/2009. Foram coletadas amostras de raízesde soja no período reprodutivo de desenvolvimento da

cultura, em 3 lavouras comerciais, sendo: área 1: municípiode Campo Florido (latitude 19º45’34" S, longitude 48º34’19"W, altitude 570 m.); área 2: município de Tupaciguara(latitude 18º35’49" S, longitude 48º41’59" W, altitude 833m.); área 3: município de Monte Alegre de Minas (latitude18º52’15" S, longitude 48º52’51" W, altitude 738 m.). Paraa constatação da presença do NLR nas raízes, foi realizadaa coloração dos nematóides dentro dos tecidos radicularespelo Método da Fucsina Ácida (BYRD, KIRKPATRICK& BARKER, 1983) e observação em microscópio óptico;e a identificação do P. brachyurus foi realizada através douso da chave dicotômica de identificação de nematóidesfitoparasitas. Como resultado, os sintomas visualizados nocampo foram confirmados como causados pelo P. brachyurus,ratificando a presença do nematóide na região do TriânguloMineiro. A identificação destes patógenos é de sumaimportância, pois possibilita o uso de técnicas adequadas emedidas mitigadoras visando a diminuição dos danoscausados pelo mesmo, através do uso de germoplasmas commaior índice de tolerância, uso de tratamentos de sementes(em avaliação), rotação com culturas não-hospedeiras,dentre outros métodos alternativos.



347

127 – OCORRÊNCIA DE Scutellonema brachyurus Andrassy EM SOJA NO BRASIL [OCCURRENCE OFScutellonema brachyurus Andrassy ON SOYBEAN IN BRAZIL] Maceda, A.¹; SILVA, J.F.²; Dias, W.P.²; Santos, J.M.³; Soares,P.L.M.³; Marcondes, M.C.¹; Lima, C.G.² ¹Secretaria de Estado da Agricultura e do Abastecimento do Paraná, Rua: JaimeBalão, 575, Campus I da UFPR, 80040-340 Curitiba, PR, Brazil; ²Embrapa Soja, C. P. 231, 86001-970 Londrina, PR,Brasil; ³UNESP, Campus de Jaboticabal, 14.884-900 Jaboticabal, SP, Brasil. E-mail: [email protected]

Nas últimas safras, em diferentes regiões dos estados doParaná, Mato Grosso do Sul e Maranhão, técnicos eprodutores vêm observando reboleiras em lavouras de sojaonde as plantas exibem crescimento reduzido e desigual,associado a baixas produtividades. Este estudo foiconduzido com o objetivo de avaliar se nematóidespoderiam ser a causa das reboleiras observadas a campo.Amostras de solo e raízes foram coletadas nessas reboleirase encaminhadas aos laboratórios de Nematologia daEmbrapa Soja, em Londrina (PR), UNESP-Jaboticabal (SP)e da SEAB, em Curitiba (PR). Os nematóides foramextraídos de alíquotas de 100 cm³ das amostras de solo,pela técnica da flotação centrífuga, em solução de sacarose.Porções de 10 g de raízes, de cada amostra, foram trituradasem água, em liquidificador. As suspensões obtidas nesseprocesso foram centrifugadas, como no caso anterior, comadição de 1 cm³ de caulim aos tubos das centrífugas. Asanálises revelaram a presença de Scutellonema brachyurus, emmuitos casos em densidades de população superiores a 5.000espécimes por 100 cm³ das amostras de solo. A identificação

da espécie foi baseada no estudo morfométrico donematóide aos microscópios fotônico e eletrônico devarredura. Conquanto esse nematóide não seja consideradoum endoparasito, freqüentemente, a população, recuperadaem 10 g de raízes, foi superior a recuperada em 100 cm³das amostras de solo. As evidências sugerem que essenematóide é um dos patógenos da soja no Brasil. O examede 154 amostras coletadas em lavouras de soja no estadodo Paraná revelou a presença do nematóide em 43 (27,9%)delas. Em alguns desses casos, a infestação foi superior a1.000 espécimes do nematóide por 100 cm³ das amostrasde solo. A ocorrência do nematóide associada a períodosde estiagem, como observado na safra 2008/09 na região,e a semeadura generalizada de cultivares precoces, parecemfavorecer a ocorrência de danos na produção de soja. Apreferência pelas cultivares precoces é um fenômenoobservado em todo Brasil. Assim, poderá ser frequentea ocorrência de danos causados por nematóides,considerados de importância secundária na cultura dasoja, no País.

128 – LEVANTAMENTO DE NEMATOIDES EM POMARES DE GOIABEIRAS DE 14 MUNICÍPIOS DOESTADO DE SÃO PAULO, BRASIL [SURVEY OF NEMATODES IN GUAVA ORCHARDS IN 14 COUNTIESOF SÃO PAULO STATE, BRAZIL] Becaro, C.K.¹; Soares, P.L.M.²; Franco, D.³; Múscari, A.M.4; Santos, J.M.² ¹UNESP/FCAV, Câmpus de Jaboticabal; ²UNESP/FCAV; ³Farm Consultor/GTACC; 4UNESP/FCAV. E-mail:[email protected]

A goiaba é uma das frutas de maior importância econômicano estado de São Paulo. Nos últimos anos, os danoscausados por nematoides, notadamente Meloidogynemayaguensis e, mais recentemente, por Pratylenchus brachyurus,têm sido muito elevados, por vezes justificando aerradicação da cultura. Plantas infectadas por essesnematoides inicialmente exibem as folhas das extremidadesdos ramos com coloração marron-avermelhadas dos bordospara o centro. Com a evolução da doença ocorre a quedaprematura de folhas, expondo os ramos e o caule à radiaçãosolar. Em conseqüência, os ramos e o caule assumem tonsde cinza claros e os frutos menores que os de plantas semesses sintomas. Em agosto de 2008, iniciou-se umlevantamento de nematoides em pomares de goiaba de 14municípios paulistas, a saber: Vista Alegre do Alto, Pirangi,Monte Alto, Taiaçú, Matão, Taquaritinga, Itápolis, FernandoPrestes, Santa Adélia, Cândido Rodrigues, Novo Horizonte,Urupês, Elisiário e Júlio de Mesquita. As amostras de solo

e raízes foram coletadas em pomares desses municípios eprocessadas no Laboratório de Nematologia da UNESP/FCAV, Câmpus de Jaboticabal. M. mayaguensis foi encontradoem pomares dos municípios de Matão, Santa Adélia e NovoHorizonte, correspondendo a 23,1% das amostras coletadas.P. brachyurus foi encontrado nas amostras dos municípiosde Júlio de Mesquita, Matão, Elisiário, Vista Alegre do Alto,Itápolis, Fernando Prestes, Pirangi e Novo Horizonte,correspondendo a 27% das amostras e Hemicycliophora spp.foram encontradas em pomares dos municípios de VistaAlegre do Alto, Itápolis, Fernando Prestes, Pirangi e NovoHorizonte, Monte Alto, Taiaçu e Taquaritinga,correspondendo a 57% das amostras. Conquanto M.mayaguensis seja a espécie de nematoide de maior importânciaeconômica para a cultura da goiabeira, no Brasil, outrosnematóides também estão se tornando ameaças para essafrutífera e devem ser levadas em conta nos programas demanejo de pragas na cultura.

348 Vol. 33(4) - 2009


129 – EL NEMATODO DE QUISTE DE LA PAPA Globodera spp EN AMÉRICA DEL SUR [POTATO CYSTNEMATODE Globodera spp. IN SOUTH AMERICA] Ponce,J.F.1 1Fundación PROINPA, Casilla 4285, Cochabamba,Bolivia, E-mail: [email protected]

El cultivo de la papa se realiza bajo un amplio rango de agro-ecologías que supera a otros cultivos de importancia mundial.Entre las limitantes más importantes en la región Andina deLatinoamérica se tiene a Globodera rostochiensis y G. pallida , porsu distribución, existencia de razas patogénicas, diseminación,difícil diagnóstico y las pérdidas económicas que causan. Entrelos estudios más completos efectuados en Latinoamérica enrelación a Globodera están los realizados en Bolivia y Perú, quepor la extrapolación de áreas cultivadas, incidencia yseveridad de daño por nematodos y precio de venta de lostubérculos, han permitido estimar las pérdidas económicasque éstos ocasionan en el valor bruto de la producción depapa. En Bolivia alcanzan a US$ 13’000,000. Durante variosaños se efectuaron muestreos de suelo en diez de losprincipales departamentos andinos productores de papanativa y mejorada en el Perú. Todos los departamentosmostraron la presencia del nematodo quiste de la papa(NQP) y el 64.90 % de las 3299 de muestras analizadas,fueron positivas, El efecto de la incidencia y la severidaddel NQP sobre las pérdidas potenciales en el rendimiento

del cultivo de las papas nativas y mejoradas en la regiónandina de Perú es analizado. La especie dominante fue G.pallida en relación a G. rostochiensis y ambas especies fueronmás frecuentes entre 3,500 y 4,000 masl. . En relación alas pérdidas que ocurren en el Perú, en la mayoría de loscasos se refieren a los causados por G. pallida y se estimanen US$ 128‘000,000. Para implementar un ManejoIntegrado de Globodera spp. se han evaluado diversasalternativas, tales como incorporación de estiércol, materiaverde, extracción de plantas voluntarias. La disponibilidadde líneas o cultivares de cultivos andinos que presenten uncomportamiento diferente en relación a los nematodos,permite que estas líneas puedan ser incorporadas en sistemasde rotación Es así que en esta oportunidad se presentanciertos conceptos sobre la relación parásito-hospedante,entre Globodera spp., con los cultivos andinos en los sistemasagrícolas tradicionales, que además de la papa, incluyen laoca, el isaño o mashua, el olluco o papalisa, la quinua y ellupinus o tarwi, asi como los cultivos introducidos como lacebada, el trigo, el haba.

130 – DIAGNOSTICO DE FITONEMATODOS ASOCIADOS AL CULTIVO DEL PLÁTANO (Musa AABCV. HARTÓN), EN EL BOSQUE HUMEDO TROPICAL, VENEZUELA [DIAGNOSIS OF PLANT-PARASITIC NEMATODES ASSOCIATED WITH PLANTAIN (Musa AAB CV. HARTÓN) IN TROPICAL HUMIDFOREST, VENEZUELA] Labarca, J.1; Casassa-Padrón, A.M.2; Vasquez, L.1; Leal, J.1; Paredes, C.1; Casanova, M.3; Sandoval,L.2 1Universidad Nacional Experimental Sur del Lago. Programa Ingeniería de la Producción Agropecuaria. A. P. 5148;2Universidad del Zulia, Facultad de Agronomía, Instituto de Investigaciones Agronómicas. Maracaibo, ZU4005, Venezuela;3Universidad Centroccidental “Lisandro Alvarado”. Posgrado de Fitopatología. Barquisimeto, estado, Lara, Venezuela. E-mail: [email protected]

Un diagnostico de los principales géneros de nematodosfitoparasíticos asociados al cultivo plátano (Musa AAB cv.Hartón), fue realizado en plantaciones de la zona sur delLago de Maracaibo, bajo condiciones de bosque húmedotropical. Se seleccionaron diez sectores ubicados en losmunicipio Colón y Francisco Javier Pulgar del estado Zulia,Venezuela, representados por treinta unidades deproducción plataneras no tecnificadas, donde se colectaron

muestras compuestas de suelo y raíz. Para la extracción denematodos en suelo se utilizó el método del Cobbmodificado y para las raíces el método del licuado; lalimpieza se realizó con el embudo de Baerman. Los génerosde fitonematodos identificados fueron: Helicotylenchus (68%),Pratylenchus (21%), Radopholus (11%). Es necesario identificarlas especies y determinar el umbral de daño que estosnematodos fitoparasíticos ocasionan al cultivo del plátano.



349

131 – FRECUENCIA DE OCURRENCIA Y NIVELES POBLACIONALES DE NEMATODOSFITOPARASÍTICOS EN PLÁTANO (Musa AAB CV. HARTÓN), EN EL BOSQUE SECO TROPICAL,VENEZUELA [FREQUENCY OF OCCURRENCE AND POPULATION LEVELS OF PLANT-PARASITICNEMATODES IN PLANTAIN (Musa AAB CV. HARTÓN), IN TROPICAL DRY FOREST, VENEZUELA] Labarca,J.1; Casassa-Padrón, A.M.2; Assi, K.A.A.B.1; Guillen, J.1; Paredes, C.1; Pineda, M.1; Casanova, M.3; Sandoval, L.2 1UniversidadNacional Experimental Sur del Lago. Programa Ingeniería de la Producción Agropecuaria. Apdo. postal 5148; 2Universidaddel Zulia, Facultad de Agronomía, Instituto de Investigaciones Agronómicas. Maracaibo, ZU4005, Venezuela; 3UniversidadCentroccidental “Lisandro Alvarado”. Posgrado de Fitopatología. Barquisimeto,estado Lara. Venezuela.Email: [email protected]

Con la finalidad de determinar los niveles poblacionales delos nematodos fitoparasíticos asociados al cultivo de plátano(Musa AAB cv. Hartón), en el bosque seco tropical en elsur del Lago de Maracaibo, Venezuela, se analizaronmuestras compuestas (suelo + raíces), colectadas en sectoresde pequeños productores de plátano. Las muestras de suelofueron procesadas por el método de Cobb modificado ylos nematodos en las raíces se extrajeron por el método demaceración con licuadora. La limpieza se realizó con el

embudo de Baerman. Los géneros de nematodosfitoparasíticos identificados fueron: Pratylenchus (78,96%),Helicotylenchus (20,56%), Radopholus (0,49%), siendo el másfrecuente el género Pratylenchus. Se observaron en las raíceslesiones y zonas necrosadas asociadas a las mayoresdensidades poblacionales de los nematodos identificados.Es importante identificar las especies y realizar las pruebasde patogenicidad de los géneros identificados paradeterminar el umbral de daño en el cultivo del plátano.

132 – AN UPDATE ON THE NEW DISCOVERY OF Globodera pallida IN USA [UMA ATUALIZAÇÃO DANOVA DESCOBERTA DE Globodera pallida NO EUA] Hafez, S.L.1; Sundararaj, P.1 1University of Idaho, Parma Researchand Extension Center, 29603 U of I Ln, Parma, Idaho 83660, USA. E-mail: [email protected]

In 2006 cyst nematodes were discovered in tare dirt at apotato (Solanum tuberosum) processing facility in easternIdaho. The morphology of cysts and second-stage juveniles,together with molecular analyses, established the identityof the species as the pale cyst nematode Globodera pallida(Stone, 1973) Behrens, 1975. This is the first time the palecyst nematode has been found in the United States. G. pallidais a major pest of potato crops in cool-temperate areas. Itprimarily affects plants within the potato family includingtomatoes, eggplants and some weeds. The nematode doesnot pose any threat to human health, but can reduce theyield of potatoes and other crops. Affected potato plantsmay exhibit yellowing, wilting or death of foliage. However,there is no sign that the quality of tubers grown in Idahohas been affected. Regulatory programs were implementedat the positive site designed to prevent the pest’s spread toother fields. Discovery of G. pallida in Idaho was significant

for potato producers and exporters since it can attack thepotato roots and reduce yields by up to 80% and severelyrestrict trade. Early discovery of PCN in Idaho providedthe opportunity to implement an efficient management /elimination program that could minimize future potatoproduction costs and enhance product quality andmarketability. Additional surveillance programs andregulations were implemented to restrict the movement ofplants and soil with appropriate sanitation procedures forequipment used in regulated field to prevent the spread ofthis nematode. Appropriate crop rotation and the use ofcertified seed and nematicides are an effective andpractical strategy to enhance PCN decline rates.Eradication program is under way in the infested fieldsby the use of high rate of soil fumigants and plantingdifferent green manure crops. Potato production isprohibited in the infested fields.

133 – POTATO GOLDEN CYST NEMATODE Globodera rostochiensis: MEXICAN SITUATION ANDCONSEQUENCES OF THE DETECTION OF PALE CYST NEMATODE G. pallida IN THE USA[NEMATOIDES DOURADO DO CISTO DA BATATA Globodera rostochiensis: SITUAÇÃO DO MÉXICO ECONSEQÜÊNCIAS DA DETECÇÃO DO NEMATOIDE PÁLIDO DO CISTO G. pallida NOS E.U.A] Ramirez-Suarez, A.1 1Plant Pathology Department, College of Agriculture and Natural Resources, 411 Plant Science Hall, zip code68583-0722. University of Nebraska-Lincoln, USA. E-mail: [email protected]

The Potato Cyst Nematode Globodera rostochiensis (PCN) isconsidered one of the most important pests in the primary

potato growing regions in Mexico. It is officially present ineight states across the country, each of which are

350 Vol. 33(4) - 2009


characterized by high production of potato for table stockand seed-tuber production. Besides the direct damage PCNcan cause to potato production, once it is present in potatofields, there is also a concern regarding regulatory issuesrelated to the movement of seed-tubers. Considering theimportance of G. rostochiensis, the Mexican ministry ofAgriculture (SAGARPA) has implemented severalphytosanitary measures in order to avoid the introduction,establishment, and spread of PCN into new areas throughMexican Official standards (NOM). So far, based on thesestandards, areas free of PCN have been established: Sonoraand Baja California Sur are the two counties that meet thosestandards. That means they are the only counties allowedto produce, mobilize and export seed-tubers. The potatopale cyst nematode, Globodera pallida (PPCN), is also an

important pest which produces serious yield losses, has ahigh level of aggressiveness on susceptible varieties and ahigh rate of reproduction; it is difficult to manage andcontrol because there are no resistant or tolerant varietiesto deal with this pathogen. During 2006 the PPCN wasdetected in the state of Idaho, which exports a high percentageof the table stock potato to Mexico. The Mexican governmentwas concerned about detection of the nematode, so all thepotato importations from that state were temporarilysuspended in order to keep the status of absence of thisnematode in the country. After an exhaustive analysis ofsampling procedures and all the measures performed by theUSDA in order to confine and eradicate the problem, theimportations from Idaho were allowed again from April 2007,except for potatoes produced in areas affected.

134 – CHARACTERIZATION OF ROOT-KNOT NEMATODE (Meloidogyne spp.) IN PEACH INSOUTHERN RIO GRANDE DO SUL STATE, BRAZIL [CARACTERIZAÇÃO DO NEMATÓIDE DAS GALHAS(Meloidogyne spp.) EM PESSEGUEIRO NA REGIÃO SUL DO RIO GRANDE DO SUL, BRASIL] Gomes, C.B.1;Bianchi V.J.2; Mayer, A.N.1 1Embrapa Clima Temperado, C. P. 403, 96001-970 Pelotas, RS, Brazil; 2Departamento de Botânica,Instituto de Biologia-UFPel, 96010-900 Pelotas, RS, Brazil. E-mail: [email protected]

Considering the economic importance of the peach crop(Prunus persica) and the damage caused by Meloidogyne spp.in orchards in southern Rio Grande do Sul state- Brazil, aroot-knot nematode survey was carried out. TwentyMeloidogyne sp. populations from peach root samplescollected in Pelotas, Capão do Leão and Encruzilhada doSul counties were biochemically characterized by esteraseisoenzyme. M. javanica Est. J3 (Rm: 1.00, 1.21, 1.30) was

the most frequent species and occurred in 85% of thesamples. M. hapla Est. H1 (Rm: 1.17) was detected in 10%of the samples occurring alone or in association with M. javanicaEst. J3. M. incognita Est. I2 (Rm: 1.03, 1.10) was identified inonly one sample. One Meloidogyne atypical population (est. A3;Rm: 1.18, 1.29, 1.40), similar to M. arenaria and M. morociensis,was detected in this study, but it was not possible to identifythe species using only electrophoresis.

135 – UMA CHAVE ILUSTRADA E COMENTADA PARA IDENTIFICAÇÃO DAS ESPÉCIES MAIS COMUNSDE Pratylenchus FILIPJEV DO BRAZIL . [AN ILUSTRATED AND COMMENTED KEY FORIDENTIFICATION OF THE MOST COMMON SPECIES OF Pratylenchus FILIPJEV FROM BRAZIL] Santos, J. M.¹;Gonzaga, V.²; Soares, P.L.M.³ ¹UNESP/FCAV, Departamento de Fitossanidade, 14.884-900 Jaboticabal, SP, Brazil;²EMBRAPA Recursos Genéticos e Biotecnologia, 70.770-900 Brasília, DF, Brasil; ³UNESP/FCAV, Departamento deFitossanidade. E-mail: [email protected]

Os nematóides das lesões radiculares (Pratylenchus spp.) sãoconsiderados o segundo grupo de nematóides de maiorimportância econômica, em termos mundiais. Somente nasduas últimas décadas; quase uma dezena de revisões sobreo grupo foram publicadas. Algumas das cerca de 70 espéciesválidas do grupo têm ampla distribuição geográfica, tantoem regiões temperadas, como em regiões tropicais domundo. O expressivo número de espécies no grupo tornaa taxonomia muito complexa, de modo que a identificaçãode espécies nas análises de rotina em nossos laboratórios étida como um desafio, especialmente no caso do Brasil ondea maioria das espécies do grupo tem importância

quarentenária. De fato, em nossos agroecossistemas, háregistro da ocorrência de apenas seis das espécies válidasdo grupo, a saber: P. brachyurus, P. coffeae, P. jaehni, P. penetrans,P. vulnus e P. zeae. Em relação ao número de anéis na regiãolabial, essas espécies se enquadram em dois grupos. As trêsprimeiras exibem dois anéis e as outras três exibem três ouquatro anéis. No primeiro grupo, P. brachyurus é uma espéciepartenogenética. As fêmeas são desprovidas de espermatecafuncional (contendo espermatozóides) e os machos sãoraríssimos na população. A angulosidade nas laterais daregião labial, nódulos basais do estilete esféricos, forma dacauda predominantemente hemisférica e lisa são



351

características marcantes para identificação da espécie.Pratylenchus coffeae e P. jaehni são espécies anfimíticas. Asfêmeas exibem espermateca funcional e em ambas aspopulações há abundante presença de machos. A forma dacauda de P. jaehni é predominantemente hemisférica e lisaenquanto em P. coffeae há alta freqüência de cauda truncada.Além dessas características, em P. jaehni o estilete < 15,5µm e V% < 79, enquanto em P. coffeae o estilete > 15,5 eV% .> 79. Pratylenchus penetrans e P. vulnus também sãoespécies anfimíticas que exibem abundante presença demachos. Em P. penetrans, a região labial das fêmeas é distinta

(“set off ”) do corpo e a espermateca funcional é esférica,enquanto em P. vulnus, a região labial é contínua com a linhado corpo e a espermateca é oblonga. Comprimento doestilete > 16 µm e número de anéis na cauda < 22 tambémcaracterizam P. penetrans, enquanto estilete < 16 µm enúmero de anéis na cauda > que 22 caracterizam P. vulnus.Em P. zeae não há espermateca funcional, machos são rarose a vulva é mais anterior (V% ~ 70) que nas demais espéciesdesse grupo. Esses dados foram utilizados para elaboraçãode uma chave ilustrada e comentada para identificaçãodessas espécies.

136 – OCCURRENCE OF Aphelenchoides fragariae IN LEAVES OF AZALEA (Rhododendron simsii Planch.)IN BRAZIL [OCORRÊNCIA DE Aphelenchoides fragariae EM FOLHAS DE AZALÉIA (Rhododendron simsii Planch.) NOBRASIL] Ferreira, R.J.¹; Soares, P.L.M.²; Alves, G.C.S.³; Santos, J.M.²; Liebe, M.A.N.4 1Faculdade de Educação São Luis.Jaboticabal, SP, Brazil; 2UNESP/FCAV, Câmpus de Jaboticabal, Departamento de Fitossanidade, Laboratório de Nematologia;³UNESP/FCAV, Câmpus de Jaboticabal; 4Liebe Azaléia: Flores e Plantas. Rodovia Raposo Tavares, km 255, Holambra II,Paranapanema, SP, Brazil. E-mail: [email protected]

The azalea (Rhododendron simsii Planch.) is an ornamentalplant of the family Ericaceae, much cultivated in Brazilthanks to the decorative effect of its flowers. It is plantedin gardens and in pots, indoors. There has been an increasingfocus on ornamental plant health problems, includingnematodes. Recently, in samples of leaves with lesions fromthe town of Paranapanema-SP, sent to the Laboratório deNematologia, Departamento de Fitossanidade UNESP/FCAV, Câmpus de Jaboticabal, there was the presence ofAphelenchoides fragariae. Symptoms on the leaves, consistingof lesions of various sizes, were photographed and aliquotsof 10 g of leaves with lesions were crushed in water inblender. The suspension obtained was centrifuged in

sucrose solution with the addition of kaolin. Suspensionof the nematode was estimated from a population of 1,412specimens of A. fragariae in 10g of leaves with lesions. Themorphometric landmarks for identifying the species havebeen documented with Photonic microscope, using animage acquisition system consisting of a digital camera onan Olympus DP72 microscope of the same make, modelBX50, coupled to a computer. The lesions caused bynematode in leaves of azalea plants in pots make itimpossible to sell the plants and cause severe damage tothe producer. This report constitutes the first record ofthe occurrence of A. fragariae parasitizing leaves of azaleain Brazil.

137 – EFFICACY OF DOSES AND APPLICATION METHODS OF OXAMYL IN THE CONTROL OFTylenchulus semipenetrans ON AN 18-YEAR-OLD CITRUS ORCHARD [EFICÁCIA DE DOSES E MÉTODOSDE APLICAÇÃO DE OXAMIL NO CONTROLE DE Tylenchulus semipenetrans EM POMAR DE CITROS COM 18ANOS] Soares, P.L.M.1; Gonring, A.H.R.2; Ferreira, R.J.4; Santos, J.M.3 1,3UNESP/FCAV, Câmpus de Jaboticabal,Departamento de Fitossanidade, Laboratório de Nematologia; Desenvolvimento DuPont do Brasil, Paulínia,SP, Brazil;3Faculdade de Educação São Luis, Jaboticabal, SP, Brazil; E-mail: [email protected]

The citrus nematode (Tylenchulus semipenetrans) has beenfound in 75% of orchards in the state of São Paulo.Worldwide, nematodes are responsible for average annuallosses of 14.2%. Aiming to mitigate the losses caused bythe citrus nematode, the efficacy was tested of doses andmethods of application of oxamyl (Vydate ® L) in controlof Tylenchulus semipenetrans in commercial orchard of 18-year-old ‘Valencia’ sweet orange, grafted on Rangpur lime,in Itápolis - SP. The treatments were: 1 and 2 oxamyl,commercial product Vydate ® L at doses of 75 and 150

mL of the commercial product (cp)/plant, respectively,applied by “Furrow” (application to track both sides ofthe plants, along the line of planting); treatments 3 and 4correspond to the doses of 75 and 150 mL cp/plant,respectively, applied through Drip (simulation of drip onboth sides of the plants towards the row, under theprojection of the crowns of trees); 5 and 6 correspondingto doses of 75 and 150 mL cp/plant, respectively, appliedby Drench (squirting the product at the base of the plants).Treatment 7 (standard) was formed by aldicarb, applied at

352 Vol. 33(4) - 2009


a dose of 130 g/plant of the commercial product Temik ®150 GR and 8 was the control treatment without applicationof any product. The experimental plot was composed offive plants and the three central portions of the floor areawere considered. The experimental design was arandomized block with eight treatments and fourreplications. We evaluated the population of the nematodein the soil and roots before the application of treatmentsand at 30, 60, 90 and 120 days after treatment. On 16/01/2008 a preliminary sampling of soil and roots took place.Then there was a application of the different treatmentsunder evaluation. About 60 days after the first applicationthe second application was made. For the standard

treatment, the application was performed once at the firstapplication. The production was also evaluated for elevenmonths after the first application. Both in the soil and roots,the treatments with oxamyl (Vydate L), corresponding todoses of 34 and 68 L of commercial product / ha (75 and150 mL / plant), applied either by Furrow, Drip or Drenchin two applications, and treatment with aldicarb, commercialproduct Temik 150 GR, at a dose of 130 g/plant in a singleapplication, provided averages of more than 70% of controlof T. semipenetrans, in at least one of the periods. Alltreatments with oxamyl (Vydate L) provided measuredincreases in production. For the control the increase of58% was obtained with aldicarb.

138 – INCIDENCIA DEL GRANO DEL BETABABEL (Beta vulgaris L.) UNA NUEVA ENFERMEDADPOR Nacobbus aberrans EN EL VALLE DE TEPEACA, PUEBLA, MEXICO [EFFECT OF BETABABELGRAIN (Beta vulgaris L.), A NEW DISEASE CAUSED BY Nacobbus aberrans IN THE TEPEACA VALLEY, PUEBLA,MEXICO] Soto, A.T.1; Magaña-Alvarez, E.1; Torres-Coronel, R.1 1Laboratorio de Nematología Agrícola, Depto. deParasitología, Escuela Nacional de Ciencias Biológicas-IPN. Carpio y Plan de Ayala S/N, Col. Santo Tomás, C. P. 11340,México, D.F. E-mail: [email protected]

El betabel (Beta vulgaris L.) es una hortaliza cultivada en elValle de Tepeaca en el estado de Puebla, en la mesa centralde la república mexicana una importante zona deproducción, acopio y distribución de hortalizas. En estazona se siembran alrededor de 150,000 ha cada año. Hacevarios años en esta zona se viene presentando en el cultivode betabel una nueva enfermedad conocida por losagricultores como “grano del betabel” debido a la presenciade lesiones tipo grano o mezquino en todo el cuerpo de laraíz, sin que a la fecha se conozca el agente causal de lamisma. Objetivo: identificar el agente causal de estaenfermedad, así como evaluar a nivel de campo la incidenciaque la misma presenta en la zona de estudio. En el 2008, seefectuó una exploración nematológica en los municipiosde Acatzingo, Los Reyes de Juárez, Quecholac y Palmar deBravo, los que conforman parte del Valle de Tepeaca,Puebla. Se muestrearon en total 58 campos sembrados condiferentes hortalizas, de los que 12 correspondieron abetabel. En cada campo seleccionado se tomaron 10submuestras de suelo (100-150 g) y plantas (15 plantas) losque se colocaron en una bolsa de polietileno para conformarla muestra representativa. En el laboratorio, las raíces decada muestra se separaron y se lavaron con agua corriente

para eliminar el suelo adherido, luego se contaron el totalde plantas sanas y enfermas, lo que sirvió para evaluar laincidencia de la enfermedad. A una parte de las raícesenfermas de betabel se les quitó la (epidermis) cáscara laque se tiñó con fucsina-lactoglicerol. La otra parte delmaterial se licuó ligeramente con agua, el material trituradose pasó por tamices de 50, 100, 200 mallas con la finalidadde retener algún organismo presente. Con el suelo se llevóa cabo la extracción para nematodos filiformes utilizandola técnica de tamizado-centrifugado y flotación. Tanto laepidermis teñida de betabel, como el material obtenido dellicuado, se revisaron al esteriomicroscopio y en ambos seencontró la presencia de hembras blanquecinas y dejuveniles J3 y/o J4 que por las características morfológicasy morfométricas más sobresalientes donde destacan: forma,longitud, tipo de estilete, posición de la vulva, tipo de cauda,fueron identificados como Nacobbus aberrans. En algunasmuestras de suelo aparecieron los machos del mismonematodo, lo que confirmó la identificación. La incidenciade la enfermedad varió de 0 a 100%, lo que representa unserio problema para los agricultores de la zona. El 66 % delos campos de betabel muestreados en la zona de estudiopresentaron esta enfermedad.



353

139 – EFFECT OF SOIL COMPACTION ON THE COMMUNITY OF EDAPHIC NEMATODESACCORDING TO DEPTH [EFEITO DA COMPACTAÇÃO DO SOLO NA COMUNIDADE DE NEMATÓIDESEDÁFICOS DE ACORDO COM A PROFUNDIDADE] Cadioli, M.C.1; Santiago, D.C.1; Baida, F.C.1; Guimarães, M.F.1;Colombano, L.P.1; Arieira, G.O.1; Pereira, R.F.G.1; Sbrussi, C.A.G.1 1Universidade Estadual de Londrina, Departamento deAgronomia, C. P. 6001, 86051-990 Londrina, PR, Brazil. E-mail: [email protected]

A compactação é um dos principais problemas do Sistemade Semeadura Direta. Os organismos do solo são afetadospela compactação e seus efeitos e pela quantidade dematerial orgânico disponível. A fauna do solo, em diferentesgraus de intensidade, é afetada pelos impactos provocadospelas práticas agrícolas, devido às modificações naspropriedades deste. Os nematóides e suas populaçõespresentes no solo se apresentam como uma ferramentaimportante para estudos ecológicos. Assim, o objetivo destetrabalho foi avaliar as modificações na comunidade denematóides, de acordo com a profundidade, decorrentesdo tráfico agrícola em Sistema de Semeadura Direta. Oexperimento foi conduzido em Londrina, PR, em umLatossolo Vermelho distroférrico (LVd) argiloso, emSistema de Semeadura Direta (SSD). Realizou-se, emcondições de elevada umidade do solo, tráfego intenso demáquinas para favorecer a compactação nas áreas. A parcelaútil tinha 5 m de largura e 25 m de comprimento. Foramcoletados seis monólitos de 0,25 x 0,25 x 0,30m, obtendo-se amostras nas profundidades de 0-10, 10-20 e 20-30cm.As amostras foram clarificadas pelo método de flotaçãocentrífuga em solução de sacarose e os nematóides extraídos

foram identificados e quantificados em microscópio ótico.Foram identificados oito gêneros de nematóides de todosos grupos tróficos. Bacteriófagos dos gêneros Rhabditis eCruznema dominaram as comunidades, independente daprofundidade analisada. Fitófagos do gênero Helicotylenchuse predadores/onívoros do gênero Seinura também forambastante abundantes nas amostras avaliadas. Independentedo grupo trófico ou do gênero, a camada de 10-20cm foi aque apresentou a maior abundância total de nematóides..As populações de nematóides apresentaram a menorpopulação na profundidade de 20-30cm, com exceção dogênero Rhabditis, que são nematóides relacionados com oteor de matéria orgânica da área. A via prevalente dedecomposição de matéria orgânica foi sempre representadapor nematóides de vida-livre, do grupo dos bacteriófagos.Como é sabido que as populações de nematóides tendem ase concentrar nas camadas até cerca de 20cm, pode-se notarque o tráfego de máquinas interferiu de forma significativana comunidade de nematóides superficialmente e sub-superficialmente. Entretanto, nas camadas mais inferiores,principalmente de 10-20cm, a ação da compactação foimenor, mantendo a comunidade com altas abundâncias.

140 – RECORD OF THE OCCURRENCE AND SURVIVAL OF Pratylenchus brachyurus ON PEANUTSHELLS IN MATO GROSSO [REGISTRO DA OCORRÊNCIA E SOBREVIVÊNCIA DE Pratylenchus brachyurus EMCASCAS DE AMENDOIM NO MATO GROSSO] Ferreira, R.J.¹; Soares, P.L.M.²; Becaro, C.K.³; Santos, J.M.²; Teixeira,G.C.4 ¹Faculdade de Educação São Luís, Jaboticabal; ²UNESP/FCAV, Campus de Jaboticabal, Departamento de Fitossanidade,Laboratório de Nematologia; ³UNESP/FCAV; 4YOKI, Rod. MT 235, KM 4, Campo Novo do Parecis, MT, Brazil. E-mail:[email protected]

Pratylenchus brachyurus exhibits broad host range and hascaused severe damage to extensive crops in different regionsof Brazil, such as soybean, cotton, corn and peanut. In theseason 2008/2009 in the new Geo-economics field atParecis-MT, the cultivation of peanut, preceded by a corncrop, recorded losses of up to 30% on the contiguous area,planted with Crotalaria spectabilis. Recently, we found thetypical symptoms of injuries caused by this nematode, inthe shells of the peanut pods cv. Tatu ST in a sample derivedfrom the food industry in the region of Sapezal - MT, whichare generally used as organic amendment by producers inthe region. The pods were dried in the sun for fiveconsecutive days. Symptoms were documented and in 10 gof shells processed by centrifugal flotation in sucrose

solution with kaolin 15,900 eggs and active forms of thenematode were found. The suspension was adjusted to 318eggs and active forms per mL and 10 mL / plant wasinoculated in five soybean plants cv. BRS Vencedora 68, intrays with substrate, transplanted into individual pots. About90 days after inoculation the roots were processed separately,following the methodology mentioned above, and thepopulation was estimated with an average of 8992 eggsand active forms / root system of P. brachyurus. Therefore,the result observed showed that the population of P.brachyurus can infect roots of any plant host where the shellsare added to the infected soil. So it is not recommended touse these shells as an organic amendment, as these mayserve to spread P. brachyurus.

354 Vol. 33(4) - 2009


141 – OCORRÊNCIA DE NEMATOIDES EM POMARES DE CITROS NO ESTADO DE SÃO PAULO[OCCURRENCE OF NEMATODES IN CITRUS ORCHARDS IN SÃO PAULO STATE] Neves, S.S.¹; Alves, G.C.S.2;Soares, P.L.M.3; Santos, J.M.² 1UNESP/FCAV, Câmpus de Jaboticabal, Departamento de Fitossanidade, Laboratório deNematologia; 2UNESP/FCAV; 3UNESP/FCAV, Campus de Jaboticabal, SP, Brasil. Departamento de Fitossanidade,Laboratório de Nematologia. E-mail: [email protected]

Foi feito um levantamento consultando os arquivos doLaboratório de Nematologia do Departamento deFitossanidade da UNESP/FCAV, Câmpus de Jaboticabal-SP, no que diz respeito aos resultados de análisesnematológicas realizadas pelo referido laboratório noperíodo de 2005 a 2008, com amostras de solo e raízesenviadas, coletadas em pomares de citros. As amostras desolo foram processadas pelo método da flotação centrífugaem solução de sacarose e as raízes, pelo método da flotaçãocentrífuga em solução de sacarose com adição de caulim.A estimativa das subpopulações das espécies presentes nasamostras, foi realizada com o auxílio de um microscópiofotônico e uma câmara de contagem de Peters. Foramanalisadas 132 amostras, sendo que em 119 coletadas, foiencontrada pelo menos uma espécie de nematóide deimportância econômica para a cultura, todas no Estado deSão Paulo, de vários Municípios, a saber: Altair, Analândia,Araraquara, Araras, Artur Nogueira, Bauru, Boa Esperança

do Sul, Cajobi, Cândido Rodrigues, Dobrada, Holambra,Ibitinga, Irapuã, Itápolis, Jales, Monte Alto, Monte AzulPaulista, Olímpia, Pirangi, Pongaí, Ribeirão Bonito, SantaRosa do Viterbo, Socorro, Santa Rita do Passa Quatro,Taquaral, Taquaritinga e Vista Alegre do Alto. Em 97,5%das amostras, foi encontrado o nematóide dos citros(Tylenchulus semipenetrans) nos Municípios de Altair,Analândia, Araraquara, Araras, Artur Nogueira, BoaEsperança do Sul, Cajobi, Cândido Rodrigues, Dobrada,Holambra, Ibitinga, Irapuã, Itápolis, Monte Alto, MonteAzul Paulista, Olímpia, Pirangi, Pongaí, Ribeirão Bonito,Santa Rosa do Viterbo, Socorro, Santa Rita do Passa Quatro,Taquaral, Taquaritinga e Vista Alegre do Alto. Em 0,84%das amostras, foi encontrado apenas Pratylenchus jaehni noMunicípio de Itápolis. A partir desses dados, conclui-se queT. semipenetrans foi a espécie que ocorreu com maiorfreqüência nas amostras e que está mais distribuído do queP. jaehni em pomares de citros no Estado de São Paulo.

142 – CONTRIBUTION TO THE STUDY OF THE RED RING NEMATODE IN THE STATE OF ALAGOAS,BRAZIL [CONTRIBUIÇÃO AO ESTUDO DO NEMATÓIDE DO ANEL VERMELHO NO ESTADO DEALAGOAS, BRASIL] Duarte, A.G.1; Lima, I.S.1; Júnior, J.V.A.1; Duarte, A.G.1; Albuquerque, A.L.S.1; Cruz, M.M.1 1Centrode Ciências Agrárias/UFAL. BR 104 Norte, Km 85, 57100-000 Rio Largo, AL, Brazil. E-mail: [email protected]

The contribution of this study was to determine the levelsof Rhynchophorus palmarum adults contaminated byBursaphelenchus cocophilus and to investigate how the red ringnematode is distributed inside the diseased plant. Trapsbaited with the aggregation pheromone and pieces of sugarcane were set up in five municipalities, Coruripe, MarechalDeodoro da Fonseca, Maceió, Barra de Santo Antônio andSão Miguel dos Milagres. From Coruripe, 30.15% of theweevils were contaminated by B. cocophilus and 23.13 % ofthe weevils collected in Marechal Deodoro werecontaminated. Weevils collected in Maceió showed 37.34%of contamination. In Barra de Santo Antônio, the level ofcontamination was 48.03% and in São Miguel dos Milagres56.94% of the weevils were contaminated. The meannumber of nematodes per weevil that were collected inSão Miguel dos Milagres was significantly higher than themean number of weevils found in any other place. It wasverified that 12.53%; 8.24%; 17.85%; 20.39% and 27.78%

of the weevils from Coruripe, Marechal Deodoro daFonseca, Maceió, Barra de Santo Antônio and São Migueldos Milagres, respectively, would be able to act as vectorsof red ring disease in the State of Alagoas. In samples ofthe roots collected at the base of the stem, the number ofnematodes was considerably higher when compared to thenumber found in the roots collected between one and threemeters away from the stem. It is suggested that the chancesof transmission of the disease through the roots areminimal. In the apex of the stem it is possible to find thenematode also in discolored apparently healthy areas. Inthe tissues of the petioles, nematodes were found in smallamounts. Disinfecting scythes during the harvest isrecommended to decrease transmission of the disease. Thepopulation of nematodes is higher in the excrement oflarval tunnels at the apex of the plant, which provide higherchances of being transported by its vector from one plantto another.



355

143 – OCORRÊNCIA DO NEMATÓIDE DO ANEL VERMELHO DO COQUEIRO EM PETROLINA – PE[OCCURRENCE OF THE RED RING NEMATODE IN PETROLINA COUNTY, PERNAMBUCO STATE, BRAZIL]Castro, J.M.C.1; Santana, T.A.S.1; Muniz, M.F.S.2; Lima, C.R.F.3 1Embrapa Semi-Árido, C. P. 23, 56302-970 Petrolina, PE,Brazil; 2Universidade Federal de Alagoas, Centro de Ciências Agrárias 57100-000, Rio Largo, AL, Brazil; 3PLANTEC/CODEVASF, Vila CS1, Distrito de Irrigação Projeto Senador Nilo Coelho, 56300-990 Petrolina, PE, Brazil. E-mail:[email protected]

No Submédio do Vale do São Francisco, principalmenteno município de Petrolina, cerca de 2500 ha são ocupadoscom a cultura do coqueiro. Nesse município, apenas noProjeto de Irrigação Senador Nilo Coelho, 700 ha sãocultivados com esta palmácea. Em fevereiro de 2009, onematóide Bursaphelenchus cocophilus foi encontradoparasitando coqueiros (Cocos nucifera L.) da cultivar anão-verde, com cerca de um ano e meio de idade, em duaspropriedades, no município de Petrolina-PE. Nos tecidos

do estipe, encaminhados ao Laboratório de Nematologiada Embrapa Semi-Árido, foi observado o sintoma internocaracterístico da doença constituído pelo anel de coloraçãopardo-avermelhada. Quando esses tecidos foram colocadosem um béquer com água por períodos de 12 a 24 horas, foramextraídos vários nematóides extremamente móveis,caracterizados por um corpo delgado e longo, com esôfagodo tipo afelencóide. Esta é a primeira constatação do nematóidecausador do anel vermelho do coqueiro em Petrolina-PE.

144 – ADDITIONAL INFORMATION ON AN ATYPICAL POPULATION OF Meloidogyne exigua GÖLDI,1887 (TYLENCHIDA: MELOIDOGYNIDAE), PARASITIZING RUBBER TREE IN BRAZIL [INFORMAÇÃOADICIONAL SOBRE UMA POPULAÇÃO ATÍPICA DE Meloidogyne exigua GÖLDI, 1887 (TYLENCHIDA:MELOIDOGYNIDAE), PARASITANDO SERINGUEIRA NO BRASIL] Muniz, M.F.S.1; Campos, V.P.2; Almeida,M.R.A.3; Gomes, A.C.M.M.3; Santos, M.F.A.3; Mota, F.C.3; Carneiro, R.M.D.G.3 1UFAL, Centro de Ciências Agrárias, BR104 Norte Km 85, 57100-000 Rio Largo, AL, Brazil; 2UFLA, Departamento de Fitopatologia, C. P. 3037, 37200-000Lavras, MG, Brazil; 3EMBRAPA/CENARGEN, C. P. 02372, 70849-970 Brasília, DF, Brazil. E-mail: [email protected]

Females, males and second-stage juveniles of an unusualpopulation of Meloidog yne exigua race 3 that onlyparasitizes the rubber tree were examined by light andscanning electron microscopy. Previous molecularcharacterizat ion, using SCAR markers, showedconsistency with other M. exigua populations from coffee.However, RAPD analysis showed high polymorphism(43.1 – 57.8%) but with 100% bootstrap support amongpopulations from coffee and rubber tree. In addition,this population showed the main M. exigua esterase band

(Rm: 1.5) and an additional band (Rm: 1.6) not detectedin the coffee population. The morphology of this atypicalpopulation was very close to M. exigua from coffee inmajor diagnostic characters such as perineal pattern andmale head region. However, minor differences occurredin morphological and morphometric features, particularlyin the female and male stylet morphology. Cytogeneticstudies confirmed the occur rence of meioticparthenogenesis with haploid chromosome number (n= 18). Support: Fapeal

145 –PARASITISM OF Meloidogyne spp. ON NATIVE PLANTS FROM FORESTS OF WESTERN PARANÁ,BRAZIL [PARASITISMO DE Meloidogyne spp. EM PLANTAS NATIVAS DE FLORESTAS DO OESTE DO PARANÁ,BRAZIL] Fiorentin, F.1; Antes, V.A.1; Furlanetto, C.2; Dildey, O.1; Casagrande, C.1; Cruz, M.I.F.1 1Universidade Estadual doOeste do Paraná, C. P. 91, 85.960-000 Marechal Cândido Rondon, PR, Brazil; 2Universidade de Brasília, Departamento deFitopatologia, 70.910-900 Brasília, DF, Brazil. E-mail: [email protected]

Meloidogyne spp. are the main plant-parasitic nematodes inthe world, showing a wide distribution and a large hostrange. In Western Paraná, Brazil, Meloidogyne species areimportant parasites of crops. However, there are no studieson the parasitism of this genus on native plants. Consideringthe importance of this nematode to the region, this workaimed at studying the parasitism of Meloidogyne spp. on nativeplants commonly found in forests of Western Paraná, Brazil.

Forty-one species of native plants, up to 30 cm in height,were collected in a nursery and examined for galls on theirroot system. Meloidogyne species were identified by perinealpattern and esterase phenotype. Plants that did not showany galls were inoculated with 5000 eggs and/or J2 of afield population of M. incognita and evaluated sixty days afterinoculation (dai) based on the number of galls per rootsystem and reproduction factor (RF) on hosts. From 41

356 Vol. 33(4) - 2009


native plants assessed, 08 species showed natural infectionby Meloidogyne incognita and M. javanica. Meloidogyne incognitawas found on the root system of Lonchocarpus campestris(Rabo-de-bugio), Croton urucurana (Sangra d’água), Tabebuiaochracea (Ipê Amarelo), Diplokeleba floribunda (Farinha seca)and Cariniana rubra (Jequitibá), while Meloidogyne javanica wasfound on Cordia ecalyculata (Café-de-bugre), Citharexyllummyrianthum (Tarumã- branco) and Apidosperma cylindrocarpon

(Guatambu–vermelho). No natural infection was detectedon thirty-three native species, which were inoculated withMeloidogyne incognita. However, four plant species showedgalls on the root system that ranged from 13 to 212 andreproduction factors (RF) as follows: Genipa americana(Jenipapo) – RF = 0.9, Schinus terebinthifolius (AroeiraVermelha) – RF = 4.1, Rollinia mucosa (Ariticum comum) –RF = 2.4 and Tabebuia impetiginosa (Ipê Roxo) – RF = 2.5.

146 – ETIOLOGIA DA CASCA PRETA DO INHAME NO ESTADO DE ALAGOAS [ETIOLOGY OF DRY ROTOF YAM IN ALAGOAS STATE, BRAZIL] Muniz, M.F.S.1; Silva, E.J.1; Castro, J.M.C.2; Alencar. L.M.C.3; Martins, A.G.11Universidade Federal de Alagoas, Centro de Ciências Agrárias, BR 104 Norte Km 85, 57100-000 Rio Largo, AL, Brazil;2Embrapa Semi-Árido, C. P. 23, 56302-970 Petrolina, PE, Brazil; 3Secretaria de Agricultura do Estado de Alagoas, R.Cincinato Pinto, 348, Centro, 57020-050 Maceió, AL, Brazil. E-mail: [email protected]

A cultura do inhame (Dioscorea sp.), no nordeste brasileiro,tem grande importância econômica e social, especialmentepara os Estados da Paraíba, Pernambuco e Alagoas,principais produtores nacionais. Dentre os problemasfitossanitários da cultura no Brasil, a casca preta ou podridãoseca, causada pelos nematóides Scutellonema bradys,Pratylenchus coffeae ou P. brachyurus destaca-se como o maisimportante. Apesar da constatação, em Alagoas, da cascapreta causada por S. bradys, há necessidade da atualizaçãodas informações sobre a doença uma vez que mais de umaespécie de nematóide encontra-se a ela associada. Para isso,efetuou-se um levantamento da doença em 2009 em onzemunicípios produtores do Estado: Paulo Jacinto, Chã Preta,Viçosa, Atalaia, Quebrangulo, Mar Vermelho, Cajueiro eJoaquim Gomes (Mata Alagoana), Taquarana, São Sebastiãoe Arapiraca (Agreste). Em cada município, foramselecionadas de uma a seis propriedades com histórico dadoença. A avaliação da incidência da doença (porcentagem

de túberas com sintomas da casca preta) foi efetuada porocasião da colheita em relação a 100 túberas. Nos casos emque a colheita já havia sido efetuada e as túberasencontravam-se armazenadas, anotava-se a informação doprodutor. Foram coletadas túberas infectadas, quetotalizaram 39 amostras. Para a extração dos nematóides,as túberas foram lavadas com água corrente retirando-seem seguida as cascas, formando uma amostra composta,da qual foram retiradas alíquotas de 100 g/amostra eprocessadas pelo método do liquidificador e centrifugaçãoem solução de sacarose e caulim. Após a extração, osnematóides foram mortos e fixados em formaldeído 4%aquecido e armazenados. Observação importante, nopresente trabalho, foi a ocorrência de S. bradys e Pratylenchussp. na mesma área, na maioria das amostras. A incidênciada casca preta atingiu valores de até 85%, o que reflete agrande importância econômica da doença nas áreasprodutoras de Alagoas.

147 –LEVANTAMENTO POPULACIONAL DE NEMATÓIDES EM ÁREAS DE CULTIVO DEOLERÍCOLAS EM BOTUCATU, SP [NEMATODE POPULATIONAL SURVEY ON VEGETABLECULTIVATION AREAS IN BOTUCATU] Rosa, J.M.O.1; Westerich, J.N.1; Wilcken, S.R.S.1 1FCA/UNESP, Departamentode Produção Vegetal/Defesa Fitossanitária, C. P. 237, 18610-307 Botucatu, SP, Brazil. E-mail: [email protected]

O cultivo sucessivo de olerícolas numa mesma áreaproporciona o agravamento de problemas fitossanitários,dentre eles os nematológicos. A fim de conhecer a incidênciade nematóides fitoparasitos em áreas de produção deolerícolas na região de Botucatu, foi desenvolvido o presentetrabalho. Foram realizados levantamentos nematológicosem 14 propriedades com áreas de cultivo de diferentesolerícolas. Em cada propriedade foram amostradasdiferentes áreas de cultivos, sendo retirada 03 subamostraspara compor 01 amostra de solo e raiz. As amostras foramacondicionadas em sacos plásticos devidamente

identificados e mantidas em caixa de isopor até seremencaminhadas ao laboratório de Nematologia Agrícola daFaculdade de Ciências Agronômicas/ UNESP - Câmpusde Botucatu. As amostras foram processadas seguindo ométodo proposto por Coolen e D’Herde para análise dasraízes e o método de Jenkins para análise do solo. Aidentificação dos nematóides nas suspensões foi efetuadacom o auxílio da lâmina de Peters, sob microscópio óptico.De acordo com os resultados obtidos no processamentode solo, das 14 propriedades amostradas, 43% apresentaraminfestação com nematóides das galhas, 71% apresentaram



357

nematóides espiralados, 7% nematóides das lesões e 21%Paratrichodorus. Em todas as propriedades foram encontradosnematóides de vida-livre no solo. Os resultados obtidosdo processamento de raiz mostraram que 43% das

propriedades amostradas apresentaram nematóides dasgalhas, 50% nematóides espiralados, 14% nematóides daslesões e 7% nematóides anelados. Dentre essas, 79% daspropriedades apresentaram nematóides de vida-livre na raiz.

148 – DINÂMICA POPULACIONAL DE NEMATÓIDES PATOGÊNICOS AO INHAME E A MANDIOCANO RECÔNCAVO DA BAHIA [POPULATION DYNAMICS OF NEMATODES PATHOGENIC TO YAM ANDCASSAVA IN THE RECÔNCAVO REGION OF BAHIA STATE] Almeida, N.S.1; Carmo, D.O.1; Santana, M.G.1; Souza,J.T.1 1Universidade Federal do Recôncavo da Bahia, UFRB, Laboratório de Fitopatologia e Microbiologia, CCAAB, 44380-000 Cruz das Almas, Email: [email protected]

O inhame (Dioscorea rotundata) e a mandioca (Manihotesculenta) são culturas suscetíveis ao ataque de diversasespécies de nematóides. Os objetivos deste trabalho foramavaliar a dinâmica populacional dos nematóides patogênicosao inhame e a mandioca em quatro áreas localizadas noRecôncavo da Bahia. As populações de Scutellonema bradys,Meloidogyne spp., Pratylenchus spp. e Rotylenchulus reniformesforam avaliadas por um período de dois anos. As populaçõesde R. reniformis variaram de 39 a 1587 nematóides/g de solo,as de Meloidogyne spp. variaram de 1 a 90 nematóides/g desolo e raízes, as populações de Pratylenchus spp. variaram de1 a 119 nematóides/g de raiz, enquanto que as de S. bradysvariaram de 1 a 46 nematóides/g de solo e raízes. Apesardas populações de S. bradys terem sido baixas em solo eraízes, esse nematóide é considerado como o maisimportante para o cultivo do inhame no Recôncavo daBahia, pois é responsável por danos aos rizóforos. Outrosgêneros de nematóides detectados nas áreas de cultivo deinhame e mandioca foram: Criconemella, Tylenchus, Aphelenchus,Xiphinema, Aphelenchoides e Helicotylenchus. Avaliou-se também

a dinâmica populacional de S. bradys em rizóforos-sementeinfectados e armazenados por 0, 30, 60 e 90 dias. Aspopulações de S. bradys em rizóforos infectados variaramde 1392 a 5858 nematóides, incluindo ovos, por grama decasca e polpa de rizóforo. As porcentagens médias dosestádios do nematóide foram: 16,4% de fêmeas, 45,6% dejuvenis, 27,7% de ovos e 10,3% de machos,independentemente dos períodos de armazenamento. Aspopulações aumentaram nos períodos de 0 a 30 dias dearmazenamento, quando atingiram os valores máximos edecresceram a partir daí, atingindo os menores valores aos90 dias de armazenamento, quando os rizóforosencontravam-se deteriorados. Estudos sobre asobrevivência de S. bradys em solo, areia e plantmaxdemonstraram que o nematóide sobreviveu por 128 diasem substrato úmido e por no máximo 24 horas em soloseco. Esses resultados demonstraram que S. bradysapresenta maior importância quando associado aosrizóforos de inhame e que apresenta baixa sobrevivênciano solo.

149 – POPULAÇÃO DE NEMATÓIDES EM GENÓTIPOS DE ACEROLEIRA ADUBADOS COM RESÍDUOSORGÂNICOS [POPULATION OF NEMATODES IN GENOTYPES OF ACEROLA FERTILIZED WITHORGANIC RESIDUES] Luquine, L.S.¹; Ritzinger, R.²; Ritzinger, C.H.S.P.²; Vieira, R.S.¹; Jesus, F.N.¹ ¹UFRB, Cruz dasAlmas, BA, Brazil; ²Embrapa Mandioca e Fruticultura Tropical, C.P.007, Cruz das Almas, BA, Brazil. E-mail:[email protected]

O interesse na utilização de resíduos agrícolas temaumentado consideravelmente, não somente pela questãoambiental, mas também pela busca de alternativas quepossam favorecer a sustentabilidade do agroecossistema.O trabalho foi realizado em plantas das variedades Rubra,CMF03-10 e CMF05-1 na área experimental da EmbrapaMandioca e Fruticultura Tropical, objetivando avaliargenótipos de aceroleira em sistema orgânico de produção.Utilizou-se o delineamento experimental em blocoscasualizados em três repetições. As parcelas foramsubdivididas, constando de três genótipos de aceroleira equatro tratamentos: sem adubo e fertilização orgânica com

manipueira, urina de vaca e torta de mamona, aplicadosem cobertura a cada dois meses. Avaliaram-se as populaçõesde nematóides inicial e após a quinta aplicação. Dentre osfitonematóides identificados nas análises, a maior populaçãoverificada foi a de Rotylenchulus reniformis. Na segunda análise,observou-se um aumento na população dos nematóides devida livre. Os nematóides de vida livre podem ser utilizadoscomo indicadores de sustentabilidade no solo, o que podeservir para avaliar o manejo orgânico. O genótipo CMF03-10 sob os tratamentos com urina de vaca e torta de mamonaapresentou maior população dos nematóides de vida livre.A menor população desses nematóides ocorreu no genótipo

358 Vol. 33(4) - 2009


CMF05-1, no tratamento com urina de vaca, e na Rubrasob o tratamento com manipueira. Nos três genótiposavaliados, a maior quantidade e maior peso de frutos

ocorreu nos tratamentos sob torta de mamona,possivelmente, devido ao efeito fertilizante da torta demamona.

150 – LEVANTAMIENTO Y CARACTERIZACIÓN ISOENZIMÁTICA DE Meloidogyne spp. ENFRUCTÍFEROS DEL NOROESTE DEL PARANÁ [ISOENZYMATIC SURVEY AND CHARACTERIZATIONOF Meloidogyne spp. ON FRUIT TREES IN NORTHWESTERN PARANÁ STATE] Barizão, D.A.O.1; Dias-Arieira,C.R.1; Formentini, H.M.2; Furlanetto, C.2; Biela, F.1; Santana, S.M.1 1Universidade Estadual de Maringá, Campus Regionalde Umuarama, C. P. 65, 87501-970 Umuarama, Paraná, Brazil; 2Universidade Estadual do Oeste do Paraná, C. P. 1008,85960-000 Marechal Candido Rondon, Paraná, Brazil. E-mail: [email protected]

Nematodos agalladores causan perjuicio considerables endiversas especies de fructíferos, como ananás, acerola,banana, guayaba, entre otras. Su control es complejo y laidentificación de la especie ocurrente es un de los pasosmás importantes para la adopción de medidas correctasde manejo. Así, se objetivo realizar el levantamiento deMeloidogyne spp. en áreas de cultivo de fructíferos en suelosarenosos de la región noroeste del Parana, Brasil. Para esto,fueron colectadas 123 muestras de suelo de 17 especies defructíferos, en 14 municipio de la región. Parte del materialfue procesada para extracción de nematodos de suelo y deraíces, siendo las muestras obtenidas evaluados enmicroscopio estereoscopio, en cámara de Peters. El restantedel material fue depositado en recipientes de 1 litro,recibiendo una muda de tomate cv. Santa Cruz, y fuemantenido en casa de vegetación por ses meses.

Posteriormente, se evaluó la raíz cuanto a la presencia deagallas. Raíces síntomaticas fueron desecar para retiradadirecto de las hembras, siendo las mismas sometidas a laelectroforesis de isoenzima esterase para caracterización delas especies. Constatarse infección por Meloidogyne spp. en10 tipos de fructiferas, siendo M. ingognita la especiepredominante. Meloidogyne javanica fue detectar en muestras deplátano y Citrus sinensis (variedad Pêra e Valência). Ya M. incognitaestuve presenta en las muestras de ananás, acerola, banano,caqui, higo, uva, C. sinensis (Valência e Folha Murcha), C.reticulata, C. latifolia e C. deliciosa. No fue constactada la presenciade esta especies en aguacate, coco, guayaba, manzana, mango,maracuyá y piña. Las mayores problaciones observadas en ellevantamiento fueron para las culturas del higo y caqui, siendorecuperado 101 y 92 espécimen en 100 cm3 de suelo y 852 y554 espécimen en 10 g de raíz, respectivamente.

151 – TAXONOMIC STUDY OF PHYTONEMATODES IN SEEDS OF FORAGE GRASSES, HOST-PATHOGEN INTERACTIONS AND ASSOCIATED FUNGI [ESTUDO TAXONÔMICO DEFITONEMATÓIDES EM SEMENTES DE GRAMÍNEAS FORRAGEIRAS, INTERAÇÕES PATÓGENO-HOSPEDEIRO E FUNGOS ASSOCIADOS] Favoreto, L.¹; Santos, J.M.1; Calzavara, S.A.1; Barbosa, J.C.2 Lara, L.A.31Departamento de Fitossanidade, Laboratório de Nematologia 2Departamento de Ciências Exatas, UNESP/FCAV, Campusde Jaboticabal; 3Departamento Técnico da Indústria e Comércio de Sementes Matsuda Ltda., Álvares Machado, SP, Brazil.E-mail: [email protected]

Brazil is the world leader in production, consumption andexport of forage grass seeds. Species of Aphelenchoides andDitylenchus can infect and/or infest those seeds in Braziland this problem has raised quarantine concerns incustomer countries. This study was carried out with theobjectives of identifying the species of phytonematodes,as well as fungus genera in samples of forage grass fromthe States of São Paulo, Minas Gerais, Mato Grosso, Bahiaand Goiás. Samples of seeds from these states were takenat the plant of Indústria e Comércio de Sementes MatsudaLtda., in Álvares Machado, SP and transported to theLaboratório de Nematologia at UNESP/FCAV,Jaboticabal Campus . The nematodes were extractedfrom aliquots of 10g of each sample by the technique

of centrifugal flotation in sugar solution with kaolin, andall populations were raised axenically in Petri dishes oncultures of Fusarium sp. Samples of 10 to 20 specimensof each pure population were examined under lightmicroscope and the main morphological characters ofeach one were documented with scanning electronmicroscope. The blotter-test , according to theInternational Seed Testing Association, was utilized fordetection of fungi. The following species of nematodeswere found in the samples: Aphelenchoides besseyi, A.bicaudatus, A. fragariae; A. sexlineatus; Ditylenchusmyceliophagus; D. dipsaci; D. montanus and Aphelenchus sp.In a greenhouse test using gerbox plate with autoclavedsand humidified with a suspension of A. sexlineatus it



359

was observed that the infection of Brachiaria brizanthaseeds occurs when they fall on to the soil. Among thefungi unidentified species of Fusarium, Helminthosporium

and Phoma were found. So, a method for cleaningphytopathogenic nematodes and fungi off seeds offorage grasses must be developed.

152 – HOST STATUS OF CITRUS ROOTSTOCKS TO THE K5 POPULATION OF Pratylenchus coffeae[REAÇÃO DE PORTA-ENXERTOS CÍTRICOS À POPULAÇÃO K5 DE Pratylenchus coffeae] Bonfim Junior, M.F.1;Oliveira, C.M.G.2; Inomoto, M.M.1 1Departamento de Entomologia, Fitopatologia e Zoologia Agrícola/ ESALQ/USP, C.P. 9, 13418-900 Piracicaba, SP, Brazil; 2Instituto Biológico, C. P. 70, 13001-970 Campinas, SP, Brazil. E-mail:[email protected]

Pratylenchus jaehni has been reported as the most damagingnematode in Brazilian citrus orchards. Therefore, this studyaimed to evaluate the host status of citrus rootstocks to K5

population of P. coffeae because of its morphometric andmolecular similarity with P. jaehni. The inoculation of 180specimens per plant was performed when the rootstockswere six months old. The evaluation was made after 120days, using the reproduction factor [RF = final population/

initial population]. The nematode did not reproduce (RF= 0.00 to 0.02) in trifoliata Limeira, Sour orange, citrangeCarrizo, Cleopatra tangerine, Sunki tangerine andVolkameriano lemon. However, Rangpur lime was a goodhost to K5 population (RF = 3.66). The host reaction ofthese seven citrus rootstocks to the K5 population was verysimilar to those presented previously by the same rootstocksto P. jaehni.

153 – POPULAÇÃO DE NEMATÓIDES EM BANANEIRA PRATA ANÃ NO MUNICIPIO DEMOCAMBINHO [NEMATODE POPULATION IN A BANANA PRATA ANÃ ORCHARD IN MOCAMBINHO,MG] Vieira, R.S.¹; Ritzinger, C.H.S.P.²; Luquine, L.S.¹; Damasceno, J.C.A.¹; Fancelli, M.²; Cordeiro, Z.J.M.² ¹UniversidadeFederal do Recôncavo da Bahia, Campus de Cruz das Almas, 44380-000 Cruz das Almas, BA, Brazil; ²Embrapa Mandiocae Fruticultura Tropical, Rua Embrapa s/n, C. P. 007, 44380-000 Cruz das Almas, BA, Brazil. E-mail:[email protected]

O Brasil é o segundo maior produtor e consumidor mundialde banana. Minas Gerais ocupa o quinto lugar na produçãonacional, sendo o Norte de Minas Gerais a maior regiãoprodutora do Estado, com uma produção estimada em cercade 26% da produção de banana. A ocorrência defitonematóides representa ameaça à cultura. O manejo pormeio de defensivos químicos tem sido ambientalmenteinsustentável. O estabelecimento de um sistema deprodução integrada desponta como alternativa parasolucionar o problema. Este trabalho objetivou avaliar apopulação de nematóides na cultura da bananeira, cultivarPrata Anã, sob manejo integrado. O experimento foirealizado na fazenda experimental da EPAMIG, emMocambinho, Distrito de Jaíba, MG. A área foi estratificadapela idade do bananal, sendo 1, bananal novo, até três anosde idade; 2, bananal com idade inferior a 10 anos e 3, bananalcom idade superior a 11 anos. As amostras de solo e raízesforam sistematizadas de acordo com o desenvolvimento

da planta: planta mãe apresentando cacho e a planta filhacom 1,5 m de altura. Foram retiradas quatro amostras/idadee cada amostra composta por duas subamostras, naprofundidade de 20 cm, em novembro/2008 e abril/2009.Foram identificados os seguintes fitonematóides: Meloidogynespp., Rotylenchulus reniformis, Hoplolaimus sp., Helicotylenchussp. e nematóides de vida livre, em sua maioria, da ordemRhabditida. No bananal novo, as populações foram baixas,média de 182 e 25 indivíduos/100cm3 de solo, época 1 e 2,respectivamente. Na primeira época, a maior população foide Hoplolaimus sp. (1915 indivíduos/100cm3 de solo) nobananal com idade inferior a 10 anos. Na segunda época,sobressaíram as populações de Helicotylenchus sp. e R.reniformis com 1076 e 405 individuos/100cm3 de solo, nosbananais com idade inferior e superior a 10 anos,respectivamente. As informações obtidas podem contribuirpara a adesão de produtores ao Sistema de ProduçãoIntegrada de Bananeira na região.

360 Vol. 33(4) - 2009


154 – OCORRÊNCIA DE NEMATÓIDES NA CULTURA DA BANANEIRA NO MUNICIPIO DE NOVAPORTEIRINHA [OCCURRENCE OF NEMATODES IN A BANANA ORCHARD IN NOVA PORTEIRINHA,MG] Vieira, R.S.¹; Ritzinger, C.H.S.P.²; Luquine, L.S.¹; Damasceno, J.C.A.¹; Fancelli, M.²; Cordeiro, Z.J.M.² ¹UniversidadeFederal do Recôncavo da Bahia, Campus de Cruz das Almas, 44380-000 Cruz das Almas, BA, Brazil; ²Embrapa Mandiocae Fruticultura Tropical, Rua Embrapa s/n, C. P. 007, 44380-000 Cruz das Almas, BA, Brazil. E-mail:[email protected]

A bananeira é uma cultura de importância comercial nospaíses tropicais. O Estado de Minas Gerais está entre osseis maiores produtores brasileiros. Contudo, a presençade fitonematóides tem causado danos econômicos a estafruteira. O estabelecimento de um sistema de produçãointegrada para a cultura desponta como alternativa parasolucionar o problema. Neste sentido, foi realizadoexperimento na fazenda experimental da EPAMIG, noperímetro irrigado de Gorutuba, município de NovaPorteirinha, MG. O trabalho teve o objetivo de avaliar apopulação de fitonematóides e nematóides de vida livre nacultura da bananeira, variedade Prata Anã sob manejointegrado. Amostras de solo e raízes foram sistematizadasde acordo com o desenvolvimento da planta, sendo que aplanta mãe apresenta cacho e a planta filha 1,5 m de altura.Foram feitas quatro amostras/idade e cada amostra foi

composta por duas subamostras, na profundidade de 20cm, em duas épocas (novembro/2008 e abril/2009). A áreado bananal era irrigada por inundação, sendo composta deplantas com 10 anos de idade, aproximadamente. Nasamostras de solo e raízes foram identificados os seguintesfitonematóides: Meloidog yne spp., Hoplolaimus sp. ,Helicotylenchus sp. e nematóides de vida livre. Houve diferençasignificativa para todas as espécies nas épocas avaliadas,exceto para Meloidogyne sp. Observou-se maior populaçãode Helicotylenchus sp. no solo e raízes somente na época 1,enquanto que o Hoplolaimus sp. foi detectado apenas naépoca 2. Também houve diferença significativa para osnematóides de vida livre, com população maior na epóca1. As informações obtidas podem fornecer importantesubsidio para o estabelecimento de um Sistema de ProduçãoIntegrada de Bananeira na região.

155 – COMUNIDADE DE NEMATÓIDES NO SOLO DA RIZOSFERA DE SEIS CULTIVARES DEBANANEIRA SOB COBERTURA VEGETAL COM FEIJÃO DE PORCO (Canavalia ensiformis) EAMENDOIM FORRAGEIRO (Arachis pintoi) [NEMATODE COMMUNITIES IN THE RHIZOSPHERE SOILOF SIX BANANA CULTIVARS UNDER BEAN (Canavalia ensiformis) AND FORAGE PEANUT (Arachis pintoi) MULCH]Santos, J.F.¹; Ritzinger, C.H.S.P.²; Borges, A.L.²; Fancelli, M.²; Ledo, C.A.S.²; Luquine, L.S.¹; Vieira, R.S.¹; Jesus, F.N.¹¹UFRB, Cruz das Almas, BA, Brazil; ²Embrapa Mandioca e Fruticultura Tropical, C.P. 007, Cruz das Almas, BA, Brazil. E-mail: [email protected]

O manejo do solo é umas das práticas mais importantes nosistema orgânico de cultivo. A qualidade do sistema podeser determinada por meio de diferentes indicadores. Acomunidade de nematóides pode refletir a sustentabilidadedo ecossistema, por meio da identificação dos grupostróficos e seu comportamento mediante o manejo adotado.O trabalho foi realizado na Embrapa Mandioca eFruticultura Tropical, objetivando identificar ascomunidades de nematóides associados ao solo da rizosferade seis cultivares de bananeira, sob duas leguminosas (feijãode porco e amendoim forrageiro). O feijão de porco foiplantado em julho de 2006 e replantado em 2007 e 2008,após a incorporação da massa verde. O amendoimforrageiro foi mantido na área. Foram realizadasamostragens de solo em duas épocas, dezembro de 2008 eabril de 2009. Oito amostras por cultivar (quatro sob acobertura de feijão de porco e quatro sob amendoim

forrageiro) na profundidade de 20 cm. Dentre osfitoparasitas, a maior população foi de Rotylenchulus sp.(647 indivíduos/100cm3 de solo) , seguida deHelicotylenchus sp., Meloidog yne sp., Pratylenchus sp.,Radopholus sp., Hoplolaimus sp., Criconemella sp. Houvediferença no comportamento dessas populações entreas cultivares, épocas e coberturas vegetais. As populaçõesde R. similis e Meloidogyne sp. foram maiores na cultivarCaipira na segunda época. Houve interação triplasignificativa para a população de Pratylenchus sp., sendomaior nas cultivares Thapimeo Ken e Pacovan. Apopulação de Helicotylenchus sp. foi maior sob Arachis pintoie a população de Rotylenchulus reniformis foi maior nacultivar Pacovan sob Arachis pintoi. A média da populaçãode nematóide de vida livre aumentou na segunda época(317 indivíduos/100cm3 de solo) não havendo diferençaentre as coberturas.



361

156 – OCORRÊNCIA DE NEMATÓIDES EM ÁREAS DE PRODUÇÃO DE CAFÉ [OCCURRENCE OFNEMATODES IN AREAS OF COFFEE PRODUCTION] Neves, S.S.¹; Alves, G.C.S.2; Soares, P.L.M.3; Santos, J.M.²;1UNESP/FCAV, Câmpus de Jaboticabal, Departamento de Fitossanidade, Laboratório de Nematologia; 2UNESP/FCAV;3UNESP/FCAV, Câmpus de Jaboticabal, Departamento de Fitossanidade, Laboratório de Nematologia. E-mail:[email protected]

Foram consultados os arquivos do Laboratório deNematologia do Departamento de Fitossanidade daUNESP/FCAV, Câmpus de Jaboticabal-SP, no período de2005 a 2008 quanto aos resultados de análises nematológicasde amostras de solo e raízes coletadas em cafeeiros eenviadas ao laboratório. As amostras de solo foramprocessadas pelo método da flotação centrífuga em soluçãode sacarose e as raízes pelo método da flotação centrífugaem solução de sacarose com adição de caulim. A seguir, assubpopulações de fitonematóides nas amostras foramestimadas ao microscópio fotônico com auxílio da câmarade contagem de Peters. Das 199 amostras enviadas paraanálise, em 109 foi constatada a presença de pelo menosuma espécie de nematóide de importância econômica paraa cultura do café. Nestas amostras enviadas de diferentesEstados e Municípios as espécies, de importância econômicaidentificadas para a cultura foram: BA (Luis EduardoMagalhães - Pratylenchus brachyurus), ES (Baixo Guandu –Meloidogyne exígua e São Grabriel da Palha – Rotylenchulusreniformis), MG (Araxá – M. exígua; Carmo do Paraná – M.exígua; Patos de Minas - M. exígua; Patrocínio - M. exígua,M. paranaensis e P. brachyurus; Presidente Olegário - M. exíguae P. brachyurus; Sacramento - M. exígua e P. brachyurus e Serra

do Salitre - M. exígua), PR (Mandaguari - M. paranaensis) eSP (Adamantina - M. exígua, M. paranaensis e P. brachyurus;Auriflama - M. exígua; Cajuru – P. brachyurus e R. reniformis;Cristais Paulista – M. incognita; Dois Córregos - M. paranaensis;Franca - M. exígua; Garça - R. reniformis; Ibaté - P. brachyurus;, Itápolis - R. reniformis; Paraíso - R. reniformis; PatrocínioPaulista - M. exígua e P. brachyurus; Pedregulho - M. exígua eP. brachyurus; Restinga - P. brachyurus; Ribeirão Corrente -M. goeldi e Santa Rosa do Viterbo - P. brachyurus). Em relaçãoà porcentagem representada por cada nematoide, em cadaEstado, nas amostras analisadas, temos os seguintes valores:72,7% das amostras com M. exigua; 18,2% com P. brachyuruse 9,1% com M. paranaensis no Estado de Minas Gerais; noEstado de São Paulo 47,6% com M. exigua; 23,8% com P.brachyurus; 16,6% com R. reniformis; 7,1% com M. paranensis;2,38% com M. goeldii; 2,38% com M. incognita; no Estadodo Paraná observou-se ocorrência de 100% com M.paranaensis; Estado da Bahia com 100% de P. brachyurus e noEstado do Espírito Santo onde constatou-se 83,3% com P.brachyurus e 16,7% das amostras com M. exigua. Conclui-seque M. exigua foi a espécie mais freqüente entre as amostrasanalisadas, evindenciando sua maior distribuição dentre asespécies de importância econômica para a cultura do café.

157 – Rotylenchulus reniformis IN NORTHEASTERN BRAZIL; HOSTS AND DAMAGE [Rotylenchulus reniformisNO NORDESTE DO BRASIL; HOSPEDEIROS E DANOS] Farias, A.C.A.1; Ribeiro, A.R.S.1; Moura, R.M.1 1UniversidadeFederal de Pernambuco, Centro Acadêmico de Vitória, Laboratório de Microbiologia e Imunologia. Rua Alto doReservatório, s/n Vitória de Santo Antão, 55.608-680 Pernambuco, Brazil. E-mail: [email protected]

Rotylenchulus reniformis, the “reniform nematode”, is asedentary ectoparasite, spread over agricultural areasworldwide. It is basically a tropical and sub-tropical plantpathogen, first described by Linford and Oliveira oncowpea, in Hawaii in 1940. In terms of host-parasiterelationships, damage varies from none to high. In 1964Ayala and Ramirez reported a list of hosts of this parasite,including 221 different hosts from 15 countries. Caswell-Chen and Robinson stated in 1996 that more than 170 dicotsand 25 monocots are hosts of R. reniformis. In the Northeastof Brazil, a tropical region, R. reniformis was reported onnew and existing hosts causing variable degrees of damage.The objective of this paper is to present the discoveries onthe “reniform nematode” in the Nor theastern

agricultural areas of Brazil. In that area, two types ofcrop reactions to the “reniform nematode” have beenobserved; susceptible and tolerant, according to Dropkinconcepts. Banana, cilantro, melon, soursop and papayawere found reacting as highly susceptible. On these hosts,damage may induce losses up to 100% On the otherhand, no damage nor losses could be observed on yams(Dioscorea rotundata) and sugarcane var. SP 70 1011, evenin the presence of population densities above 700nematodes/300cc of soil. Both crops were consideredtolerant. When reported, cilantro and soursop werepresented as new hosts for R. reniformis and melon, yam,papaya and sugarcane populations were reported for thefirst time in Brazil.

362 Vol. 33(4) - 2009


158 – ORBITAL REMOTE SENSORING CAN HELP THE MANAGEMENT OF NEMATODES ONSOYBEAN IN BRAZIL [SENSORIAMENTO REMOTO ORBITAL PODE AUXILIAR O MANEJO DENEMATÓIDES EM SOJA NO BRASIL] Santos, J.M.¹; Marchiorato, I.A.1 ¹UNESP/FCAV Departamento de Fitossanidade,14.884-900 Jaboticabal, SP, Brazil. E-mail:[email protected]

The knowledge of the spatial distribution of nematodes incrops is essential to adoption of management practices. Inlarge farms in Mato Grosso State, Brazil, because theproducers do not have information about nematodedistribution inside the plots, they prefer not to adopt anymeasure of nematode management, since, depending onthe cost and operational point of view, it would beimpracticable to do so in entire area. Maps of variability ofthe potential of productivity achieved with satellite imageryfrom the entire farm could indicate the plots whose potentialof productivity is below expectations, according to the levelof technology used. Then, the producer could, in thecurrent crop, make sure if the nematodes, problems offertility or combinations of both, or still other causes wouldbe the limiting factors to the achievement of the potentialproductivity of the plot. This study was carried out inpartnership between the Laboratório de Nematologia ofthe Departamento de Fitossanidade of UNESP/FCAV,Jaboticabal Campus in São Paulo State, Brazil and GlobalsatMonitoramento Agrícola Company, based in RondonópolisCounty, Mato Grosso State, with the objective of checkingthis hypothesis. A map of variability of the potential ofproductivity of 1,378.9 ha of soybean in Aimi Farm, in

Rondonopolis County, was carried out with images fromSPOT 4, a French satellite, in December, 2006. Bands ofproductivity potential had been determined: class I - 65 to75 bags/ha, represented on the map by blue color; class II- 55 to 65, green; III - 50 to 55, orange; IV - 45 to 50,yellow; class V - 35 to 45, red; VI - 25 to 35, XXX and classVII - 00 to 25, black. In the following year, in December2007, soil and root samples were collected in threepreviously defined points with the help of a GPS receptor,inside the corresponding area of each mentioned class ofproductivity, and transported to the Nematology Lab atUNESP/FCAV Campus, where they were processed. Thedata were submitted to the analysis of simple linearcorrelation between the average of the potential ofproductivity in the different classes of productivity and thesum of the nematodes found in 100 cm3 of the soil samples,plus 10 g of roots collected in the three points inside thecorresponding areas of each class. The data revealed anegative linear correlation between the average potentialof productivity obtained from the satellite imagery and thecounts of Pratylenchus brachyurus recovered in each class,indicating that such maps are valuable auxiliary tools fordecisions on the management of nematodes in soybean.

159 – STUDY OF PREDATORY NEMATODES ON FRUIT TREES IN KERMAN [ESTUDO DENEMATÓIDES PREDADORES EM ÁRVORES FRUTÍFERAS EM KERMA] Shahbazi, H.1; Mohammad Deimi, A.2;Barooti, S.2 1Department of Plant Protection, Abourayhan Campus, University of Tehran, Tehran, Iran. E-mail:[email protected]; 2Dep. of Plant Pathology, Faculty of Agriculture and Natural Resources, Science and Res.Branch, Islamic Azad University, P.O. Box 14515-775, Tehran, Iran. E-mail: [email protected]

Predatory nematodes have an effective role in biologicalcontrol of plant parasitic nematodes in soil. In order toidentify the predatory nematodes of fruit trees from theorder Mononchida in in Kerman province, about 32 soilsamples were collected during 2008-2009. The nematodeswere extracted by centrifugal technique, killed, fixed andtransferred to glycerin, and the nematodes were prepared

according to De Grisse method (1969). Morphological andmorphometrical characters were studied by lightmicroscope. In this study 6 species belonging to 4 generaof orders Mononchida were identified as follows:1)Anatonchus tridendatus 2) Clarkus papillatus 3) Mononchusaquaticus 4) Mylonchulus brachyuris 5) Mylenchulus minor 6)Mylonchulus sigmaturus

160 – AVALIAÇÃO DE ESQUEMAS DE AMOSTRAGEM PARA MONITORAMENTO DE Meloidogyne spp.EM ÁREAS CULTIVADAS COM CANA-DE-AÇÚCAR [SAMPLING EVALUATION FOR MONITORINGMeloidogyne spp. IN SUGARCANE GROWING AREAS] Vicente, T.F.S.1; Pedrosa, E.M.R.1 Rolim, M.M.1; Barbosa, N.M.R.1;Souza, A.M.P.L.1 1Universidade Federal Rural de Pernambuco, Rua Dom Manoel de Medeiros s/n, Dois Irmãos, 52.171-900 Recife, PE, Brazil. E-mail: [email protected]

A distribuição horizontal irregular dos nematóides éprovavelmente o maior obstáculo para obtenção de

estimativas confiáveis da densidade populacional. Por outrolado, a coleta adequada de amostras pode permitir adoção



363

de práticas de manejo eficientes e reduzir os custos. Opresente estudo teve como objetivo determinar diagramade amostragem para monitoramento de populações deMeloidogyne spp. na presença e ausência de irrigação, em trêsescalas de amostragem, em área de tabuleiro costeirocultivada com cana-de-açúcar na Zona da Mata Norte dePernambuco. Para coleta de amostras foram usadas malhas

quadrangulares de 2,00 × 2,00 m, 20,00 × 20,00 m, e 200,00× 200,00 m, e simulados padrões de caminhamento em“X”, diamante, linhas paralelas, diagonais, “V”, zigue-zague,“W”, aleatório, “degrau” e “S”, recomendando-secaminhamento em zigue-zague para monitoramento deMeloidogyne spp. em campos cultivados com cana-de-açúcarnas condições do Nordeste do Brasil.

161 – SUSCEPTIBILITY OF WINGED BEAN (Psophocarpus tetragonolobus) TO Meloidogyne incognitaAND M. javanica [SUSCETIBILIDADE DE FEIJÃO ALADO (Psophocarpus tetragonolobus) A Meloidogyne incognita E M.javanica] Biela, F.1; Dias-Arieira, C.R.1; Puerari, H.H.1; Cunha, T.L.P.1; Cosmo, D.A.1; Chiamolera, F.M.1; Duarte e Silva,L.C.2; Seabra Junior, S.2 1Universidade Estadual de Maringá, Campus Regional de Umuarama, C. P. 65, 87501-970 Umuarama,PR, Brazil; 2Universidade do Estado do Mato Grosso, Departamento de Agronomia, 78200-000 Cáceres, MG, Brazil. E-mail: [email protected]

The winged bean (Psophocarpus tetragonolobus) is a leguminousplant originally from New Guinea, which has been cultivatedand studied principally in the Amazon region, Brazil. Fewworks have studied the susceptibility of this pathogen toplant-parasitic nematodes. So this work aimed to evaluatethe susceptibility of this leguminous plant to root knotnematodes. For this, seedlings were produced in trayscontaining substrate and were transplanted to pots withcapacity for three liters, containing soil: sand in theproportion 2:1, previously autoclaved. Three days aftertransplanting, the seedlings were inoculated with suspensionof 4ml, containing 4,000 eggs of Meloidogyne incognita or M.

javanica. After 60 days, the number of galls and eggs wasmeasured, and from the latter the nematode reproductionfactor (RF = final population / initial population) wascalculated. The average numbers of galls and eggs ofM. incognita and M. javanica were 37 and 4,726 and 75and 5,327, respectively. The RF equal to 1.18 for M.incognita and 1.33 for M. javanica show the susceptibilityof the winged bean to both nematodes evaluated. Theviability of the inoculum was proved by the values ofRF equal to 25.50 and 4.13, for M. incognita and M.javanica, respectively, observed in the root system of thetomato plant.

162 – THE DECLINE AND DEATH OF GUAVA TREES PARASITIZED BY Meloidogyne mayaguensis: APUTATIVE COMPLEX DISEASE INVOLVING Fusarium solani [DECLÍNIO E MORTE DE GOIABEIRASPARASITADAS POR Meloidogyne mayaguensis: POSSIVELMENTE UMA DOENÇA COMPLEXA ENVOLVENDOFusarium solani] Gomes, V.M.1; Souza, R.M.1; Mussi-Dias, V.1; Silveira, S.F.1; Dolinski, C.1. 1Universidade Estadual do NorteFluminense Darcy Ribeiro/CCTA/LEF. 28015-620 Campos dos Goytacazes, RJ, Brazil. E-mail:[email protected]

In Brazil, M. mayaguensis has become a menace for guavaproduction. Nationwide, a fourth of the cultivated area isinfested, for which the prospect is the decimation of theorchards. Because infected plants’ roots become entirelyrotten as the disease progresses, a study was set up toinvestigate whether a soilborne pathogen could be involved.From eight nematode-free or -infested orchards, 1,536 rootfragments were processed for isolation of systemic bacteriaand fungi. Positive isolations were obtained from nematode-infested areas only, from which many Fusarium sp. isolateswere established. In the field, guava seedlings wereinoculated with M. mayaguensis only or a combination ofthe nematode with one of 11 Fusarium sp. isolates.Uninoculated plants were kept as controls. One hundred

and fifty days later, half of the plants inoculated with M.mayaguensis and Fusarium sp. had started to decline. Variablesrelated to the plants´ shoot and root growth were negativelyaffected by the fungus, especially when root rotting wasintense. The six most damaging isolates were identifiedas F. solani. In Brazil, Fusarium sp. has never been reportedassociated with or as pathogenic to guava on its own.The extent of the root rotting and damage caused by F.solani when associated with M. mayaguensis indicates thata complex disease involving these organisms may beresponsible for the widespread decimation of orchardsthroughout Brazil. A second field experiment and severallaboratory assays are being conducted to confirm thishypothesis.

364 Vol. 33(4) - 2009


163 – SINTRA-ROOT SYSTEM HETEROGENEITY OF Radopholus similis POPULATION DYNAMICSON BANANAS, A MODELING APPROACH [SISTEMA SINTRA-RAÍZ DE HETEROGENIDADE DADINÂMICA DE POPULAÇÕES DE Radopholus similis EM BANANEIRAS, UMA ABORDAGEM DE MODELAGEM]Tixier, P.1; Quénéhervé, P.2 1CIRAD UPR 26, 2IRD, UMR RPB, Pôle de Recherche Agroenvironnementale de la Martinique,BP 214 - 97285 Lamentin Cedex 2 Martinique, French West Indies, France. Email: [email protected]

On the plant scale, the heterogeneity of pest populationshas long been ignored. Concerning plant-parasiticnematodes, there is strong evidence that these populationscould be highly heterogeneous in space, mostly due to theirlow dispersal capacities. On bananas, this heterogeneity iseven emphasized by the semi-perennial nature of this plantand by the recurrent development of a new emerging rootsystem at every crop cycle. Hence, the root biomass resourcefor plant-parasitic nematodes is not available constantlyeither in terms of quality or quantity but accordingly to thephenology of successive suckers. We adapted the SIMBA-NEM model to simulate nematode sub-populations for eachsucker, at the scale of the banana mat. SIMBA-NEM wasprimarily designed to simulate the plant-parasitic nematodesof banana at field scale, considering the global populationof the simulated plot; the model used two populationparameters, ‘r’ the growth rate of the population and ‘K’the carrying capacity of root resource. The simulation ofthe root biomass of each sucker was performed with the

SIMBA-GROW module. We introduced a new parameterrelated to the rate of infestation from one sucker to thesuccessive ones. We confronted the simulations performedfor the burrowing nematode Radopholus similis over fourcropping cycles with field measures of R. s imi l i spopulations, separately acquired from each sucker’s rootsystem. We conclude that the model reproduces correctlythe pattern of population dynamics for the successivesuckers. Our results highlight the importance of bananavegetative development on the population dynamics ofR. similis. This improved model should be a useful toolto design new management strategies for banananematodes, especially when it deals with cultural practicesperformed at the plant or the organ levels, e.g.desuckering techniques or pesticide applications. Finally,this work provides evidence that nematode populationsmight be managed on a more local scale and that speeddevelopment of plant organs is of importance in theirpopulation dynamics.

164 – RELATIONSHIPS BETWEEN NEMATODE COMMUNITIES AND PHYSICAL-CHEMICAL SOILATTRIBUTES IN AREAS DEGRADED BY LAMINAR EROSION [RELAÇÕES ENTRE A NEMATOFAUNAE ATRIBUTOS FÍSICO-QUÍMICOS DO SOLO EM ÁREAS DEGRADADAS POR EROSÃO LAMINAR] Ramos,Y.S.1; Pedrosa, E.M.R.1; Rolim, M.M.1; Miranda, T.L.1; Matos, S.S.1 1Universidade Federal Rural de Pernambuco, Rua DomManoel de Medeiros s/n, Dois Irmãos, 52.171-900 Recife, PE, Brazil. E-mail: [email protected]

Relationships between nematode communities and physical-chemical soil attributes were evaluated in nine areaspresenting initial, intermediate or severe erosive processes,around the reservoir banks of the Luiz Gonzagahydroelectric dam, in Pernambuco State, Brazil .Nematodes were classified into taxonomic groups, andthe density and relative abundance of each trophic groupwas estimated and correlated with physical and chemicalattributes of soil. Sites in initial erosive processes showedhigher density of bacteria-feeding nematodes(Rhabditidae and Cephalobidae) with relative abundance

of 36.83%, especially Cephalobidae (26.82%). Theomnivores, particularly Dorilaymidae, were moreabundant in intermediary and severe process, 39.87%and 48.17%, respectively. In areas with intermediaryprocesses there were weak correlations betweennematodes and soil attributes. In contrast, sites in initialand severe process showed stronger correlations,pointing out natural argyle with Helicotylenchus density ininit ia l process, and aluminum saturat ion withMononchidae, Aphelenchidae and Trichodorus densitiesin severe process.



365

Section 4 - Marine nematodes

165 – NEMATODES ASSOCIATED WITH SANDY REEFS OF Sabellaria wilsonii (POLYCHAETA:SABELLARIIDAE) IN THE NORTH OF BRAZIL [NEMATÓIDES ASSOCIADOS A RECIFES DE AREIADE Sabellaria wilsonii POLYCHAETA: SABELLARIIDAE NO NORTE DO BRASIL] Ataíde, M.B.1; Venekey, V.1; Gomes,T.P.1; Rosa-Filho, J.S.1 1Universidade Federal do Pará, Faculdade de Oceanografia, Laboratório de Oceanografia Biológica.Rua Augusto Corrêa, 01. Guamá, 66075-110. Belém, PA, Brazil. E-mail: [email protected]

The nematodes of a sandy reef constructed by Sabellariawilsonii (Polychaeta: Sabellaridae) were studied during therainy season (June, 2008) in the Algodoal/Maiandeua Island(200 Km from Belém-PA, Brazil), with the aim ofcomparing areas protected or exposed to waves. Sampleswere collected using a corer of 3.0 cm in diameter and 10cm in length. A total of 16 samples were collected, dividedequally between protected and exposed areas. Aftersampling, the replicates were stocked in plastic pots, fixedwith formol 4% tamponed by Tetraborat of sodium andcolored with Rose Bengal. In the laboratory the nematodeswere extracted with elutriation, isolated from macrofaunausing meshes of 0.045 and 0.5 mm and later sorted withthe help of stereoscopic microscope. Up to 30 nematodeswere mounted on permanent slides and identified up togenus level using optical microscope and pictorial keys. In

order to compare the richness and population structure ofprotected and exposed environments similarity analyses(ANOSIM – Bray Curtis index of similarity) were appliedon the data transformed to square root. A total of 3 orders,10 families and 15 genera were recorded. Consideringgenera level, Viscosia was the dominant one in bothenvironments, comprising 63% of the individuals andpresent in all samples. The highest densities were foundin the exposed area, 290.51 ind.10cm²; however, thepopulation structure in this locality did not differsignificantly from that found for the protected area,234.25 ind.10cm² (ANOSIM; p=0.06). The present workcontributed with the first list of Nematoda associatedwith sandy reefs of Sabellaria in Brazil and recorded anew occurrence for the Brazilian coast, the genusEumorpholaimus.

166 – NEMATODES AS INDICATORS OF SHRIMP FARM IMPACT ON THE CURUÇÁ ESTUARY (PARÁ-BRASIL) [NEMATÓIDES COMO INDICADORES DE IMPACTO EM FAZENDAS DE CAMARÃO NOESTÚARIO DE CURUÇA (PARÁ-BRAZIL)] Venekey, V.1; Gomes, T.P.1; Rosa-Filho, J.S.1 1Universidade Federal do Pará,Faculdade de Oceanografia, Laboratório de Oceanografia Biológica. Rua Augusto Corrêa 01, Guamá, 66075-110 Belém,PA, Brazil. E-mail: [email protected]

The impacts of a shrimp farm on the benthic fauna wereevaluated with sampling of nematodes in the dry and rainyseasons (August/2004 and January /2005) in localitiessituated at 0m (D1), 30m (D2) and 200 m (D3) from theeffluent discharge point. Eight replicates were sampled ateach site using a corer of 3 cm inner diameter and 10 cmlength, subsequently being fixed in 4% formol. Inlaboratory, nematodes were extracted from the sediment(elutriation and sieving through meshes of 0.045 and 0.5mm), mounted on permanent slides and identified up togenus level using optical microscope and pictorial keys.Multidimensional Scaling (MDS) was used for nematodecharacterization. Richness (R), density (D), diversity (S),evenness (E) and population structure between seasons andsampling stations were compared through the t test (log(x+1) -transformed data) and Analyses of Similarity(ANOSIM). Thirty-eight genera were recorded with

Terschellingia, Daptonema, Sabatieria and Ptycholaimellus beingthe dominant ones in the dry season and Terschellingia,Gomphionema and Sabatieria in the rainy season. Alldescriptors presented higher values in the rainy season withdensity and diversity being significantly different. Significantdifferences were not observed in the variation of anydescriptors concerning sampling stations, even with theirreduction from D1 to D3 in the dry season. The nematodeassemblages were different between seasons (R=0.052;p=0.0001) and sampling stations in the dry season (R=0.39;p=0.001) but not in the rainy season, when they were similarin D1 and D2. It is possible to conclude that: 1. the nematodegenera from Curuçá are typically estuarine; 2. the variation inwater salinity is the major factor responsible for temporalvariations in nematode assemblages; and 3. evidentmodifications in the benthic fauna of the estuary as aconsequence of shrimp farm discharge could not be observed.

366 Vol. 33(4) - 2009


167 – EFFECT OF CADMIUM ON THE DEVELOPMENT OF Diplolaimelloides oschei (Monhysteridae,Nematoda) [EFEITO DO CÁDMIO NO DESENVOLVIMENTO DA Diplolaimelloides oschei (Monhysteridae, Nematoda)]Lira, V.1; Santos, G.2; Fonsêca-Genevois, V.1; Moens, T.2 1Department of Zoology, Federal University of Pernambuco,Brazil. zip-code: 50670901; 2Department of Biology, Marine Biology Section, Ghent University, Krijgslaan 281 (S8), 9000Ghent, Belgium. E-mail:[email protected]

Among the marine benthic organisms, free-livingnematodes possess several traits which render them usefuleco-toxicological indicators and biomonitoring tools. Manyspecies cycle an important proportion of the sediment poolof decanted insoluble heavy metals (e.g. Cd). Heavy metalpollutant cycling is cumulative throughout ecological foodweb interactions. Nematodes are known to be an importantlink between bacterial production and higher trophic levels.They are also a highly diverse group, even at a local scale.However, few species can be maintained in permanentculture under standardized conditions. One of these speciesis Diplolaimelloides oschei. Aiming to analyze lethal andsublethal effects of five different cadmium concentrations(control, 0.3, 1.0, 5.0, 9.0 and 12.0 ppm) on the populationdevelopment of D. oschei, petri dishes (5.0 cm i.d.) filledwith sloppy bacto-agar with a final concentration of 0.75% and a salinity of 25 were maintained at 17 °C . Ten malesand ten females were inoculated per microcosm, with 4

replicate microcosms per treatment, and Escherichia coli wasoffered as food. Every second day, numbers of eggs,juveniles and adults (male and females) were quantified untilthe 16th day, and then every 96 hours until the 32nd day. D.oschei expressed relatively high sensitivity to Cdconcentrations. Eggs appeared from the first day ofcounting in all treatments and replicates, but theirabundance decreased at concentrations exceeding 1.0 ppm.Ergo, juvenile densities followed the same pattern. Maleabundance appeared more sensitive to Cd pollution thanfemale abundance, the former already being affected at adose of 1 ppm, the latter only from 5 ppm onwards. At thetwo highest Cd concentrations, no maturation of the F1generation to adults was observed. Diplolaimelloides oschei wasmore sensitive to cadmium than another species from thesame habitat (e.g. Pellioditis marina). The higher sensitivityof D. oschei is possibly due to their comparatively longerlife cycle and longevity, allowing a higher bioaccumulation.

168 – NEW SPECIES OF FREE-LIVING MARINE NEMATODES OF THE FAMILY LEPTOLAIMIDAEFROM PATAGONIA COAST (CHUBUT AND SANTA CRUZ, ARGENTINA) [NOVAS ESPÉCIES DENEMATÓIDES DE VIDA LIVRE DA FAMÍLIA LEPTOLAIMIDAE DA COSTA PATAGÔNICA (CHUBUT ANDSANTA CRUZ, ARGENTINA] Catalina, T.1; Ward, P.1; Lo Russo, V.1, Villares, G.1; Panasiuk, T.R.1 1Centro NacionalPatagónico, CONICET, C.C. 128 ,9120 Puerto Madryn, Chubut, Argentina. E-mail: [email protected]

This work focuses on free-living marine nematodes of thefamily Leptolaimidae Örley, 1880. This family comprises agroup of 31 heterogeneous genera grouped into threesubfamilies: Anonchinae Andrassy, 1973, CamacolaiminaeMicoletzky, 1924 and Leptolaiminae Örley, 1880. Tencoastal areas were sampled along the Patagonian coastbetween 40º to 49ºS. In each site fifteen samples werecollected, at upper, middle and lower coastline with aPlexiglas corer. The samples were fixed in 5% formalin withRose Bengal in the field. The Nematodes found wereidentified, drawn and described using a microscope. Threeprobably new species belonging to the subfamilyLeptolaiminae and the genera Leptolaimus, Antomicron and

Dagda are described from Patagonian coastal areas, Chubutand Santa Cruz provinces of Argentina. Leptolaimus sp. ischaracterized by the number of supplements (three) withhamate distal end, as two hooks; it was found at lowintertidal level, San Julian bay (Santa Cruz). Antomicronsp. differs from the four species of the genus by having35 alveoli on esophageal region and three precloacalsupplements and was found at low intertidal level, SanJulian bay (Santa Cruz). Dagda sp. differs from the otherthree species of the genus by having one papilla on tailand cephalic setae shorter than cephalic diameter; it wasfound in coastal groundwater in Puerto Madryn bay(Chubut).



367

169 – ESTRATÉGIAS DE MOBILIDADE E PADRÕES DE DISPERSÃO EM NEMATOIDES MARINHOSDE VIDA LIVRE [STRATEGIES OF MOBILITY AND PATTERNS OF DISPERSION IN FREE LIVING MARINENEMATODES] Thomas, M.C.1; Lana,P.C.1 1Centro de Estudos do Mar, Departamento de Zoologia da UniversidadeFederal do Paraná, UFPR, Av. Beira-mar, C. P. 50002; 83255-000 Pontal do Paraná, PR, Brasil.

Este trabalho analisa as estratégias de mobilidade e padrõesde dispersão de diferentes espécies de nematóides marinhosde vida livre de um baixio não vegetado na Baía deParanaguá (Paraná). Três categorias de comportamentoforam observadas em 300 indivíduos de 20 espécies oumorfotipos mantidos vivos em aquários: Ativo/nadador:espécies ativas no sedimento e com capacidade de natação;Ativo/não nadador: espécies ativas no sedimento semcapacidade de natação, mas com capacidade de flutuar nasuperfície da água quando ressuspendidas e Letárgico: semmovimentos ativos no sedimento ou na coluna d´água(afundando passivamente assim que ressuspendidas). Apósa categorização, os modos de locomoção foram observadosem ágar salino a 0,1% e registrados em vídeos digitais paraposteriores análises dos padrões de deslocamento, comomovimento senoidal, circular, ômega e alfa_epsilon. Das20 espécies anal isadas, Anoplos toma v iv ipara eNeochromadora bonita apresentaram uma relação docomportamento Ativo/nadador com os movimentos de

deslocamento ativo no ágar do tipo senoidal-ômega esenoidal, respectivamente. Por outro lado, a espécieSpirinia parantifera categorizada como Ativa/não nadadoraapresentou movimento de deslocamento no ágar poucoativo e com padrões circular e senoidal. As espéciescategorizadas como Letárgicas, caso de Pseudochromadoraincubans e Metachromadora sp 1, não apresentaram qualquermovimento de deslocamento no ágar, permanecendosempre paradas. Espécies com estratégias de mobilidademais ativas e que apresentam capacidade de nataçãopossuem modos de deslocamento bem diferentes dasespécies menos ágeis. Tais estratégias de mobilidade estãoclaramente relacionadas com a morfologia do corpo,como um corpo retilíneo e cauda mais longa nas espéciesativas/nadadoras e corpo mais robusto e cauda curta ecônica nas espécies letárgicas. Neste contexto, diferentesestratégias de mobilidade podem determinar distintospadrões de dispersão ativa ou passiva em diferentesescalas espaciais e temporais.

170 – BIODIVERSITY PATTERNS OF FREE-LIVING MARINE NEMATODES IN A TROPICAL BAY:CIENFUEGOS, CARIBBEAN SEA [PADRÕES DE BIODIVERSIDADE DE NEMATÓDEOS MARINHOS NABAÍA TROPICAL DE CIENFUEGOS, MAR DO CARIBE] Armenteros, M.1,2; Ruiz-Abierno, A.1; Fernández-Garcés,R.1; Pérez-García, J.A.1; Díaz-Asencio, L.3; Vincx, M.2; Decraemer, W.4,5 1Centro de Investigaciones Marinas, Universidadde La Habana, 16 # 114, C. P. 11300, Playa, Ciudad Habana, Cuba; 2Marine Biology Section, Department of Biology,Ghent University, Krijgslaan 281 S8, B9000, Ghent, Belgium; 3Centro de Estudios Ambientales de Cienfuegos, Ministeriode Ciencia, Tecnología y Medio Ambiente, Ciudad Nuclear, Cienfuegos, Cuba; 4Department of Invertebrates, RoyalBelgian Institute of Natural Sciences, Vautierstraat 29, B1000 Brussels, Belgium; 5Nematology Section, Department ofBiology, Ghent University, Ledeganckstraat 35, B9000, Ghent, Belgium. E-mail: [email protected]

Spatial and temporal biodiversity patterns of free-livingmarine nematodes were studied in Cienfuegos Bay, a tropicalbasin in the Caribbean. Taxonomic and functional structuresof nematode assemblages are reported for the first timefor a tropical semi-closed bay; comparison with similarsubtropical habitats indicated several similarities:anthropogenic and natural processes interact to determinethe spatial distribution, a few species tolerant of pollutionand hypoxia are dominant, and there is a lack of seasonalchanges. High content of silt/clay and organic matter insediments can be explained by high rate of primaryproduction during the whole year, considerable run-offfrom land and high rate of sedimentation. The bay haswidespread pollution due to historical industrial activitiesand reduced water exchange with the Caribbean. Both heavy

metal pollution and the hydrodynamic regime have possiblydriven the spatial km-scale distribution of nematodeassemblages in Cienfuegos Bay. The low hydrodynamicregime determines the poor dispersion of nematodesresulting in high spatial variance across stations and theexistence of hypoxic conditions in some stations withdominance of tolerant species belonging to generaTerschellingia, Sabatieria and Daptonema. Species interactionprobably takes higher importance in determination of short-scale spatial distribution. Species of Terschellingia appear toexploit the fine sediments in the Bay better than Sabatieria,as indicated by contribution to overall abundance. The highturnover of species in km-scale probably does not changethe functional diversity of assemblages since deposit feedingnematodes account for most abundance.

368 Vol. 33(4) - 2009


171 – INVESTIGACION DE FAUNA NEMATOLOGICA EN AMBIENTES DULCEACUICOLAS DEL SURDE LA PROVINCIA DE MENDOZA, ARGENTINA: RESULTADOS PRELIMINARES [INVESTIGATIONOF NEMATOLOGICAL FAUNA IN FRESHWATER ENVIRONMENT IN SOUTH OF MENDONZA PROVINCE]Picca, C.1; Porcel, L.1; Yunes, A.2 1INTA, EEA Rama Caída, Centro Regional Mendoza-San Juan, Calle El vivero s/n. C.P. 5600. San Rafael, Mendoza, Argentina; 2Universidad Nacional de Cuyo, Facultad de Ciencias Aplicadas a la Industria,San Martín 352, C. P. 5600, San Rafael, Mendoza, Argentina. E-mail: [email protected]

En la República Argentina son escasos los estudios referidosa nematodos que se desarrollan en lagos, lagunas yhumedales de agua dulce. El objetivo del presente trabajofue evaluar la fauna nematológica que habita los ambientesdulceacuícolas del sur de la provincia de Mendoza,Argentina. Se realizó un muestreo exploratorio en el lagoEl Nihuil (departamento San Rafael) y en la lagunaLlancanelo (departamento de Malargüe), en Mendoza,Argentina. Las muestras, conteniendo agua y sedimentos,fueron recolectadas durante la primavera 2009 y el verano2008-2009. La extracción de muestras se realizó según lametodología descripta en Standard Methods for theExamination of Water and Wastewater. Estas muestrasfueron procesadas en el laboratorio según técnicas clásicas

en Nematología (f lotación-centrifugación), paraobservaciones en microscopio óptico. En base a lascaracterísticas morfológicas de los individuos observados,se identificaron los siguientes géneros: Dorylaimus y Tobrilus(cuyas especies se desarrollan mayormente en ambientesdulceacuícolas); Acrobeloides y Hemicycliophora (que son mascomunes de encontrar en ambientes terrestres) yrepresentantes del género Rhabditis (que se desarrollan enambientes donde abundan las bacterias). Este estudio esun aporte al conocimiento general de la fauna nematológicade ambientes dulceacuícolas y su consecución podrácontribuir a un mayor entendimiento del grado deinteracción de los nematodos con los demás habitantes dela comunidad acuática de estos ecosistemas.

172 – MARINE NEMATODES OF THE CONTINENTAL SHELF OF NORTHEASTERN BRAZIL(REVIZEE PROGRAM) [NEMATÓIDES MARINHOS DA PLATAFORMA CONTINENTAL DO NORDESTEDO BRASIL (PROGRAMA REVIZEE)] Sobral, L.D.T.1; Botelho, A.P.1; Fonseca-Genevois, V.1; Esteves, A. M.11Universidade Federal de Pernambuco, 50670-901. E-mail: [email protected]

The goal of this study was to characterize the marinenematodes on the northeastern Brazil continental shelf,which were collected during the REVIZEE program.Samples were obtained by the oceanographic vessel“Antares” of the Brazilian Navy, in four campaign years: I(year 1995), II (1997), III (1998) and IV (year 2000). In thelaboratory, nematodes were separated by decantation (withagitation) method and wet sieving. In each sample, onehundred individuals of nematodes were picked out foridentification at genus level, using a pictorial key. Thedistribution was analyzed considering three factors (depth,campaigns, sediment type). A total of 7865 individuals wereidentified and distributed in eight orders (Enoplida,Triplonchida, Chromadorida, Desmodorida, Desmoscolecida,

Monhysterida, Araeolaimida and Plectida), 35 families and 172genera. The most abundant families were Desmodoridae,Chromadoridae and Epsilonematidae, which represented morethan 50% of total abundance. The families Desmodoridae(17), Chromadoridae (15) and Xyalidae (15) showed the highestnumber of genera. Considering the different campaigns, 26genera represented 70% of the relative abundance.Acanthopharynx and Desmodora were the most abundant generain this study. The depth was the only factor that showedsignificantly formed groups of community structure (GlobalR: 0.235; p: 0.01). However, the literature has indicated thatdepth is not “a direct factor” and that others, like food availableand sediment type, should be considered in a study of deepsea marine nematodes.



369

173 – COMPARATIVE AGGRESSIVENESS OF Pratylenchus brachyurus AND P. zeae TO SUGARCANE INPOTS IN AN OPEN AREA [AGRESSIVIDADE COMPARADA DE Pratylenchus brachyurus E P. zeae À CANA-DE-AÇÚCAR A CÉU ABERTO] Barbosa, B.F. F.1; Santos, J.M.¹; Barbosa, J. C.¹; Ruas, A. R.²; Carvalho, R.B.¹ ¹UNESP,Faculdade de Ciências Agrárias e Veterinárias de Jaboticabal, 14884-900 Jaboticabal, SP, Brazil; ²Bioenergia SucroalcooleiraFATEC 14884-900 Jaboticabal, SP, Brazil. E-mail: [email protected]

In Brazil, Meloidogyne javanica, M. incognita and Pratylenchuszeae, are considered the key nematodes for sugarcane.Among the lesion nematodes group, P. zeae has historicallybeen the only species taken into consideration inmanagement programs. An experiment conducted in potsof 100L, in an open area, using inoculum levels of 10, 100,1,000, 10,000 and 100,000 specimens of P. brachyurus or P.zeae by pot, and the control treatment without inoculation,was carried out in order to compare the aggressiveness ofP. brachyurus and P. zeae to sugarcane, considering therelationships among the levels of inoculum of thenematodes and the variables related to plant developmentand the predisposition to attack of the sugarcane borer(Diatraea saccharalis). Each plot was composed of 7 pots of100L and the experimental design was randomized blockswith five replications in a factorial 2 x 5 + 1 (2 species ofnematodes x 5 inoculum levels + 1 corresponding to thecontrol without inoculation). The variety of sugarcanetested was CTC 2. At 15 months after inoculation, duringthe harvest, the numbers of nematodes in aliquots of 100cm ³ of soil and 10 g of roots, fresh mass of roots, freshmass of stems, mass of tips, the average stem diameter,height of the stem until the +1 leaf, the percentage of boredinternodes (number of bored internodes/number ofinternodes of the stem * 100), number of bored stems/pot, the percentage of bored stem/pot, number of

internodes, number of tillers and total number of stems.The final population of P. zeae in soil and roots from eachpot was two times greater than that of P. brachyurus. Thefinal population of P. zeae at the inoculum levels of 1,000to 100,000 by pot, was about 20 and 6 times higher,respectively, than that of P. brachyurus. This behavior maybe related to differences in susceptibility of the variety tothe nematode species, and/or the biotic potential of thespecies. At the end of the experiment, the number of P.zeae specimens in soil and roots did not change among thelevels of inoculum tested, unlike what happened to P.brachyurus, which reached the peak of population, accordingto the regression curve, with the level of inoculumequivalent to 7,000 specimens by pot, and decreased rapidlyabove this level, becoming barely detectable in plantsinoculated with 100,000 specimens by pot. The numberof bored stalks was directly proportional to increasinglevels of inoculum of P. brachyurus, showing thepredisposition of plants infected by the nematode to beattacked by other pests. The number of internodes wasgreater for P. brachyurus than for P. zeae at 100,000specimens by pot. The highest values of fresh weight ofstems and tips for treatments on P. zeae, as well as morecane borer in stems of plants inoculated with P.brachyurus, show more aggressiveness of P. brachyurus tovariety CTC 2 of sugarcane than P. zeae.

Section 5 - Damage and plant nutrition

174 – ASSESSING THE DAMAGE THRESHOLD FOR COFFEE-PARASITIC Meloidogyne exigua IN ACOMMERCIAL, UPLAND PLANTATION [DETERMINAÇÃO DO NÍVEL DE DANO DE Meloidogyne exiguaEM UMA LAVOURA CAFEEIRA DE MONTANHA] Barbosa, D.H.S.G.1; Vieira, H.D.1; Souza, R.M.1; Rodrigues, W.P.1;Filho, J.C.R.1; Pinto, J.F.2 1Universidade Estadual do Norte Fluminense Darcy Ribeiro/CCTA, Av. Alberto Lamego 2000,28013-620 Campos dos Goytacazes, RJ, Brazil; 2MAPA/PROCAFE. E-mail: [email protected]

Accurately predicting yield losses due to nematodeparasitism is one of the most difficult tasks in agriculturalNematology, particularly in perennial crops. In Rio deJaneiro State, Brazil, more than half of the coffeeplantations are parasitized by M. exigua, a nematode thataccording to short-term assays may cause yield losses ofup to 45%. The goal of this five-year-long experiment wasto establish the damage threshold for coffee-parasitic M.exigua under field conditions. A M. exigua-infested, 9-year-old commercial plantation (‘IAC Catuaí Vermelho 144’) was

divided in plots and subjected to nematicide (Terbuphos®)treatment at 0.5, 1, 1.5 or 2 times the recommended dosage,applied twice during the rainy seasons of 2004-2008. Eachtreatment (dosage) was applied in five replicates, eachconsisting of tree lines of 8 plants each, in a randomizeddesign in which buffer lines and plants were used. A controlcheck was established with no nematicide treatment. Thesoil nematode population (J2/100 cc of soil) and the densityof nematode-induced root galls/g of root were assessedevery 45 days from December 2004 through July 2008. The

370 Vol. 33(4) - 2009


productivity was evaluated in 2005-2008 and expressed in60 Kg-bags/hectare (ha). The plantation was conductedunder optimal conditions regarding fertilization, pest anddisease management. The five nematicide dosages createdfive different levels of soil J2 infestation, which remainedduring the study. The density of galls/g of root was reducedby about half upon the start of the nematicide applications,but there was little difference among the nematicide dosages.This indicates that in highly infested coffee plantations thereexists a tremendous surplus of J2 in the soil, with as little as5-10 J2/100 cc of soil resulting in as many as 100 galls/g

of root. Because no differentiation was achieved amongthe treatments (dosages) in the density of galls/g of root,their productivity in four harvests was similar (average of52-60 bags/ha). Apparently, the vigorous vegetationexperienced by the plants that received nematicide resultedin excessive shading of the plants` lower branches,restricting fruit bearing to the top branches, whichcompromised the analysis of the nematode effect on theproductivity. As practiced by coffee growers, the plantationwas pruned at 14 years of age, and this experiment willcontinue for another four-year period.

175 – QUANTIFICATION OF DAMAGE CAUSED BY Meloidogyne exigua IN COMMERCIAL CROP OFCoffea arabica L. IN NORTHWEST FLUMINENSE REGION [QUANTIFICAÇÃO DO DANO CAUSADOPOR Meloidogyne exigua EM LAVOURA COMERCIAL DE Coffea arabica L. NA REGIÃO NOROESTE FLUMINENSE]Barbosa, D.H.S.G.1; Vieira, H.D.1; Souza, R.M.1; Rodrigues, W.P.1; Filho, J.C.R.1; Pinto, J.F.2 1 Universidade Estadual doNorte Fluminense Darcy Ribeiro, CCTA, Av. Alberto Lamego 2000, 28013-620 Campos dos Goytacazes, RJ, Brazil.2Foundation MAPA/PROCAFE. E-mail:[email protected]

In field conditions it is very difficult to predict cropresponses to different densities of nematodes. In Rio deJaneiro State, more than 50% of crops are infested by M.exigua, with loss of productivity of up to 45%. The objectiveof this work was to quantify the level of economic damageof M. exigua in a commercial coffee crop. The experimentwas installed in a coffee crop of IAC Catuai red 144 cultivarinfested by M. exigua, with nine years of age, spacing of1.70 x 1.0 m in Varre-Sai - RJ. A completely randomizeddesign was used, consisting of 5 treatments with plots of24 plants (3 lines of 8 plants, evaluating six plants of thecentral line) with five replications. To obtain different levelsof the nematode population, different doses of terbufosnematicide were applied (zero to twice the commercial doserecommended) in two seasons. The population level of M.exigua was monitored, determining the number of second-stage juveniles in soil (J2/100 cc) and number of galls pergram of root (NG). The evaluations occurred in an intervalof 45 days and with the applications of nematicideoccurring in December (2004, 2005, 2006 and 2007) andMarch (2005, 2006, 2007 and 2008). The application of

nematicide was done with rattle, and the dose delivered todifferent points of application under the coffee “skirt” (0,2, 4, 6 and 8), according to the treatment, the commercialdose of 35 kg / ha (dose 1). The productivity of eachtreatment was obtained in the crop years of 2005 to 2008.The results showed that population fluctuation in trackedsoil (J2/100 cc) and roots (NG) behaved differently in theassessments with opposite trends, that is, during the rainyseason reduction in the population of the soil was observedand increase of NG with the emission of roots. However,there was less fluctuation in NG when compared to thepopulation of soil. The effect of the application ofnematicide was more effective for variable J2/100 cc.Although the level of nematode population was falling, thisis not reflected in significant increases in productivity. Inthis work, a threshold of economic damage was notobtained, because of the “closing” of plant tops (densityof the plants). The plots treated with nematicides showedhigh growth, resulting in death of lower branches,concentrating production in the highest part of the plant(plant top) and reducing its productive potential.

176 – AVALIAÇÃO DE CARACTERÍSTICAS DE CRESCIMENTO DE TOMATEIROS PARASITADOS PORDIFERENTES NÍVEIS POPULACIONAIS DE M. javanica [EVALUATION OF GROWTH CHARACTERISTICSOF TOMATO PLANTS INFECTED BY DIFFERENT POPULATION LEVELS OF M. javanica] Belan, L.L.1; Fonseca,S.O.1; Alves, F.R.1; Filho, J.C.1; Jesus Júnior, W.C.1 1Universidade Federal do Espirito Santo, Centro de Ciências Agrárias.Alto universitário s/n, Centro, C.P 16 29500-000 Alegre, ES, Brazil. E-mail: [email protected]

O tomateiro é uma hortaliça atacada por inúmerospatógenos, entre eles os nematóides formadores de galhas,principalmente M. incognita e M. javanica. A quantificação

dos danos causados por esses patógenos é essencial para aelaboração de programas adequados de manejofitossanitário, todavia, são escassas as pesquisas sobre esse



371

tema. Objetivou-se, com este trabalho, avaliar a influênciado parasitismo de níveis crescentes de inóculo de M. javanica(0, 2000, 4000, 6000 e 8000 ovos/planta) sobre algumascaracterísticas de crescimento de cinco genótipos detomateiros (4 acessos tipo cereja, denominados acessos 01,02, 03, 04 e 05 e a cultivar Santa Clara). Assim, oexperimento foi conduzido em esquema fatorial 5 x 5(genótipos de tomateiro x níveis de inóculo do nematóide)em delineamento inteiramente casualizado com 8 repetiçõesem casa-de-vegetação do Centro de Ciências Agrárias da

Universidade Federal do Espírito Santo. Trinta e cinco diasapós a inoculação das plantas com os nematóides foramavaliados o diâmetro do caule (DC) e a altura das plantas(AP). Houve interação entre os fatores analisados. Verificou-se redução significativa no DC das plantas dos acessos 02 e03 à medida que se aumentou o nível populacional denematóides. Para a característica AP houve efeito significativodos tratamentos somente para a cultivar Santa Clara, queapresentou maiores valores dessa característica quando asplantas receberam maiores níveis de inóculo dos nematóides.

177 – EFEITO DE NÍVEIS CRESCENTES DE INÓCULO DE M. javanica SOBRE A ÁREA FOLIAR DETOMATEIROS [EFFECT OF INCREASING INOCULUM LEVELS OF M. javanica ON LEAF AREA OF TOMATO]Belan, L.L.1; Fonseca, S. O.1; Alves, F.R.1; Costa, F.P.1; Souza, A.F.1; Jesus Júnior, W.C.1 1Universidade Federal do EspiritoSanto, Centro de Ciências Agrárias, Alto universitário s/n, Centro, C. P 16 29500-000, Alegre, ES, Brazil. E-mail:[email protected]

A cultura do tomateiro pode ser afetada por inúmerosfatores bióticos e abióticos com potencial de causarexpressiva redução de produtividade. Dentre os patógenos,destacam-se os nematóides formadores de galhas,Meloidogyne spp. Há muitos trabalhos sobre os danoscausados por patógenos foliares, mas poucos são aquelesque fazem alusão aos patógenos radiculares, entre eles osfitonematóides. Neste trabalho, conduzido em casa-de-vegetação no Centro de Ciências Agrárias da UniversidadeFederal do Espírito Santo, avaliou-se o efeito de níveiscrescentes de inóculo de M. javanica sobre a área foliar de

cinco genótipos de tomateiro. O experimento foi conduzidoem delineamento inteiramente casualizado, sob esquemafatorial 5 x 5 (4 acessos de tomateiro cereja, quais sejam:01, 02, 03, e 04 e a cultivar Santa Clara x 5 níveis iniciais deinóculo do nematóides, ou seja, 0, 2000, 4000, 6000 e 8000ovos/planta) com oito repetições. As plantas foraminoculadas no ato transplantio e, após 35 dias da inoculação,foi determinada a área foliar e o percentual de redução daárea foliar (%RAF). Observou-se crescente %RAF dostomateiros em relação à testemunha, principalmente paraas plantas inoculadas com 6000 nematóides.

178 – INFLUÊNCIA DE DIFERENTES NÍVEIS POPULACIONAIS DE M. javanica SOBRE A PRODUÇÃODE MATÉRIA SECA DE TOMATEIROS [INFLUENCE OF DIFERENT POPULATION LEVELS OF M. javanicaON PRODUCTION OF DRY MATTER OF TOMATO] Belan, L. L.1; Fonseca, S. O.1; Alves, F. R.1; Costa, F.P.1; Souza,A.F.1; Matta, P.M.1 Jesus júnior, W.C.1 1Universidade Federal do Espirito Santo, Centro de Ciências Agrárias. Alto universitários/n, Centro, C. P. 16 29500-000 Alegre, ES, Brazil. E-mail: [email protected]

Vários patógenos radiculares podem afetar a cultura dotomateiro reduzindo sua produtividade, com destaquepara os nematóides de galhas, Meloidogyne spp. Como sãoescassos os trabalhos sobre quantificação de danoscausados por patógenos radiculares, entre eles osfitonematóides, decidiu-se avaliar o efeito de níveiscrescentes de inóculo de M. javanica sobre produção dematéria seca de cinco genótipos de tomateiro. Oexperimento foi conduzido em casa-de-vegetação noCentro de Ciências Agrárias da UFES em delineamentointeiramente casualizado em esquema fatorial 5 x 5 (4

acessos de tomateiro cereja, a saber: 01, 02, 03 e 04 e acultivar Santa Clara x 5 níveis iniciais de inóculo donematóide, isto é, 0, 2000, 4000, 6000 e 8000 ovos/planta) com oito repetições. No ato do transplantio, asplantas foram inoculadas com os respectivos níveispopulacionais de nematóides e, 35 dias mais tarde,avaliou-se a matéria seca das folhas (MSF) e matéria secatotal (MSC). Houve interação entre os fatores analisados.Observou-se redução significativa para ambas ascaracterísticas avaliadas somente para o acesso 02, sendoessa redução mais acentuada para MSF.

372 Vol. 33(4) - 2009


179 – FIELD ASSESSMENT OF COFFEE (Coffea arabica) CULTIVARS IN FIELDS IN RIO DE JANEIROSTATE, BRAZIL, INFESTED WITH OR FREE OF Meloidogyne exigua- [AVALIAÇÃO A CAMPO DECULTIVARES DE CAFÉ EM ÁREAS INFESTADAS COM Meloidogyne exigua OU ISENTAS, NO ESTADO DO RIODE JANEIRO, BRASIL] Barbosa, D.H.S.G.1; Vieira, H.D.1; Souza, R.M.1; Rodrigues, W.P.1; Filho, J.C.R.1; Pinto, J.F.21Universidade Estadual do Norte Fluminense Darcy Ribeiro/CCTA, Av. Alberto Lamego, 2000, Campos dos Goytacazes,RJ, Brazil; 2Fundação Procafe/MAPA.

A five-year field assessment of M. exigua--susceptible and–resistant coffee cultivars was conducted in two fields,infested with or free of nematodes, in Rio de Janeiro State,Brazil. The nematode-susceptible cultivars ‘IAC CatuaíVermelho 144’, ‘Obatã’ and ‘Tupi’, self-rooted or graftedonto the nematode-resistant ‘IAC Apoatã 2258’, werecompared in their vegetative development (plant height,number of plagiotropic branches and collar diameter) andproductivity (during four harvests) with the nematode-resistant ‘Acauã’, ‘Catucaí 785/15’ and ‘Iapar 59’. The highnematode population drastically reduced the vegetative

development and productivity of all cultivars, regardlessof their nematode-resistance or the use of the resistantrootstock ‘IAC Apoatã 2258’. This indicates that in regionswith widespread incidence of M. exigua, as in Rio de JaneiroState, coffee growers should be discouraged from cultivatingself-rooted, nematode-susceptible cultivars even if theirfields are initially free of nematodes, because a futureinfestation may reduce their revenues over the plantationlife span. Also, it is crucial that nematode-suppressingmeasures are taken before planting the currently availableM. exigua-resistant genotypes to avoid enormous yield losses.

180 – INFLUENCE OF Meloidogyne mayaguensis PARASITISM IN THE NUTRIENT LEVEL IN LEAVESAND PHENOLOGY OF THE GUAVA ‘PALUMA’ [INFLUÊNCIA DO PARASITISMO POR Meloidogyne mayaguensisNOS NÍVEIS DE NUTRIENTES EM FOLHAS E NA FENOLOGIA DE GOIABEIRA ‘PALUMA’] Almeida, E.J.1;Santos, J.M.1; Alves, G.C.S.1 1Universidade Estadual Paulista, Faculdade de Ciências Agrárias e Veterinárias, Departamentode Fitossanidade, Via de acesso Prof. Paulo Donato Castelane, s/n. 14887-900.

The reduction in vigor of guava parasitized by Meloidogynemayaguensis is a consequence of changes in root system, andthis infection triggers a syndrome characterized bysymptoms of nutritional imbalance. To characterize it,chemical analysis of three types of leaves was performed(leaves without symptoms, with symptoms considered mildand severe) and soil of guava ‘Paluma’ in two periods:February and August. The plants were grown with andwithout inoculation of the nematode guava, for two years,in microplots in the Department of Plant Pathology ofUNESP/FCAV. The levels of N, P and K are lower in leaveswithout symptoms than in leaves with mild and severesymptom in the analysis carried out in two seasons. Caconcentration was increased as symptoms worsened in both

seasons, and Mg did not change in February, while in Augustit also showed higher concentration in leaves with severesymptoms than in leaves with mild symptoms or withoutsymptoms. S had a higher concentration in leaves withoutsymptoms, and the analysis conducted in February and inAugust showed that the leaves with severe symptoms hadhigher concentrations of S. The content of B did not differregarding the presence or absence of symptoms and timeof analysis. Cu and Fe concentrations increased in February,along with severity of symptoms. The content of Zndecreased with increasing degree of severity on the leaves,at both assessment times. The phenology of guava ‘Paluma’was not affected by parasitism of M. mayaguensis at the firstflowering.

181 – EFEITO DE DENSIDADES POPULACIONAIS DE Meloidogyne javanica SOBRE PLANTAS DETectona grandis [EFFECT OF POPULATION DENSITIES OF Meloidogyne javanica ON Tectona grandis] Oliveira, A.S¹;Silva, R.A¹; Sena, A.¹ ¹Agronomia/UNIVAG, Av. Dom Orlando Chaves, 2655, Cristo Rei, 78118-000 Várzea Grande, MT,Brazil. E-mail: [email protected]

A Teca (Tectona grandis L.f.) é uma essência florestal deorigem asiática com alto valor comercial. Os primeirosplantios no Estado de Mato Grosso datam de 1968 eatualmente o cultivo supera 40.000 ha, porém, no ano de2003 observou-se a ocorrência de Meloidogyne javanica

parasitando plantas no Médio Norte do Estado. Sendoassim, o objetivo desse trabalho foi avaliar o efeito dediferentes níveis populacionais de M. javanica sobre odesenvolvimento de plantas de Teca. O experimento foiconduzido em telado de sombrite com 50% de



373

sombreamento no campo experimental do UNIVAG,Várzea Grande, MT. O delineamento experimental foiinteiramente casualizado, com cinco tratamentos e cincorepetições. Mudas de Tectona grandis com 30 dias de idadeproduzidas a partir de sementes e acondicionadas em sacosde polietileno, foram transplantadas para vasos comcapacidade de 3L de solo e inoculadas com 750, 1000, 1500,3000 juvenis e ovos de M. javanica, e testemunha semnematóide. Após 120 dias da inoculação, o efeito dasdensidades populacionais do nematóide foram avaliadas, com

base no peso fresco das raízes, peso seco da parte área, alturadas plantas e fator de reprodução (Pf/Pi). Os resultadosindicaram que a Teca apresenta tolerância ao nematóide, poisnão houve diferença significativa em relação aos parâmetrosavaliados. Por outro lado observou-se que essa planta é umaboa hospedeira do nematóide, pois os fatores de reproduçãoforam superiores a 1,0 variando de 2,6 a 10,0. Portanto essesresultados comprovam a importância do nematóide comopatógeno da Teca e justifica a necessidade de trabalhosposteriores que envolvam esse patossistema.

182 – INFLUÊNCIA DA INFECÇÃO DE RAÍZES DE SOJA POR NEMATOIDES NA QUALIDADE DASSEMENTES [INFLUENCE OF SOYBEAN ROOT INFECTION BY NEMATODES ON SEED QUALITY] Becaro,C.K.¹; Alves, G.C.S.¹; Soares, P.L.M.²; Franco, D.³; Múscari, A.M.4; Santos, J.M.² ¹FCAV/Unesp; ²UNESP/FCAV, Câmpusde Jaboticabal; ³FarmConsultor/GTACC;4UNESP/Jaboticabal, SP, Brazil. E-mail: [email protected]

A cultura da soja tem grande importância para oagronegócio brasileiro e os danos ocasionados pornematóides variam de imperceptíveis até ocomprometimento econômico da produção. Como ainfecção por nematóides altera todos os processosfisiológicos da planta, além de variáveis quantitativas, assementes produzidas por plantas infectadas podem não tera mesma qualidade daquelas produzidas por plantas sadias.Essa hipótese foi testada em um experimento numa lavouracomercial de soja da variedade Codetec CD-214, infestadapor nematoides, na Fazenda de Ensino, Pesquisa e Produçãoda FCAV/UNESP, Câmpus de Jaboticabal-SP. Em marçode 2008 foi constatada a presença de reboleirascaracterísticas do ataque de nematoides na lavoura. Então,foram coletadas oito amostras compostas de solo e raízes,sendo quatro dentro de diferentes reboleiras e quatro emáreas aparentemente sadias, dentro do mesmo talhão.Também, foram coletadas amostras compostas de 30plantas, nos mesmos locais de coletas das amostras de soloe raízes, totalizando 240 plantas, em fase final de ciclo, paraas avaliações da porcentagem de germinação, índice develocidade de germinação e massa de 100 sementes. Outrasvariáveis complementares tais como altura das plantas,

número de vagens por planta, número de sementes porvagens e produção total das plantas também foramconsideradas. Nas amostras de solo e raízes, foramencontrados Rotylenchulus reniformis, Pratylenchus brachyurus,Meloidogyne sp. e Helicotylenchus dihystera, sendo que R. reniformisfoi a espécie predominante nas amostras de raízes. Assementes coletadas de plantas das áreas sadias apresentaramporcentagem de germinação de 63,83%, muito superior aos26,88% das sementes de plantas coletadas nas reboleiras.O mesmo ocorreu com o índice de velocidade degerminação, sendo 25,07 nas sementes das áreas sadias e9,10 nas sementes coletadas nas reboleiras. As médiasda altura das plantas e do número de vagens por planta,assim como da massa total de sementes produzidas nasplantas das reboleiras foram menores que nas de foradas reboleiras e, também, difer iram a 1% deprobabilidade pelo Teste F. Entretanto, não houvediferença significativa entre as médias das massas de 100sementes em ambas situações. Por conseguinte, essesdados indicam que além da redução na produtividade, ainfestação dos campos de produção de sementes de sojapor nematoides pode resultar, também, em redução naqualidade das sementes.

183 – VIGOR DO CAFEEIRO CONILON (Coffea canephora) NA FASE DE MATURAÇÃO DOS FRUTOS,EM CONDIÇÕES DE CAMPO INFESTADO POR Meloidogyne incognita [VIGOR OF CONILON COFFEE(Coffea canephora) IN FRUIT RIPENING PHASE, UNDER Meloidogyne incognita INFESTATION CONDITIONS] Lima,I.M.1; Costa, A.2; Oliveira, E.B.2 1Instituto Capixaba de Pesquisa, Assistência Técnica e Extensão Rural, C.P 62, 29915-140Linhares, ES, Brazil; 2ITC, Fapes. E-mail: [email protected]

Existe uma carência de informações científicas eagronômicas sobre o patossistema clones de conilon vsMeloidogyne spp. O objetivo deste trabalho foi avaliar o efeitodo parasitismo de M. incognita no vigor do cafeeiro conilon

clone 12 V da variedade ‘Vitória – INCAPER 8142’ naépoca de maturação dos frutos. Quarenta e cinco dias antesda colheita foram amostrados cafeeiros com 3 anos de idadeem lavoura irrigada. A lavoura, localizada no município de

374 Vol. 33(4) - 2009


Sooretama-ES, é formada alternadamente por 7 linhas doclone 12V e 1 linha da variedade G35, sob solo argilosonaturalmente infestado de M. incognita. Foram selecionadasaleatoriamente plantas e divididas em três tratamentos deacordo com a quantidade de nematóides no solo: (T1: 0;T2: 122 ±61 e T3: 402 ±123 J2/200cc). Cadatratamento conteve 10 repetições (planta). Os cafeeiros queapresentaram, em sua rizosfera, maior quantidade de J2tiveram a maior redução nas variáveis analisadas. No T3, a

altura de planta teve uma redução de 38%, 266% no númerode folhas/planta e 28% na área foliar. A quantidade deramos produtivos e vegetativos foram respectivamente 30%e 119% menores, assim como o número de rosetas/ramo(20%) e frutos/ramo (66%) quando comparadas com aplanta sadia. Portanto o parasitismo interferiunegativamente no vigor do clone 12 V. Apoio: Fundaçãode Apoio à Ciência e Tecnologia do Espírito Santo —FAPES

184 – TEORES FOLIARES DE NUTRIENTES DO CAFEEIRO CONILON (Coffea canephora) NA ÉPOCADE MATURAÇÃO DOS FRUTOS,EM FUNÇÃO DO PARASITISMO DE Meloidogyne incognita [NUTRIENTCONTENT OF CONILON COFFEE LEAVES (Coffea canephora) IN FRUIT-RIPENING SEASON IN FUNCTIONOF Meloidogyne incognita INFESTATION [] Lima, I.M.1; Costa, A.2; Oliveira, E.B.2; Serrano, L.A.L.3 1Instituto Capixaba dePesquisa, Assistência Técnica e Extensão Rural, C. P. 62, 29915-140 Linhares, ES, Brazil; 2ITC, Fapes; 3Incaper/CRDRNordeste, Brazil. E-mail: [email protected]

Os clones de cafeeiro conilon oriundos de seleções feitasnos programas de melhoramento genético do Incaperapresentam elevado potencial produtivo, com alta exigêncianutricional e grande acúmulo de nutrientes em seus órgãos.A meloidoginose vem apresentando sintomas severos emalguns clones de conilon em lavouras do Estado do EspíritoSanto. O objetivo deste trabalho foi avaliar os teores foliaresde nutrientes no cafeeiro conilon clone 12 V da variedade‘Vitória – INCAPER 8142’, com 36 meses de idade naépoca de maturação dos frutos. Foram coletadas amostrasnuma lavoura irrigada, localizada no município deSooretama-ES, formada alternadamente por 7 linhas doclone 12V e 1 linha da variedade G35, em solo argiloso

naturalmente infestado de M. incognita. Foram selecionadasaleatoriamente plantas e divididas em três tratamentos deacordo com a quantidade de nematóides no solo: (T1: 0;T2: 122 ±61 e T3: 402 ±123 J2/200cc). Cada tratamentoconteve 10 repetições (planta). Os resultados mostraramque os cafeeiros com a maior quantidade de nematóidesno solo apresentaram menores teores foliares de N e P.Não houve diferença entre os tratamentos para os teoresfoliares de Ca e Mg. Os cafeeiros com nematóidesapresentaram os maiores teores foliares de B, Cu, Fe eZn, e os menores teores foliares de Mn. Apoio:Fundação de Apoio à Ciência e Tecnologia do EspíritoSanto — FAPES

185 – CARACTERÍSTICAS QUANTITATIVAS E QUALITATIVAS DE FRUTOS DE CAFEEIRO CONILON(Coffea canephora) ORIUNDOS DE PLANTAS PARASITADAS POR Meloidogyne incognita [QUANTITATIVEAND QUALITATIVE CHARACTERISTICS IN CONILON COFFEE FRUIT (Coffea canephora) FROM PLANTSINFESTED BY Meloidogyne incognita ] Lima, I.M.1; Costa, A.2; Oliveira, E.B.2 1Instituto Capixaba de Pesquisa, AssistênciaTécnica e Extensão Rural, C. P. 62, 29915-140 Linhares, ES, Brazil; 2ITC, Fape. E-mail: [email protected]

Com aumento na demanda pelo café Conilon, seu cultivovem se mostrando sempre crescente. Entretanto, a culturavem apresentando problemas fitossanitários dentre os quaisa meloidoginose. O objetivo deste trabalho foi avaliar aprodução e a qualidade dos grãos do cafeeiro conilon clone12 V da variedade ‘Vitória – INCAPER 8142’. Foramcoletadas amostras numa lavoura de 3,5 ha, com 36 mesesde idade, irrigada e localizada no município de Sooretama-ES, formada alternadamente por 7 linhas do clone 12V e 1linha da variedade G35, em solo argiloso naturalmenteinfestado de M. incogni ta . Foram selecionadas

aleatoriamente plantas e divididas em três tratamentosde acordo com a quantidade de nematóides no solo: (T1:0; T2: 122 ±61 e T3: 402 ±123 J2/200cc). Cadatratamento conteve 10 repetições (planta). O parasitismode M. incognita interferiu negativamente tanto naprodução quanto na qualidade dos grãos beneficiados.O T3 teve uma redução de 237% na sua produção eacréscimo de 4% no número de fruto moca e 96% nonúmero de frutos bóia em relação a testemunha T1.Apoio: Fundação de Apoio à Ciência e Tecnologia doEspírito Santo — FAPES



375

186 – TEORES FOLIARES DE NUTRIENTES NA GOIABEIRA ‘PALUMA’ PARASITADAS POR Meloidogynemayaguensis [NUTRIENT CONTENT OF LEAVES FROM ‘PALUMA’ GUAVA INFESTED BY Meloidogyne mayaguensis]Lima, I.M.1; Serrano, L.A.L.2; Oliveira, E.B.3; Costa, A.3 1Instituto Capixaba de Pesquisa, Assistência Técnica e ExtensãoRural, C. P. 62, 29915-140 Linhares, ES, Brazil; 3Incaper/CRDR Nordeste; 3ITC, Fapes. E-mail: [email protected]

No fim do ciclo produtivo da goiabeira, parasitada porMeloidogyne mayaguensis (Mm), é constatada na planta aocorrência de folhas de diferentes colorações, sintomassimilares à deficiência nutricional. O objetivo deste trabalhofoi avaliar os teores foliares de nutrientes em função dacoloração apresentada pela folha. O trabalho foi realizadonos municípios de Pedro Canário e Montanha-ES, em oitopomares distintos de goiabeira ‘Paluma’, com idade,fenofase e tratos culturais semelhantes, e que apresentavamplantas sadias e plantas parasitadas por Mm e com sintomasvisuais do parasitismo. Em cada pomar foram coletadas,em média, 100 folhas localizadas no 3º ou 4º par do ramoa partir do ápice, sendo estas divididas em folhascompletamente roxas-bronzeadas (T1); folhas amareladascom bordas levemente roxas-bronzeadas (T2); folhas

completamente amareladas (T3); e folhas verde-escurasobtidas de plantas sadias (T4). As amostras foramencaminhadas ao Laboratório de Análise Foliar doINCAPER para quantificação dos teores foliares denutrientes. As folhas dos T1, T2 e T3 (folhas com sintomas)apresentaram menores teores de N, P e K em relação aoT4 (folhas sadias). As folhas do T1, com o sintoma visualmais característico da doença, apresentaram o menor teorde Mg. Os teores foliares de Ca tiveram pouca variaçãoentre os tratamentos. Com relação aos teores foliaresdos micronutrientes B, Cu, Fe, Mn e Zn, não houvediferenças entre as amostras. Concluiu-se que o ataquede Meloidogyne mayaguensis influencia os teores foliares demacronutrientes da goiabeira. Apoio: Banco Nacionaldo Nordeste - BNB

187 – CARACTERÍSTICAS DE FRUTO DE GOIABEIRA ‘PALUMA’ COLHIDOS DE PLANTASPARASITADAS POR Meloidogyne mayaguenis [CHARACTERISTICS OF ‘PALUMA’ GUAVA FRUITSHARVESTED FROM PLANTS INFESTED BY Meloidogyne mayaguensis] Lima, I.M.1; Oliveira, E.B.1; Costa, A.1; Martins,M.V.V.2 1Instituto Capixaba de Pesquisa, Assistência Técnica e Extensão Rural, C. P. 62, 29915-140 Linhares, ES, Brazil;2EMBRAPA, CNPAT, 60511-110 Fortaleza, CE, Brazil. E-mail: [email protected]

Os frutos oriundos de goiabeiras parasitadas por Meloidogynemayaguensis (Mm) apresentam uma diversidade de tamanhoe formas. O objetivo deste trabalho foi avaliar ascaracterísticas morfométricas e qualitativas em função dopeso fresco (g) apresentado pelo fruto colhido “de vez”em plantas sadias e em plantas parasitadas por Mm. Oexperimento consistiu de nove intervalos de peso, sendoaqui apresentados os tratamentos mais representativos daprodução T1 (25-50); T2 (75-100); T3 (100-130) e, T4 (160-200). Os frutos foram colhidos, na primeira quinzena deabril/09, aleatoriamente, em lavoura comercial, com 5 anosde idade, localizada no município de Montanha-ES. Paracada tratamento houve 10 repetições (frutos) sendo que osfrutos do T4 foram colhidos de plantas sadias. No

laboratório de Fisiologia Vegetal do INCAPER foram feitasas medidas morfométricas externas e internas compaquímetro digital, analisada a densidade, o teor de sólidossolúveis totais (SST) e acidez total titulável (ATT). O T4apresentou as maiores médias para peso, matéria seca,largura e comprimento externo do fruto, comprimentoda cavidade interna e espessura da polpa. No entanto, alargura da cavidade interna do fruto não apresentoudiferença entre os T2, T3 e T4, média de 39 mm. Os T2e T3 apresentaram a espessura da polpa similares. Adensidade e ATT foram maiores no T1. Os T2, T3 e T4não foram influenciados pelo peso do fruto em relaçãoa SST e SST/ATT. Apoio: Banco Nacional Nordeste -BNB

188 – EFEITO DA PODA DE FRUTIFICAÇÃO E DO PARASITISMO DE Meloidogyne mayaguensis NAPRODUÇÃO E NAS CARACTERÍSTICAS MORFOMÉTRICAS DE FRUTOS DE GOIABEIRA ‘PALUMA’[EFFECT OF PRUNING FRUIT AND Meloidogyne mayaguensis INFESTATION ON THE YIELD ANDMORPHOMETRIC CHARACTERISTICS OF GUAVA CV. PALUMA] Lima, I.M.1; Costa, A.2; Oliveira, E.B.2; Martins,M.V.V.3 1Instituto Capixaba de Pesquisa, Assistência Técnica e Extensão Rural, C. P. 62, 29915-140 Linhares, ES, Brazil;2Fapes; 3EMBRAPA, CNPAT, 60511-110 Fortaleza, CE, Brazil. E-mail: [email protected]

O nematóide da goiabeira Meloidogyne mayaguensis (Mm) vemcausando severos danos à cultura da goiabeira

nacionalmente. O objetivo deste trabalho foi avaliar aprodução e as características morfométricas dos frutos de

376 Vol. 33(4) - 2009


‘Paluma’, sob o efeito da poda de frutificação e doparasitismo de M. mayaguensis. O experimento, instalado sobDIC em esquema fatorial (2x2) foi realizado em pomarcomercial com 5 anos de idade no município de Montanha-ES. Foram selecionadas plantas com característicassemelhantes quanto ao vigor e porte. Os tratamentos foram:plantas submetidas à poda de frutificação parasitada porMm (T1) e sem parasitismo (T2), planta sem poda defrutificação e parasitada por Mm (T3) e sem parasitismo(T4), cada tratamento teve 7 repetições (planta). As plantasforam podadas em 05/11/08 e a população de J2 no solofoi quantificada. O número de frutos/planta (NFP) e o

peso médio dos frutos (PMF) foram maiores nas plantaspodadas e sem parasitismo (T2). Para essa época de poda,e independentemente do parasitismo, as plantas nãosubmetidas à poda de frutificação apresentaram os menoresPMF e NFP. Independente da poda, não houve diferençasentre o comprimento e largura dos frutos entre as plantasparasitadas. O T3 teve o PMF e NFP reduzido 45,60 e56,05% em relação a T2, respectivamente. Pode-se concluirque a poda de frutificação só produz efeito quando não háparasitismo de Mm, no entanto os T3 e T4 tiveram sempreas menores médias. Apoio: Banco Nacional do Nordeste –BNB.

Section 6 - Biological control

189 – BIOLOGICAL CONTROL OF Meloidogyne incognita IN GRAPEVINE CV. BONARDA WITHTrichoderma harzianum, IN MENDOZA PROVINCE, ARGENTINA [CONTROL BIOLÓGICO DE Meloidogyneincognita EN VID CV. BONARDA CON Trichoderma harzianum, BAJO CONDICIONES DE MEDIA SOMBRA, ENMENDOZA, ARGENTINA]. Del Toro, M.S.1; Lafi, J.G.1; Martinotti, M.D.1; Tonda, M.M.1; Roán, J.2; Moyano, E.A.M.1;Bustamante, C.M.1 1Departamento de Ciencias Biológicas, Facultad de Ciencias Agrarias, UNCuyo, Chacras de Coria,Luján de Cuyo, Mendoza, Argentina; 2Facultad de Ciencias Agrarias y Forestales, U.N. La Plata, Buenos Aires, Argentina.E-mail: [email protected]

Grapevine is susceptible to attack by nematodes, whichaffect its performance, growth and longevity. Biologicalcontrol is one of the different alternatives offered byintegrated pest management. Trichoderma harzianum isreferred to as an antagonistic fungus of soil pathogens andplant parasitic nematodes, which produce knots on roots.The aim of this study was to evaluate the possibility ofcontrolling Meloidogyne incognita in grapevine plants withTrichoderma harzianum, biologically. The study was conductedat Facultad de Ciencias Agrarias, U.N.Cuyo, in a plot under50% half-shade mesh. Experimental design was made upof ten randomized blocks with seven treatments. Eachexperimental unit was represented by a 20-liter capacity pot,containing sterile substrate. One-year-old grapevine plantscv. Bonarda, on their own roots, were transplanted in eachpot. The fungus Trichoderma was obtained from an Argentinecommercial liquid formulation (5.108 ufc.ml-1), where 3 mlwasadded to each pot. The treatments were: T1. HealthyControl: plants without Trichoderma or Meloidogyne; T2.Diseased Control: plants inoculated with Meloidogyne at 15DAT (Days After Transplant); T3. Meloidogyne at 15 DATand Trichoderma at 20 DAT; T4. Meloidogyne at 15 DAT and

Trichoderma at 20 and 35 DAT; T5. Trichoderma at 0 DATand Meloidogyne at 15 DAT; T6. Trichoderma at 0 and 30 DAT,and Meloidogyne at 15 DAT; and T7. Trichoderma at 0 and 30DAT and Meloidogyne at 35 DAT. The following variableswere evaluated: plant neck diameter at 0 and 120 DAT;weight of pruned wood at 9 months AT; and number oflive plants per treatment, gall index, root weight andMeloidogyne final population in soil and in roots, at 18 monthsAT. Final population was higher than the original one, inall the treatments but T1. The number of females with eggmasses was lower in T5 and T7. The highest reproductiverates were found when inoculating Meloidogyne prior toTrichoderma. The highest nematode gall index wasencountered in those treatments where only Meloidogyne wasinoculated. Trichoderma inoculation did not prevent theestablishment of nematode-host relationship. Theapplication of Trichoderma in two consecutive doses (T7)showed better results than applying a single dose (T5).Under these study conditions, it was demonstrated thatTrichoderma begins controlling Meloidogyne when theinoculation of the fungus is made on at least one occasion,30 days before plants are infected by Meloidogyne.



377

190 – DISPLACEMENT OF Heterorhabditis amazonensis (RHABDITIDA: HETERORHABDITIDAE) INSEARCH OF Galleria mellonella LARVAE (LEPIDOPTERA: PYRALIDAE) [DESLOCAMENTO DEHeterorhabditis amazonensis (RHABDITIDA: HETERORHABDITIDAE) NA BUSCA POR LARVAS DE Galleria mellonella(LEPIDOPTERA: PYRALIDAE)] Andaló, V.1; Santos, V.2; Moreira, G.F.1; Moreira, C.1; Freire, M.1, Moino Jr., A.11Universidade Federal de Lavras, C.P. 3037, 37200-000 Lavras, MG, Brazil; 2Universidade de São Paulo, ESALQ, C.P. 9,13418-900. Piracicaba, SP, Brazil. E-mail: [email protected]

In the control of insect pests with entomopathogenicnematodes it is important to know their efficiency, verifyingtheir pathogenicity and virulence. Furthermore, it isimportant to evaluate the ability to search for the insecthost, because this factor can influence the success ofcontrolling the target insect. Thus, the objective of this workwas to evaluate the displacement of Heterorhabditisamazonensis on Galleria mellonella larvae to verify thenematode’s ability to search for a host. A corridor of sandwas used, made of polystyrene, measuring 80 cm in length,20 cm in width and 10 cm in height. This was divided in 5parts, using polystyrene pieces, at distances of 10, 20, 40,60 and 80 cm. The nematode was applied at a concentrationof 10,000 infective juveniles (IJ) at the beginning of thecorridor and a G. mellonella larva, kept in a cage (3 x 3 cm),was placed at the end of each division. The IJ suspension

was not applied in the control treatment, only water. Fivereplicates were performed for each distance and the larvaemortality was estimated after 6 days of the release of thenematodes. The data mortality, in terms of displacement,were submitted to a regression analysis. The IJ were capableof causing mortality at distances from 10 to 60 cm; however,the treatment where G. mellonella was placed at 80 cm fromthe nematode did not cause mortality in the larvae. Thepercentage of mortality at distances of 10, 20, 40 and 60decreased, whereas at the first two there was 100% mortalityof larvae, while at 40 cm 80% mortality was obtained andat 60 cm 60% of larvae mortality was obtained. There wasno larvae mortality in the control treatment. In this way, agood potential was observed for H. amazonensis IJ to find,infect and kill larvae of G. mellonella at distances up to 60cm under the evaluated conditions.

191 – AVALIAÇÃO DE RIZOBACTÉRIAS VISANDO O CONTROLE DE Meloidogyne mayaguensis[ASSESSMENT OF RHIZOBACTERIA FOR THE CONTROL OF Meloidogyne mayaguensis] Almeida, A.M.1; Gomes,V.M.1; Souza, R.M.1; Vieira, J.R.2 1Universidade Estadual do Norte Fluminense Darcy Ribeiro/CCTA/LEF, Av. AlbertoLamego 2000, 28015-620 Campos dos Goytacazes, RJ, Brazil; 2Embrapa Rondônia, BR 364, km 5,5, Porto Velho, RO,Brazil. E-mail: [email protected]

Bactérias promotoras de crescimento, dentre elasrizobactérias, vêm sendo avaliadas para o controle denematoses em diversas culturas agrícolas. Neste trabalhoobjetivou-se avaliar 45 isolados de rizobactérias obtidos depomares de goiaba em Cachoeiras de Macacu e São Joãoda Barra (RJ) para o controle de M. mayaguensis. Para cadaisolado, estacas herbáceas de goiabeira ‘Paluma’ foramplantadas em substrato à base de casca de arroz carbonizada,vermiculita e Osmocote®, e 30 dias após a região do calofoi imersa em suspensão de células (0,4 A a 540 nm) por 8hs. Como controle utilizou-se a imersão de estacas emágua estéril. A seguir, as estacas foram enraizadas por90 dias em sacolas de 5L do mesmo substrato einoculadas com 2000 J2 de M. mayaguensis em 20 ml deágua aplicados em orifícios em torno da planta. Odelineamento estatístico foi em blocos ao acaso, com 46tratamentos e seis repetições (uma planta/sacola).

Quatro meses após a inoculação com o nematóide, dadosrelativos à reprodução do nematóide (número de ovos+ J2/g de raiz e FR) e ao desenvolvimento vegetativo(altura das plantas, peso de parte aérea, “spad” e pesodas raízes) foram analisados por ANOVA e teste de Scott-Knott a 5%. Não foram obser vadas diferençassignificativas entre os isolados de rizobactérias e atestemunha para as variáveis vegetativas, mas os isolados108, 164, 124, 142, 41v, 117, 65, 107, 116, 123, 49, 25,110, 22, 74, 100, 128, 151, 97, 159, 146, 66 e 63 reduziramsignificativamente (P<0,05) o número de ovos + J2/gde raiz em relação à testemunha e aos demais isolados.Experimentos estão em andamento em pomarescomerciais com o objetivo de comparar os três isoladosde rizobactéria mais promissores (108, 117 e 164) comprodutos comerciais biológicos que têm sidocomercializados como eficientes contra M. mayaguensis.

378 Vol. 33(4) - 2009


192 – EVALUATION OF POSTURE WEIGHT AND WEIGHT OF ENGORGED FEMALES OF Rhipicephalus(Boophilus) microplus SENSITIVE AND RESISTANT STRAIN AFTER ENTOMOPATHOGENICNEMATODES Heterorhabditis indica LPP4 AND H. baujardi LPP7 (RHABDITIDA:HETERORHABDITIDAE) APPLICATION [AVALIAÇÃO DO PESO DE POSTURA E PESO DE FÊMEASINGURGITADAS DE Rhipicephalus (Boophilus) microplus ESTIRPES SENSÍVEIS E RESISTENTES APÓS APLICAÇÃODE NEMATÓIDES ENTOMOPATOGÊNICOS Heterorhabditis indica LPP4 AND H. baujardi LPP7(RHABDITIDA:HETERORHABDITIDAE)] Machado, I.R.1; Minas, R.S.1; Dolinski,C.M.1 1Universidade Estadual doNorte Fluminense Darcy Ribeiro, Campos, RJ, Brazil. E-mail:claudia.dolinski @censanet.com.br

The cattle tick, Rhipicephalus (Boophilus) microplus Canestrini(Acari: Ixodidae) is one of the most important ectoparasitesof tropical and subtropical regions attacking more than 75%of the world’s cattle population. There is a good prospectfor the use of entomopathogenic nematodes (EPNs) ofthe families Steinernematidae Chitwood & Chitwood, 1937and Heterorhabditidae Poinar, 1976 (Nematoda:Rhabditida) for controlling these ectoparasites. Thesenematodes have been used successfully in biological controlof insect pests in soil. This study aimed to evaluate theinfluence of Heterorhabditis indica LPP4 and H. baujardi LPP7in the posture and engorged female weight of R. (B.)

microplus strains sensitive and resistant to ticks. We testedseven treatments plus the control, represented by differentconcentrations of infective juveniles (15, 30, 60, 120, 240,480 and 960). The weight of both resistant and susceptiblefemales was reduced when the two EPN species wereapplied. The change in weight decreased when theconcentration of the JIs increased. It was observed thatthe change in female weight (initial weight - final weight)was one of the most important parameters to check thetreatment effect. When the weight change was little, it wasbecause the females had insufficient time to release eggs,and because of early death caused by the treatment.

193 – COMPARISON OF RADIAL GROWTH OF EIGHT ISOLATES OF NEMATOPHAGOUS FUNGI INSIX DIFFERENT CULTURE MEDIA [COMPARAÇÃO DO CRESCIMENTO RADIAL DE OITO ISOLADOSDE FUNGOS NEMATÓFAGOS EM SEIS DIFENTES MEIOS DE CULTURA] Medeiros, M.R.M.1; Martinelli, P.R.P.1;Becaro, C.K.1; Santos, J.M.1 1Faculdade de Ciências Agrárias e Veterinárias UNESP, 14884-900 Jaboticabal, SP, Brazil. E-mail: [email protected]

The biological control of nematodes with nematophagousfungi has been widely used worldwide in agriculture as anew tool for management of these pathogens. Theutilization of nematophagous fungi in biological controlrequires mass multiplication of the inoculum in laboratoryand later formulation for field application. This study wascarried out to evaluate the radial growth of Arthrobotrysmusiformis, A. robusta, A. oligospora, Monacrosporiumeudermateum, M. elegans, Pochonia chlamydosporia, Dactylellaleptospora and Paecilomyces lilacinus on six culture media, whichwere: CPDA (commercial potato dextrose agar), NPDA(potato dextrose agar produced with potato in nature),AMD (corn starch and dextrose agar), FAR (rice mealdextrose agar), AA (water agar) and ARR (water ricedextrose agar). The cultures were maintained in these mediain Petri dishes, in average room temperature of 26.5 °C inthe dark. Measurements of radial growth were taken for

15 days with intervals of 48 hours. The AA media promotedfaster and higher radial growth with average of 8.5 cm,statistically differing from the others by the F Test at 1%probability, for the isolates of A. musiformis, M. eudermatum,M. elegans and A. robusta in the assessment of 96 h.Dactylella leptospora grew 8.5 cm and P. chlamydosporia 4.9cm in the evaluation of 288 h. For P. lilacinus the averageradial growth was 8.0 cm, in the evaluation of 288 h.For A. oligospora 8.5 cm of growth was obtained in theevaluation of 144 hours. The AMD media did not favorthe growth of any isolates. The data show that AA ismore suitable for the test of pathogenicity in vitro thenthe others. The media ARR, NPDA and FAR providedmore visual volume of mycelium, and therefore are moresuitable for initial growth of the cultures of these fungiin the production of formulations of these agents foruse in the field.



379

194 – EFFECT OF SUBSTRATES WITH DIFFERENT SOIL TEXTURE CLASSES IN THE MOBILITYOF ENTOMOPATHOGENIC NEMATODE Heterorhabditis baujardi LPP7 (RHABDITIDA:HETERORHABDITIDAE) [EFEITO DO SUBSTRATO COM DIFERENTES CLASSES TEXTURAIS NAMOBILIDADE DO NEMATÓIDE ENTOMOPATOGÊNICO Heterorhabditis baujardi LPP7 (RHABDITIDA:HETERORHABDITIDAE)] Pinto, C.C.S.1; Robaina, R.R.1; Bellini, L.L.1; Dolinski, C.M.1 1UENF/CCTA/Lab.Entomologia e Fitopatologia, 28.013-602, Campos dos Goytacazes, RJ, Brazil. E-mail: [email protected]

Entomopathogenic nematodes (EPNs) (Rhabditida:Heterorhabditidae and Steinernematidae) are used asbiological control agents against many insect pests. As aresult there is great interest in studying the environmentalconditions that may favor their survival and movement inthe soil. The objective of this research was to determinethe effects of different texture classes on mobility of theentomopathogenic nematode Heterorhabditis baujardi LPP7.The IJs were quantified and were adjusted to 10,000infective juveniles (IJs)/30 mL. Bioassays were done in unitsmade from PVC pipes 1 m long X 150 mm in diameter.Galleria mellonella larvae were added to each PVC pipeconfined in metallic screen in each texture class tested:

sandy, sandy clay loam, clay loam and clay. Each pipe wasfilled with soil previously placed in a solar collector andadjusted to 12% humidity. In each class tested, G. mellonellalarvae were placed at 30, 60 and 90 cm. from the IJs applicationpoint. After a 12-day period, larvae and pupae were recovered,and mortality was quantified under a dissected magnifying glassto verify nematode infection. The greatest average mobilityand infectivity occurred at 30 cm in the sand and sandy clayloam classes. The mortality at 60 and 90 cm was only computedfor the sand and sand clay loam classes. There were no larvaeinfected observed in the clay loam class at 60 and 90 cm. Forthe clay class, larvae infection was not observed for all of thedistances evaluated.

195 – BIOLOGICAL CONTROL OF ROOT-KNOT NEMATODES ON POTATO WITH FIVENEMATOPHAGOUS FUNGI [CONTROLE BIOLÓGICO DE Meloidogyne javanica E M. incognita COM UMAFORMULAÇÃO DE CINCO FUNGOS NEMATÓFAGOS NA CULTURA DA BATATA] Martinelli, P.R.P.1; Silva,A.R.1; Andrade, F.C.A.1; Santos, J.M.1; Shimoyama, N.2 1Faculdade de Ciências Agrárias e Veterinárias UNESP, 14884-900Jaboticabal, SP, Brazil; 2Associação Brasileira da Batata ABBA. Email: [email protected]

Nematodes can cause losses in crop quality and potato(Solanum tuberosum L.) quantity, estimated at 12.2% of theworld production. Among the various species of nematodesthat act as parasites of the potato crop in Brazil, Meloidogynejavanica and M. incognita are the most damaging species, sincethey cause losses in the quantity and quality of marketablepotatoes. The study was conducted to evaluate the efficacyof a formulation in sugarcane bagasse comprising fivenematophagous fungi (Arthrobotrys oligospora, Monacrosporiumeudermatum, Pochonia chlamydosporia, Paecilomyces lilacinus andDactylella leptospora) compared to the chemical control ofM. javanica and M. incognita in an irrigated area in the countyof Perdizes/MG. The treatments were 0 (control), 0.5, 1and 2 liters of formulation of the nematophagous fungiper meter, applied at planting, in soil. The BASF productQL AGRI 35, aldicarb (Temik 150g) Carbofuran (Furadan50G), at planting and Caduzafós (Rugby 100G) in the soilat the doses recommended by manufacturers for crops were

included as comparisons. Evaluations of the populationof nematodes in soil and roots, 30 and 60 days after theapplication of treatments and number of tubers withgalls in the collection, and the number of stems per plantand yield were used to compare the effectiveness of thetreatments. The treatments of 1 liter of formulation offungi per meter at planting, 1 liter/meter applied to thesoil and 2 liters/meters of the formulation applied atplanting and in the soil were more efficient in reducingthe number of tubers with galls and statistically differentfrom the others, with averages of 12.5, 9.6, 13.8%,respectively. In control, 45,4% of tubers with galls wereobserved. Biological control also provides a greaternumber of stems per plant. However, the higherproductivity was obtained in Carbofuran and controltreatments, differing statistically from the others. Thenumbers of nematodes in tubers and soil did not differamong the treatments.

380 Vol. 33(4) - 2009


196 – EFFICIENCY EVALUATION OF A FORMULATION FROM FIVE NEMATOPHAGOUS FUNGIFOR Pratylenchus jaehni MANAGEMENT IN CITRUS [AVALIAÇÃO DA EFICÁCIA DE UMA FORMULAÇÃODE CINCO FUNGOS NEMATÓFAGOS PARA O MANEJO DE Pratylenchus jaehni EM CITROS] Martinelli, P.R.P.1;Andrade, F.C.A.2; Medeiros, M.R.M.3; Santos, J.M.4 1Faculdade de Ciências Agrárias e Veterinárias UNESP, 14884-900Jaboticabal, SP, Brazil. E-mail: [email protected]

The citrus nematode (Tylenchulus semipenetrans) and the citrusroot lesion nematode (Pratylenchus jaehni) are considered thekey nematodes for the citrus crop in Brazil. Tylenchulussemipenetrans is the most widely distributed but P. jaehni isthe most aggressive. This phytonematode has already beenfound in orchards of more than 30 cities from São Paulo,two from Minas Gerais and three from Paraná. This studywas carried out with the purpose of evaluating the efficiencyof formulations from five nematophagous fungi in thebiological management of P. jaehni. Doses of 1; 2; 4 and 6liters per plant of a formulation constituted of equal partsof sugar cane bagasse and rice grain mixture colonizedindividually by Arthrobotrys robusta, A. oligospora, A. musiformis,Dactylella leptospora and Monacrosporium eudermatum fungi weretested in the field, in “Pera” orange grafted on Rangpurlime in an orchard infested by P. jaehni in Itápolis/SP. The

treatment with aldicarb at the dose of 130 g per plant wasincluded as a comparison. Treatments relative to 1 L offungi formulation, plus 200 g of organic fertilizer AO-15/plant, 200 g AO-15/plant, 1 L of fungi formulation plus 4L of Agrolmin AH/plant and 4 L of Agrolmin AH/plantwere also included in the study. The doses of 1 and 2 L ofnematophagous fungi formulation were more effective thanhigher doses, outperforming the soil treatment with aldicarbfor the control of P. jaehni both in the soil and in citrusroots. The application of the nematophagous fungiformulation combined with Agrolmin AH or AO-15organic fertilizer did not increase treatment efficiency withthe nematophagous fungi. The obtained data confirm thatthe formulation containing five nematophagous fungi usedin the study is efficient for the biological control of P. jaehnion citrus.

197 – ECONTROLE BIOLÓGICO DE Pratylenchus brachyurus EM GOIABEIRA COM FUNGOSNEMATÓFAGOS, BACTÉRIAS E PRODUTOS ORGÂNICOS [BIOLOGICAL CONTROL OF Pratylenchusbrachyurus IN GUAVA WITH NEMATOPHAGOUS FUNGI, BACTERIA AND ORGANIC AMENDMENTS] Barbosa,B.F.F.¹; Souza, G.P.F.¹; Ruas, A.R.²; Santos, J.M.¹; Barbosa, J.C.¹; Soares, P.L.M.¹ ¹UNESP, Faculdade de Ciências Agráriase Veterinárias de Jaboticabal, 14884-900 Jaboticabal, SP, Brazil; ²Bioenergia Sucroalcooleira FATEC 14884-900 Jaboticabal,SP, Brazil. E-mail: [email protected]

Foi constatada no município de Bauru uma alta infestaçãode Pratylenchus brachyurus em um pomar de goiabeira. Opomar apresentava sintomas foliares como os doparasitismo de Meloidogyne mayaguensis, porém, não havia apresença deste nematóide. Em vista dos danos provocadosà cultura, foi instalado o experimento em julho de 2008, afim de testar alternativas de controle do nematóide, comprodutos de origem orgânica e ou biológica. Os tratamentosutilizados foram: ácidos húmicos e fúlvicos extraídos deturfa (Agrolmin®), nas doses 600 e 1200 L/ha, divididosem duas aplicações, metade na implantação e o restante 50dias depois; um coquetel de fungos nematófagos em estudono Laboratório de Nematologia da UNESP – FCAV(Paecilomyces lilacinus, Pochonia clamidospora, Arthrobotrys sp.,Monacrosporium elegans e Dactylela leptospora) na dose de 2 L/planta; Agrolmin na dose 600 L/ha associados ao coquetelde fungos nematófagos (2L/planta); Condissolo® (ácidoshúmicos e fúlvicos em pó) a 300 Kg/ha; Condissolo a 300Kg/ha, associado aos fungos nematófagos (2L/planta);Nemix® (coquetel de bactérias formuladas em pó); aduboorganomineral OM15® e OM21® (empresa Nutrissafra)

a 300 Kg/ha; OM15 e OM21 associado aos fungosnematófagos; nematicida sistêmico aldicarbe (Temik®)utilizado como padrão; e a testemunha sem aplicação dequalquer produto. Foi realizada uma análise prévia dapopulação dos nematóides, imediatamente anterior aaplicação dos produtos e, periodicamente, aos 50, 100, 150dias após a instalação do experimento. Foi calculado paracada tratamento, o percentual de aumento ou diminuiçãoda população de nematóides (solo e raiz) presentes, emrelação à análise prévia, em cada período de avaliação. Naanálise prévia foi constatada uma boa distribuição dapopulação do nematóide entre as parcelas, que não diferiramentre si. Aos 50 e 100 dias, foi observada uma diminuiçãodos nematóides para todos os tratamentos, inclusivena testemunha, fato provavelmente relacionado àdiminuição natural provocada por fatores abióticos.Aos 150 dias a população para todos os tratamentosaumentou. Porém, de forma bem menos acentuadapara os tratamentos Agrolmin, associado aos FungosNematófagos e Temik, que em relação à prévia,obtiveram respectivamente aumento de 82,5 e 83,8%



381

na população dos nematóides, lhes conferindo umcontrole de 17,45 e 16,19%. O aumento percentualpara Agrolmin 1200 L/ha, Nemix, Condissolo eFungos Nematófagos, Agrolmin 600 L/ha, Fungos

Nematófag os, Tes temunha , OM15 e OM21 ;Condissolo; OM15, OM21 e Fungos Nematófagos,foi respectivamente de 87,31%; 95,37%; 98,12%;99,97%; 100,16%; 100,91%; 101,35%; e 108,82%.

198 – DEVELOPMENT OF A NEMATICIDAL EXTRACT FROM Paecilomyces lilacinus[DESENVOLVIMENTO DE UM EXTRATO NEMATICIDA A PARTIR DE Paecilomyces lilacinus] Rodríguez, A.2; Arro,A.2; Alcalà, S.1; Ornat, C.1; Sorbías, F.J.1; Fernández, C.2; Lara, J.M.2 1DEAB-UPC; 2FUTURECO BIOSCIENCE S.L.;1,2Parc Mediterrani de la Tecnologia, c/ Esteve Terrades 8, Castelldefels 08860, Spain. E-mail: [email protected]

Paecilomyces lilacinus is a fungal antagonist with recognizedability against phytopathogenic nematodes. There areseveral commercial products based on spores of this fungus,but with little stability and dependent on refrigeration. Theaim of this study was to obtain extracts from metabolicactivity of Paecilomyces lilacinus (strain FEEP PL0501) to beincorporated as active ingredient in a commercialbionematicide and to assess their effectiveness in vitro. Ascreening of culture media was made to select the highestyield of P. lilacinus. The fungus was subjected to differentdegrees of stress to induce the production of metabolitesby three fermentation systems (bio-fermentor, shaker andstatic for 2, 3 and 15 days, respectively). Broth cultures were

centrifuged and ultrafiltered to obtain different prototypes(technical product). Nematicidal activity of prototypes wasevaluated in vitro against Meloidogyne javanica eggs masses andjuveniles. Then, the technical products were replaced bywater and maintained at constant temperature (25ºC), for amonth. Nematicidal activity was assessed on egg hatchingand juvenile mobility. The extract obtained from bio-fermentor caused 99% mortality for both stages. Theprototype has retained its effectiveness after keeping it for1 year at 4ºC. Extracts obtained from this study will providethe active ingredient for a more stable product, easy toproduce at an industrial level and less dependent on theenvironment than a classic bionematicide based on spores.

199 – LONG TERM BENEFITS ASSOCIATED WITH DITERA® BIOLOGICAL NEMATICIDE[BENEFÍCIOS A LONGO PRAZO ASSOCIADOS COM NEMATICIDA BIOLÓGICO DITERA®] Rehberger, L.1;Shammo, B.1; Dahod, S.1; Hopkins, R.1 1Valent BioSciences Corporation, 6131 Oakwood Road, Long Grove, IL, 60047USA. E-mail: [email protected]

In long term perennial field trials in which DiTera®biological nematicide has been applied regularly overmultiple years, improved yields have been observed inaddition to improved nematode control. A long termgreenhouse study was conducted over two cropping cyclesto further demonstrate and understand the plant vigor andsoil health effects and benefits of regular DiTeraapplications. In the first generation, potted tomatotransplants were grown to harvest. Plants received eitherregular fertilizer treatments or regular fertilizer andDiTera treatments. Additionally, half of the plants wereinoculated with Meloidogyne incognita nematodes. Aftercompletion of the first crop cycle, a second tomato cropwas transplanted and grown in the same soils withoutfurther treatments. All plants were adequately andequally fertilized throughout the duration of the study.In the second phase of the study, although there were

no additional DiTera treatments, there were statisticallysignificant dose dependent improvements in plantgrowth and vigor for the plants grown in soil previouslytreated with DiTera® compared to plants grown in soilsthat were treated with fertilizer alone. The positiveeffects of the earlier DiTera treatments were observedwhether or not the soils had been inoculated withnematodes. Plants grown in soils previously treated withDiTera® had less root galling and increased shoot androot mass compared to plants grown in soils that receivedonly fertilizer. Samples of soil from each treatmentwere analyzed. Soils previously treated with DiTera®had improved moisture retention and overall improvedsoil quality. This greenhouse study demonstrates thatregular applications of DiTera® can provide not onlynematode control, but also give long-term improvementsin plant vigor and soil health.

382 Vol. 33(4) - 2009


200 – EFECTIVENESS OF BIONEM WP AGAINST Meloidogyne javanica ON CUCUMBER AND TOMATOCROPS IN A PLASTIC GREENHOUSE [EFICIÊNCIA DO BIONEM WP CONTRA Meloidogyne javanica NACULTURA DO TOMATEIRO EM CASA PLÁSTICA] Alcalá, S.1; Ornat C.1; Sorribas F.J.1; Izquierdo J.2 1DEAB-UPC.08860 Castelldefels, Barcelona, Spain.; 2BAYER CropScience S.L. 46290 València. Spain. E-mail:[email protected]

The effectiveness of BioNem WP (BN) (Bacillus firmus, 3x109

cells/g) against M. javanica on cucumber cv. Dasher II andtomato cv. Durinta cultivated from September to December2008 was assessed. The experiment included 7 treatments:a) BN at 60 kg/ha; b) BN at 80 kg/ha; c) Rhizo Vital 42(RV) (B. amyloliquefaciens, 2.5x1010 cfu/g) at 2 l/ha; d) BN at80 kg/ha + RV; e) Nemacur micro (Nm) (Fenamiphos 24%CS) at 40 l/ha; f) b+e; and g) untreated. BN was applied fivedays before transplanting. RV was applied five days beforetransplanting in treatment c, and twice, five days beforetransplanting and at transplanting in treatment d. Splitapplication of Nm was done, 70% five days beforetransplanting and the remaining 30% seven days aftertransplanting. Individual plots consisted of four rows eachof six plants per row. Initial population densities incucumber plots ranged from 166 to 371 J2 / 250 cm3 ofsoil, and from 670 to 1825 J2 / 250 cm3 of soil in tomatoplots. Each combination crop-treatment was replicated

three times according to a stratified randomized blockdesign. Dry shoot weight, fresh root weight, gall index, andnumber of eggs per plant from 12 plants per plot wereevaluated at 8 and 14 weeks after transplanting. In addition,yield of crops was assessed, and nematode densities in soilwere evaluated at the end of the assay. Gall index andnumber of eggs per gram of root of cucumber and tomatoin plots treated with Nm were lower than in untreated plots.Cucumber growth and yield in plots treated with BN at 80kg/ha, alone or in combination with Nm, were higher, androot galling and eggs per gram root were lower than inuntreated plots. Tomato yield in plots treated with BN at80 kg/ha, alone or in combination with Nm, was higherthan in plots with other treatments. However, only tomatoplants cultivated in plots treated with BN at 80 kg/ha incombination with Nm or with RV, as well as RV alone,showed a lower number of eggs per gram of root thanthose cultivated in untreated plots.

201 – EFEITO DO TRATAMENTO DE MUDAS DE BANANEIRA PRATA-ANÃ NO CONTROLE DEMeloidogyne javanica e Fusarium oxysporum f. sp. cubense [EFFECT OF SEEDLING TREATMENT OFBANANA ‘PRATA ANÃ’ TO CONTROL Meloidogyne javanica AND Fusarium oxysporum f. sp. cubense]. Ribeiro, R. C. F.1;Xavier, A. A.1; Rocha, L. S.1; Aguiar, F. M.1; Campos, V. P.2; Pimenta, L.1; Lopes; P. S.1, Nietsche, S.1 1 Depto. CiênciasAgrárias, Unimontes, CP 91, 39440-000 Janaúba, MG, Brasil. E-mail: [email protected], 2 Depto. Fitopatologia,UFLA, CP 3037, 37200-000, Lavras, MG, Brasil. E-mail: [email protected]

A produção de mudas de bananeira micropropagadasconstitui-se em estratégia de controle de diversosfitopatógenos. Entretanto, existem relatos na literatura deque tais mudas são mais suscetíveis a nematóides e fungosquando plantadas no campo. Vários trabalhos têmdemonstrado a eficiência de rizobactérias no tratamentode sementes e mudas no controle de patógenos de solo. Otrabalho objetivou avaliar o tratamento de mudasmicropropagadas com 15 isolados de rizobactérias nocontrole de Meloidogyne javanica e Fusarium oxysporum f. sp.cubense (FOC). Mudas micropropagadas de bananeira ‘Prata-Anã’, produzidas em laboratório, tiveram suas raízes imersasem suspensão bacteriana (concentração ajustada:OD540=0,5). Em seguida, as mudas foram transferidas paratubetes com vermiculita onde permaneceram por 30 diasem condições de aclimatação. Antes do transplantio, asraízes das mudas localizadas externamente sofrerammicroferimentos com estilete. A seguir, foram

transplantadas para vasos de 1,5 L contendo solo:areia (1:1)previamente desinfestado. Adicionou-se, na região do coloda planta, 5 mL de uma suspensão de esporos de FOC (103

conídios/mL). Após 24 horas, inocularam-se 5 mLcontendo 3000 J2 de M. javanica em 3 orifícios ao redor damuda. Os tratamentos constaram de plantas inoculadasapenas com os isolados, isolados x FOC, isolados x M.javanica, isolados x FOC x M. javanica, apenas M. javanica eapenas FOC. O ensaio foi montado em casa-de-vegetaçãoem DBC no esquema fatorial. Foram empregadas 6repetições. Após 60 dias, avaliaram-se as variáveis: númerode galhas, massas de ovos e ovos por raiz e número de J2de M. javanica; altura de plantas, peso de matéria fresca eseca de parte aérea, peso de raiz. Para avaliação do efeitodas rizobactérias sobre o Mal-do-Panamá, usou-se a escalade notas Charlier e Escalant. Na ausência de FOC todos osisolados avaliados proporcionaram número de J2significativamente inferior ao da testemunha. Fixando-se o



383

fator ‘isolados de rizobactérias’, 8 isolados proporcionaramredução significativa do número de J2 nas plantas inoculadascom FOC, em relação àquelas não inoculadas com o fungo.Na ausência de FOC 8 isolados de rizobactérias avaliadosproporcionaram número de galhas significativamente

inferior ao da testemunha. Na presença de FOC, 2 e 8isolados de rizobactérias aumentaram significativamente amatéria seca e altura de plantas, respectivamente. Comrelação ao Mal-do-Panamá, 5 isolados proporcionaramausência de sintomas. Apoio Financeiro: FAPEMIG.

202 – SPORULATION AND COLONY FORMING UNITS IN EIGHT ISOLATES OF NEMATOPHAGOUSFUNGI IN TWO LIQUID CULTURE MEDIA [ESPORULAÇÃO E UNIDADES FORMADORAS DECOLONIAS DE OITO ISOLADOS DE FUNGOS NEMATÓFAGOS EM DOIS MEIOS DE CULTURA LÍQUIDOS]Medeiros, M.R.M.1; Martinelli, P.R.P.2; Becaro, C.K.3; Santos, J.M.4 1Faculdade de Ciências Agrárias e Veterinárias UNESP,14884-900 Jaboticabal, SP, Brazil. Email: [email protected]

Nematode biological control gained prominence in recentyears due to the efficiency obtained with some antagonists,among which are some nematophagous fungi predators.The management of these agents requires mass productionof inoculum aiming to produce a formulation for fieldapplication. The aim of this study was to evaluate theproduction of spores and CFU/mL of Arthrobotrysmusiformis, A. robusta, A. oligospora, Monacrosporiumeudermateum, M. elegans, Pochonia chlamydosporia, Dactylellaleptospora and Paecilomyces lilacinus in two liquid culture media:PD (potato dextrose) and YE (1% yeast extract). Thecolonies were kept in average temperature of 26.5 °C inthe dark and after 20 days the conidia were counted byusing a Neubauer chamber. The assessment of CFUnumbers was done with serial dilution plated in PDA culturemedium and evaluated 72 hours later. The fungi A.musiformis and P. lilacinus sporulated in the PD with averages

of 2.5 x104 and 7.2 x105 conidia/mL, respectively. A. robusta,A. oligospora, M. eudermateum, M. elegans, P. chlamydosporia, D.leptospora did not sporulate. However, there was muchgrowth of all. In the YE medium, M. elegans, P. chlamydosporiaand P. lilacinus sporulated with averages of 2.5 x103, 2.5x104 and 7.7 x104 conidia/mL, respectively. There was nosporulation for the other isolates. In the relative assessmentrelated to the numbers of CFU, the PD means werestatistically higher than YE for isolates of A. robusta, A.oligospora, M. eudermateum, M. elegans, P. chlamydosporia and P.lilacinus. For the YE means all the isolates formed fewercolonies, statistically different from PD. The growth ofnematophagous fungi in liquid medium is feasible and canbe useful for the formulation production process of theseagents to facilitate the inoculation of large volumes of solidsubstrates, in addition to allowing application throughirrigation water.

203 – NEMATOPHAGOUS FUNGI DETECTED IN CITRUS ORCHARDS IN SÃO PAULO STATE [FUNGOSNEMATÓFAGOS DETECTADOS EM POMARES DE CITROS DO ESTADO DE SÃO PAULO] Martinelli, P.R.P.1;Andrade, F.C.A.2; Medeiros, M.R.M.3; Santos, J.M.4 1Faculdade de Ciências Agrárias e Veterinárias UNESP, 14884-900Jaboticabal, SP, Brazil. Email: [email protected]

In studies accomplished in the Nematology Laboratory ofthe Department of Plant Pathology FCAV/UNESP,Campus of Jaboticabal/SP, 38 samples were used in citrusorchards of São Paulo counties: Taquaritinga, Taquaral,Monte Alto, Bebedouro, Itápolis, Cândido Rodrigues andin Goiânia/GO, sent to the laboratory for nematologicalanalysis or collected by the team of the Laboratory for thestudy of the flora of nematophagous fungi. The sampleswere plated in agar-water 2% and Panagrellus sp. was addedto the culture medium to serve as baits for nematophagousfungi and incubated in BOD 25 ± 1 ° C. All orchards wereinfested by Tylenchulus semipenetrans and/or Pratylenchus jaehni.The main isolated species were genus Arthrobotrys, with thefrequency of Arthrobotrys robusta 23.7%, A. musiformis 18.4%,

A. oligospora 10.5% and A. conoides 5.2%. Monacrosporiumelegans, M. eudermatum, Dactyllela leptospora and Paecilomiceslilacinus were found in 2.6% of the samples. In the total of26 fungi isolates obtained, 92.8% were pathogenic to T.semipenetrans and 82.1% to P. jaehni. The predatory capacityof the isolates varied among species and within the samespecies. Isolates that exhibited highest predatory capacityin vitro of T. semipenetrans were A.oligospora PPM-1, A.oligospora PPM-2, A.musiformis PPM-2, A. musiformis PPM-5, A. robusta PPM-1, A. robusta PPM-2, M. eudermatum, M.elegans and D. leptospora. For P. jaehni the individual M.eudermatum, M. elegans, D. leptospora, A. oligospora PPM-2, A.oligospora PPM-1, A. Robusta PPM-3 and A. musiformis PPM-4 were the most effective.

384 Vol. 33(4) - 2009


204 – HONGOS NEMATOFAGOS ASOCIADOS A RIZOSFERA DE CULTIVO DE TOMATE EN EL VALLEDEL CAUCA – COLOMBIA [NEMATOPHAGOUS FUNGI ASSOCIATED WITH RHIZOSPHERIC SOIL, INTOMATO CULTIVARS FROM VALLE DEL CAUCA – COLOMBIA] Parada, S.J.C.1; García, T.A.2; Lotero L.H.2;Leguízamo, M.C.2; Sánchez, P.M.2 1Facultad de Ciencias, Departamento de Biología; 2Facultad de Ciencias Agropecuarias,Universidad Nacional de Colombia. E-mail: [email protected]

Con el fin de evaluar el comportamiento de juvenilesinfectivos de Sterneinema feltiae (Cephalobina Sterneinematide)cepa Colombia, frente a hongos presentes en suelorizosferico de cultivo de Tomate (Lycopersicum esculentum), sedirigieron montajes en microcultivo sobre Agar PDA y AgarQuitina, de aislamientos de colonias fungosas de los génerosAspergillus spp., Acaulopage sp.,, Cunninghamella sp.,Chr ysor porium sp.,, Geotr ychum sp.,, Penicillum spp.,,Tiegheomiomyce sp.; como patógenoss Fusarium spp.,Rhizoctonia sp., Phytophthora sp., y Periconiella sp.; Methariziumanisoplae; los nematofagos Paecylomices lillacinis, Arthrobotrydactyloides, Mucor sp., Dactylaria sp., Nematoctonus sp.,Haplosporangium sp., Stylopage sp., y Trichoderma sp. Elaislamiento y purificación de estas colonias fungicas, seobtuvieron postratamiento en series de dilución en soluciónde Winogradsky y siembras en agar PDA (Merck) y agarQuitina, elaborado con cadáveres de adultos de Galleriamelonella previamente deshidratados y pulverizados a 80

micras. Los resultados mostraron que los génerosArthrobotry dactyloides, Dactylaria sp se comportan comopredadores y Nematoctonus sp., Haplosporangium sp., Stylopagesp, Paecylomices lillacinus como endoparásitos medianteesporas. El género Cunninghamella sp reportadogeneralmente como saprofito (Barnett & Hunter) parasitaal nematodo con sus esporas equinuladas. La actividadesde estas especies de hongos sobre juveniles de S. feltiae,se expresa principalmente en medios de agar quitina.Aunque la actividad de estos aislamientos sobre juvenilesinfectivos de S. feltiae, bajo condiciones de columna dearena y suelo en cultivo de plántulas de L. esculentum eninvernadero, se atenúa hasta en un 50%, dada la altamovilidad de los juveniles a través de la columna, queles permite alejarse de las de esporas e hifas, el potencialde uso de estas especies para el control y manejointegrado de nematodos parásitos de plantas, enColombia, asume gran importancia.

205 – INTERACTION BETWEEN Nacobbus aberrans AND Glomus intraradices IN TOMATO [INTEIRAÇÃOENTRE Nacobbus aberrans E Glomus intraradices EM TOMATEIROS] Lax, P.1; Becerra, A.2; Soteras, F.2; Cabello, M.3;Doucet, M.E.1 1Centro de Zoología Aplicada, C.C. 122, 5000 Córdoba, Argentina; 2IMBIV-CONICET, Córdoba, Argentina;3Instituto Spegazzini, Buenos Aires, Argentina. E-mail: [email protected]

Several studies have reported that root colonization byGlomus spp. increases tolerance of the host plant to someplant-parasitic nematodes. Information about the effectsof the interaction between arbuscular mycorrhizal fungi(AMF) and N. aberrans is scarce. The possible protectiveeffect of G. intraradices on tomato plants (cv. Platense)inoculated with an N. aberrans population from LisandroOlmos (Buenos Aires, Argentina) was studied undergreenhouse conditions. Four treatments were performed,which consisted of inoculating tomato plants with: a) AMFat transplanting (zero time=T0), b) nematodes at T0, c) AMF+ nematodes at T0, d) AMF in T0 + nematodes after 3 weeks.Five replications per treatment were performed. Each plantwas inoculated with 100 second-stage nematode juvenilesand 980 AMF spores. After 80 days, reproduction factorof N. aberrans (RF=final density/initial density) was

calculated and percentage of arbuscular mycorrhizalcolonization (%AMC) in roots was estimated. Treatmentsc and d did not show significant differences in RF values(RFc=17.9; RFd=15.8) and %AMC obtained(%AMCc=45.7%; %AMCd=47.4%). By contrast,differences between treatments c and d and controls wereobserved (%AMCa=30%; RFb=42.8). AMF inoculationof tomato at transplanting and subsequent infection bynematodes three weeks later produced a greaterpercentage of AMF colonization and lower parasitereproduction. This experiment shows the importance ofconducting further studies in this field because of thepotential benefits they would have in the managementof nematode populations. This is the first study of theinteraction between G. intraradices and N. aberrans inArgentina.



385

206 – INTERACCIÓN Glomus mosseae - Pochonia chlamydosporia VAR. Catenulata Y Meloidogyne incognitaEN TOMATE (Solanum Lycopersicum L.) [INTERACTION Glomus mosseae - Pochonia chlamydosporia VAR. CatenulataY Meloidogyne incognita IN TOMATO (Solanum lycopersicum L.)] Hernández, M.A.1; Hidalgo-Díaz, L.1; Plana, R.2; Álvarez,M.2; Rodríguez, M.G.1 1Grupo Plagas Agrícolas. Dirección de Protección de Plantas. Centro Nacional de SanidadAgropecuaria (CENSA). Carretera de Jamaica y Autopista Nacional. San José de las Lajas, La Habana, Cuba; 2Departamentosde Genética y Nutrición y Biofetilizantes. Instituto Nacional de Ciencias Agrícolas (INCA). Km. 31/2 Carretera deTapaste. San José de las Lajas, La Habana, Cuba. Email: [email protected]

El uso combinado de Agentes de Control Biológicos,Micorrizas y la resistencia genética constituyen alternativasecológicas para el manejo de poblaciones de nematodosformadores de agallas (Meloidogyne spp.), una de lasprincipales plagas del cultivo del tomate en Cuba. En esteestudio se evaluó, en condiciones de microparcelas, lainteracción de Glomus mosseae -Pochonia chlamydosporia var.catenulata cepa IMI SD 187 y Meloidogyne incognita raza 2 entomate (Solanum lycopersicum cv. Eliana- portadora del genMi). El experimento se desarrolló durante el periodo del18 de diciembre/ 2006 al 12 de marzo/ 2007. Seestablecieron 5 tratamientos (aplicaciones simples ycombinadas de ambos hongos) y un control, con 10repeticiones en un diseño experimental completamentealeatorio. Las variables evaluadas fueron: Masa fresca de laraíz (g), Índice de Agallamiento, Número de ootecas.g deraíz-1, Número de huevos.ootecas-1, UFC.g de raíz-1, UFC.gde sustrato-1, porcentaje de colonización de ootecas y deparasitismo de huevos, masa seca de la raíz, masa seca de labiomasa aérea y rendimiento (kg.planta-1). Los resultados

demostraron la capacidad de ambos hongos paraestablecerse en el sustrato y las raíces de las plantas. Seconstató que, la colonización de masas de huevos de M.incognita por P. chlamydosporia fue de 70% cuando este hongoactuaba sólo y que su actividad disminuyó a 60% en eltratamiento donde se combinó con G. mosseae, así comoque la actividad parasítica de huevos disminuyó de un 30%a 25% en el tratamiento donde se aplicó P. chlamydosporia +G. mosseae. Por su parte, el número de huevos.ootecas-1, fuemenor en los tratamientos donde P. chlamydosporia actuó solocon respecto al tratamiento simple con M. incognita. Sinembargo, el Índice de Agallamiento disminuyó y losrendimientos aumentaron en las plantas tratadas conmicorrizas y el hongo nematófago. Los resultados sugierenque ambos organismos pueden ser empleados juntos en elmanejo de M. incognita en el tomate (S. lycopersicum, cv Eliana),manejando el momento de introducción de cada uno alsistema productivo de esta variedad, la que se comportócomo tolerante a M. incognita , demostrando suspotencialidades para ser explotada en Cuba.

207 –ASSESSING INTERACTION BETWEEN ENTOMOPATHOGENIC NEMATODES AND PLANTPATHOGENIC FUNGI: A MULTITROPHIC-MULTISPECIES STUDY [EVALUCION DE LASINTREACCIONES ENTRE NEMATODOS ENTOMOPATÓGENOS Y HONGOS FITOPATÓGENOS: UNESTUDIO MULTITRÓFICO Y ENTRE MULTISPECIES] Gutierrez, P.D.N.1; Stock, S.P.1 1Department of Entomology,University of Arizona, Tucson AZ 85721-0036, USA. E-mail: [email protected]

The entomopathogenic nematode Heterorhabditis sonorensis,a native pathogen of nymphs of Diceroprocta ornea(Homoptera: Cicadidae) was isolated in Caborca, Sonora,Mexico. In this region, seasonal cicadas (Diceroprocta spp,Homoptera Cicadidae) are major pests in asparagus fields.The isolation of a native entomopathogenic nematode, H.sonorensis, offers potential for controlling these insects.However, approximately 70% of the cicadas collected havebeen found infested with Fusarium oxysporum f.sp. asparagi, asoilborne fungus pathogenic to asparagus. We hypothesize

that F. oxysporum affects the success of H. sonorensis incontrolling the cicada populations. Laboratory experimentswere conducted to evaluate the performance of thenematode H. sonorensis in the presence of F. oxysporum, usingG. mellonella larvae as a host. Treatments considered two F.oxysporum inocula (106, 107, 108, 109 spores/ml) and three F.oxysporum application times: simultaneously, 24 hours before,and 24 hours after nematode inoculation. The effect ofthe nematode-fungi interactions will be shown in thispresentation.

386 Vol. 33(4) - 2009


208 – ISOLAMENTO DE FUNGOS ANTAGONISTAS A NEMATÓIDES DE SUPERFÍCIE DAS RAÍZESDO CAFEEIRO [ISOLATION OF ANTAGONISTIC FUNGI OF NEMATODES ON COFFEE ROOT SURFACE]Freire, E.S.¹; Faria, M.R.¹; Goulart, M.¹; Maximiniano, C.¹; Campos, V.P.¹ ¹Laboratório de Nematologia/ Área deFitopatologia/ DFP/ UFLA, C. P. 3037, 37200-000 Lavras, MG, Brazil. E-mail: [email protected]

São muitas as interações entre microorganismos e a rizosferada planta, porém, pouco conhecidas. Com o intuito de isolarfungos antagonistas a Meloidogyne exigua e residentes dorizoplano, raízes de cafeeiros infestados com M. exigua foramcoletadas, cortadas e lavadas, cuidadosamente, em águadestilada e esterilizada. Em seguida, foram transferidas paraBecker de 1L com 400 mL de água destilada e agitadas por30 minutos em baixa rotação. O conteúdo foi vertidoem peneiras de 0,075mm sobre 0,0020 mm e o materialretido na peneira de 0,0020 mm foi recolhido com águadestilada e esterilizada. A suspensão foi centrifugada pordois minutos a 1609 G, em microtubos de 1 mL,concentrando assim, os esporos. Em câmara de fluxo

laminar e após o descarte do sobrenadante, o precipitadofoi recolhido e espalhado com alça de Drigalski em placasde Petri contendo meio malte. As placas foram vedadascom filme de PVC e incubadas em BOD a 25ºC noescuro. As colônias fúngicas foram repicadas para placascom meio malte e identificada a espécie fúngicaencontrada, pelas características morfológicas emmicroscópio biológico. Identificou-se apenas o fungopredador de nematóides Arthrobotrys conoides. Estudosestão sendo realizados para confirmação da associaçãode A. conoides em raízes de cafeeiros e possíveis papéisna predação de J2 nas massas de ovos de M. exigua nasuperfície das raízes

209 – NUTRITIONAL EFFECTS OF A HOST PLANT (POTATO) AND BREAK CROPS ON Pochoniachlamydosporia AND OTHER FUNGAL PARASITES OF THE POTATO CYST NEMATODE, Globoderapallida [EFECTOS NUTRICIONALES DE UNA PLANTA HOSPEDANTE (PAPA) Y CULTIVOS DE ROTACIÓNEN Pochonia chlamydosporia Y OTROS HONGOS PARÁSITOS DEL NEMATODO ENQUISTADO DE LA PAPA,Globodera pallida] Manzanilla-López, R.H.1; Esteves, I.2; Powers, S.3; Ferry, B.R.1 1Nematode Interactions Unit, Plant Pathologyand Microbiology Department, Rothamsted Research, Harpenden, AL5 2JQ, U.K.; 2IMAR-CMA, Departamento deZoologia, Faculdade de Ciências e Tecnologia, Universidade de Coimbra, 3004-517 Coimbra, Portugal; 3Statistics Unit,Biomathematics and Bioinformatics Department, Rothamsted Research, Harpenden, AL5 2JQ, U.K. E-mail: [email protected]

Pochonia chlamydosporia (Clavicipitaceae) occurssaprophytically in soils and is a potential biological controlagent of endoparasitic plant nematodes. The fungus is afacultative parasite of nematode eggs and the switch fromthe saprophytic to the parasitic phase of the fungus may berelated to soil nutrients, including C and N released by plantsinto their rhizospheres. The quantity and quality of rootexudates are changed by nematodes and we hypothesisethat such changes are used as signals for nematode-parasiticfungi to switch to their parasitic phase. The parasitic fungi,P. chlamydosporia, Paecilomyces lilacinus and Monographellacucumerina, infect the eggs of potato cyst nematode (PCN).It is not known if the presence or absence of plant rootexudates will affect the parasitic activity of the fungus. Theobjectives of the present study were: i) to assess if nutrientsin the potato rhizosphere will increase abundance of theabove fungal species, including two Pochonia varieties: P. c.var. chlamydosporia (Pc280, PCN biotype) and P. c. var.catenulata (Pc392, root-knot nematode biotype); ii) toexamine if break crops in the potato rotation (wheat, oilseedrape and sugar beet) differ in their ability to support selected

fungal isolates (P. lilacinus, Pc280, Pc392); iii) to assess ifnematode infection (Meloidogyne incognita) in tomato plantsprovides the fungus (Pc280 and Pc392) with nutrients(different from those obtained from host plant alone) thatmay enhance its reproduction and colonization of soil andrhizosphere. Potato chits and crop seedlings were plantedinto boiling tubes containing 5000 chlamydospores orconidia/g of acid washed sand (pH 6) and kept in a growthchamber at 20 °C and 16 h of light for up to six weeks.Plants were sprayed regularly with a foliar fertilizer (avoidingthe sand) and watered. The abundance of the fungal speciesand biotypes (colony forming units or CFU) in soil andrhizosphere in the presence and absence of plants wascompared using ANOVA of the square root transformedCFU at the end of experiments, and used as a measure ofthe nutrition derived from the plant by each fungal isolate.The abundance of the fungi in sand differed significantly(P<0.05) but there was no interaction between plant speciesand fungal isolate (P=0.180). There was a strong effect ofP. lilacinus on oilseed rape and sugar beet and this fungusalso proliferated most on potato. Pc392 was present in large



387

quantities on wheat. There was evidence of a differentresponse to M. incognita for Pc392 than for Pc280 but there

was no significant effect of the presence of the nematodeon the rate of increase of the fungus (P=0.558).

210 – BIOPROSPECTION OF SOIL NEMATOPHAGOUS FUNGI ON AGRICULTURAL SOILS OF COSTARICA, AS A POTENTIAL ALTERNATIVE FOR CHEMICAL SOIL DISINFESTATIONS [BIOPROSPECÇÃODE FUNGOS NEMATÓFAGUS DO SOLO EM SOLOS AGRÍCOLAS DA COSTA RICA, UMA ALTERNATIVAPARA DESINFESTAÇÃO QUÍMICA DO SOLO] Peraza, W.1; Esquivel, A.1; Chavarri, F.2; Rivera, G.1; Ramírez, F.2;Guzman, T.3 1Escuela de Ciencias Agrarias; 2Escuela de Ciencias Ambientales, Universidad Nacional, Apdo 86-3000Heredia, Costa Rica; 3Instituto Tecnológico de Costa Rica. E-mail: [email protected]

Nematode control is one of the main problems inagricultural fields of Costa Rica. Over the last 25 years,the country became one of the largest consumers ofchemicals for soil disinfestations. Pesticides for nematodecontrol, such as Methyl Bromide, Metham Sodium, 1,3Dichloropropene, Dazomet, Terbufos, Cadusafos,Carbofuran, Etoprop among others, represent nearly 15%of total pesticide yearly consumption in Costa Rica. Basedon the experience to develop alternatives for tropicalagriculture, the Universidad Nacional of Costa Rica startsin 2009 a Biological Control and Ecological SoilManagement Program (COBIMES), based on previousresearch suggesting that the most sustainable alternativefor chemical soil disinfestations are those based onecological and integrated pest management. This programis monitoring the soil of the main producing areas of rice,melon, and plantain, including a more comprehensiveanalysis than traditional ones. These analyses include theidentification of plant feeding and free living nematodes

and nematophagous fungi, for a better understanding ofthe trophic chains in the soil ecosystem. Soil samples werecollected from three regions of Costa Rica. They werescreened in order to isolate nematode destroying fungithrough sprinkling technique. Thirty-four isolates wereobtained: 4 were identified as Paecilomyces sp., 3 asMonacrosporium sp., 4 as Fusarium oxysporum, 6 as Fusariumsp., 8 as Penicillium sp., 9 as Trichoderma sp. All the isolateswere characterized morphologically; micro andmacroscopically, describing characteristics like shape, color,appearance of colonies as well as size of conidiophores,conidia, hyphae, etc. The efficiency of these fungi are undertesting in order to determine their potential for nematodecontrol in vitro. Information obtained in this study will beuseful for spore mass production, efficient means ofinoculation and management of nematophagous fungi insoils to enhance their predatory activity. Understandingthe soil trophic webs is important to maintain bothagricultural productivity and ecosystem health.

211 – MORPHOLOGY, ULTRASTRUCTURE AND PHYLOGENETIC POSITION OF A Pasteuria ISOLATEINFECTING Mesocriconema ornata [MORFOLOGIA, ULTRAESTRUTURA E POSIÇÃO FILOGENÉTICA DEUM ISOLADO DE Pasteuria INFECTANDO Mesocriconema ornata] Orajay, J.I.1; Williams, D.S.2; Brito, J.A.3; Giblin-Davis,R.M.4; Preston, J.F.2; Dickson, D.W.1 1University of Florida, Entomology and Nematology Dept., PO BOX 110620,Gainesville, FL 32611-0620, USA; 2University of Florida, Microbiology and Cell Science Dept., PO BOX 110700,Gainesville, FL 32611-0700; 3Division of Plant Industry, PO.B 147100, Gainesville, FL 32614-7100; 4University of Florida,Ft. Lauderdale Research and Education Center, 3205 College Ave. Ft Lauderdale, FL 33314-7719. E-mail: [email protected]

A population of Pasteuria was observed infectingMesocriconema ornata in a peanut field in Marion County,Florida where P. penetrans (P-20) was also observed infectingMeloidogyne arenaria. In natural field populations, attachmentand development of this ring nematode Pasteuria (RNP)were frequently observed in female ring nematodes. Eachparasitized female contained about 5,000-8,000 matureendospores that were each enclosed in a large exosporiumand devoid of a sporangium. The cup-shaped endosporesmeasured 3.79 + 0.12 ìm in diam. and 2.21 + 0.12 ìm inheight, whereas the central body diam. was 2.41 + 0.13 ìmand the height was 1.81 + 0.12 ìm. TEM micrographs

revealed that sporulation conformed to the seven-stageddevelopment previously observed in other species ofPasteuria. The sporangium was rhomboidal in shape andappeared to disintegrate at the culmination of endosporematuration. RNP was different from other Pasteuria by nothaving microprojections on the outer spore coat or a basalring surrounding the germination pore. RNP endosporespossessed the apomorphy of a thick and trapezoidalepicortex that was about two-thirds the height of the core.The basal adhesion layer was also thick, measuring about0.14 ìm. Phylogeny based on Bayesian inference andmaximum likelihood methods of a 1,344 bp region of the

388 Vol. 33(4) - 2009


16S rRNA placed RNP within the genus Pasteuria togetherwith other isolates that infect tylenchid nematodes. The

morphological and genetic uniqueness of RNP justify itsconsideration as a new candidate species.

212 – EVALUATION OF DIFFERENT METHODS OF APPLICATION OF Pochonia chlamydosporia ONTHE CONTROL OF Meloidogyne javanica AND ON THE GROWTH PROMOTION OF TOMATO PLANTS[AVALIAÇÃO DE DIFERENTES MÉTODOS DE APLICAÇÃO DE Pochonia chlamydosporia NO CONTROLE DEMeloidogyne javanica E NA PROMOÇÃO DE CRESCIMENTO DO TOMATEIRO] Ferreira, P.A.1; Ferraz, S.1; Ferreira,F.C.1; Dallemole-Giaretta, R.1; Freitas, L.G.1; Amora, D.X.1; Lopes, E.A.1; Neves, W.S.2; Podestá, G.S.1 1Universidade Federalde Viçosa, Departamento de Fitopatologia, 36570-000 Viçosa, MG, Brazil; 2Epamig, Unidade Regional Norte de Minas,39525-000 Nova Porteirinha, MG, Brazil. E-mail: [email protected]

Pochonia chlamydosporia, a facultative parasitic fungus ofnematode eggs, has shown potential as biological controlagent against Meloidogyne spp. and as plant-growth promoter.However, the conventional method of application of thefungus by means of chlamydospores requires a high amountof inoculum. Thus, the objective of this work was toevaluate different methods of application of the funguson the control of Meloidogyne javanica and its effect on thegrowth of tomato plants. Fungus was applied either as seedtreatment (1,000 chlamydospores per seed), as plant-growthsubstrate treatment (1,000 chlamydospores per g); or soiltreatment (5,000 chlamydospores per g). After 21 days, theseedlings were transplanted to 1-L pots containing soilinfested either with 5,000 eggs of the nematode or 5,000

chlamydospores/kg of soil. Untreated plants (seeds orsubstrate) and soil were used as controls. Pots were keptunder greenhouse conditions without mineral fertilization.Weight of the roots, height of the plants and the numberof galls and eggs were evaluated 45 days later. There wasno effect of the fungus on the height of the plants, and onthe number of galls of the nematode. However, nematodeinfection reduced plant height and root weight by 19% and17.4%, respectively. Soil treatment with P. chlamydosporiareduced the number of eggs per g of root by 50%.Application of the fungus either as seed treatment or asplant-growth substrate treatment was not efficient incontrolling M. javanica and promoting plant-growth.Support: FAPEMIG and CNPq.

213 – EVALUACIÓN Y SELECCIÓN DE AGENTES DE CONTROL BIOLÓGICO CON ACCIONNEMATICIDA [EVALUATION AND SELECTION OF BIOCONTROL AGENTS PRESENTING NEMATICIDEACTION] Ornat, C.1; Alcalà, S.1; Lara, J.M.2; Sarro, A.2; Sorribas, F.J.1; Fernández, C.2 1DEAB-UPC; 2FUTURECOBIOSCIENCE S.L.; 1,2Parc Mediterrani de la Tecnologia, c/ Esteve Terrades 8, Castelldefels 08860, España. E-mail:[email protected]

En suelos infestados con nematodos es común la presenciade microorganismos antagonistas que pueden actuar comobionematicidas. Estos Agentes de Control Biológico (ACB)comparten rasgos fisiológicos y rutas metabólicas que sepueden aprovechar para diferenciarlos del resto de lapoblación. Teniendo en cuenta alguna de las característicasespecíficas de conocidos microorganismos antagonistas denematodos, en este trabajo se consideró la habilidad decrecimiento en sustratos específicos para seleccionarposibles ACB en muestras de suelos y se verificó su potencialnematicida mediante bioensayos in vitro. En una primerafase, se recolectó suelo y raíces de campos agrícolas endiferentes localidades de España. Las muestras fueronsometidas a un proceso estándar de extracción,identificándose 12 especies de nematodos fitoparásitos.Diluciones seriadas del suelo y suspensiones acuosas quecontenían juveniles o huevos de Meloidogyne sp. o Globodera

sp., fueron sembradas sobre diferentes medios de cultivo,obteniéndose un total de 328 microorganismos. En unasegunda fase, se sembraron los aislados sobre mediosde cultivo específicos (quitinolíticos y proteolíticos). Deeste modo, se obtuvieron 109 aislados posibles ACB.Posteriormente, se evaluó in vitro la capacidad deinhibición de la eclosión de huevos de Meloidogyne incognitade 14 aislados bacterianos y 13 fúngicos preparados ensuspensión acuosa. Se determinó la eclosión de las masasde huevos 1, 2, 7, 14, 21 y 28 días después de haberlaspuesto en contacto durante una semana con lassuspensiones acuosas de los diferentes aislados .Diez delos 27 aislados evaluados presentaron porcentajes deinhibición entre el 99-75%. Aunque deben realizarse másestudios, las 10 cepas seleccionadas presentan buenasposibilidades para el futuro desarrollo de un productobionematicida.



389

214 – DESARROLLO DE UN EXTRACTO NEMATICIDA A PARTIR DE Paecilomyces lilacinu[DEVELOPMENT OF A NEMATICIDE EXTRACT FROM Paecilomyces lilacinu] Rodríguez, A.2; Sarro, A.2; Alcalà, S.1;Ornat, C.1; Sorbías, X.1; Fernández, C.2; Lara, J.M.2; 1DEAB-UPC; 2FUTURECO BIOSCIENCE S.L.; 1,2Parc Mediterranide la Tecnologia, c/ Esteve Terrades 8, Castelldefels 08860, España. E-mail: [email protected]

Paecilomyces lilacinus es un hongo con reconocida capacidadantagonista sobre nematodos fitopatógenos. Existen variosproductos comerciales formulados a base de esporas deeste hongo, pero con escasa estabilidad y dependientes derefrigeración. El objetivo de este trabajo fue obtenerextractos derivados de la actividad metabólica de Paecilomyceslilacinus (cepa FEEP PL0501) que pudieran incorporasecomo ingrediente activo de un bionematicida comercial yestudiar su efectividad in vitro. Para ello se realizó un screeningde medios de cultivo y se seleccionó el que favorecía unmayor rendimiento del hongo. A continuación, secompararon tres sistemas de fermentación (biofermentador,orbital y estático durante 2, 3 y 15 días, respectivamente),sometiendo al hongo a diferentes grados de estrés parainducir la producción de metabolitos. Los caldos de cultivose centrifugaron y ultrafiltraron eliminando la biomasa yobteniendo diferentes prototipos (producto técnico). La

actividad nematicida de los prototipos se evaluó in vitro sobremasas de huevos y juveniles de Meloidogyne javanica. Sepusieron en contacto los productos técnicos con los dosestadios del nematodo durante una semana. A continuación,los productos técnicos se sustituyeron por aguamanteniéndose a temperatura constante (25ºC),realizándose lecturas periódicas durante un mes. Laactividad nematicida se calculó sobre la eclosión de huevosy la movilidad de juveniles. El extracto obtenido a partir debiofermentador provocó un 99% de mortalidad sobreambos estadios. El prototipo conservó su eficacia despuésde mantenerlo durante 1 año a 4ºC. Los extractosdesarrollados a partir de este estudio, constituirán elingrediente activo de un producto más estable, sencillo deproducir a nivel industrial y menos dependiente delambiente que un bionematicida clásico formulado a basede esporas.

215 – EFFECT OF CADAVER COVERINGS ON EMERGENCE AND INFECTIVITY OF Heterorhabditisbaujardi LPP7 (RHABDITIDA: HETERORHABDITIDAE) AND THE REMOVAL OF CADAVERS BYEctatomma spp. [EFEITO DA COBERTURA DE CADÁVERES NA EMERGÊNCIA E INFECTIVIDADE DEHeterorhabditis baujardi LPP7 E NA REMOÇÃO DE CADÁVERES POR Ectatomma spp.] Del Valle, E.E.1; Dolinski, C.2;Barreto, E.L.S.2; Souza, R.M.2 1Universidad Nacional del Litoral, Facultad de Ciencias Agrarias, Kreder 2805, C. P. 3080,Santa Fe, Argentina; 2Univesidade Estadual do Norte Fluminense, Laboratório de Entomologia e Fitopatologia, Av. AlbertoLamego, 2000, Pq. Califorrnia, 28015-620 Campos dos Goytacazes, RJ, Brazil. E-mail: [email protected]

Entomopathogenic nematodes (EPNs) are used for thebiological control of soil insect pests worldwide and aregenerally applied to the soil in aqueous suspension. Analternative application method that could be especiallypractical and effective under certain conditions is to applythe nematode-killed insect (referred to herein as infectedinsect cadavers) that are placed on or in the soil and fromwhich the nematodes emerge to seek new hosts. However,physical damage to the insect cadavers during handling andapplication as well as the potential detrimental impact ofvarious soil biotic and abiotic factors could reduce theefficacy of cadaver applications. Our objective was to testthe effectiveness of various protective coverings appliedto Galleria mellonella insect cadavers in terms of theirpotential impact on the emergence and virulence ofinfective juveniles of the EPN Heterorhabditis baujardi LPP7,

and to evaluate whether these coverings influenced cadaverremoval by ants (Ectatomma spp.). The protective coveringtreatments included a commercial calcareous powder, acommercial talc powder, and gelatin capsules. Thenumber of emerging infective juveniles (IJs) from insectcadavers formulated with talc powder (9.722 ± 1.382)and gelatin capsules (7.892 ± 1.072) was similar to thecontrol (6.346 ± 1.311), and indicated that thesecoverings do not interfere with IJ emergence. However,the powdered calcareous covering significantly reducedIJ emergence. High infectivity was observed for IJs thatemerged from cadavers in all treatments. Ectatomma spp.ants removed all insect cadavers from the nest entranceto a distance of 20 cm, with the exception of insectcadavers formulated in gelatin capsules, which were notremoved.

390 Vol. 33(4) - 2009


216 – INFLUENCE OF TIME PERIOD BETWEEN INFECTION BY Heterorhabditis baujardi LPP7 ANDSOIL APPLICATION OF Galleria mellonella CADAVERS ON EMERGENCE OF INFECTIVE JUVENILENEMATODES [INFLUÊNCIA DO TEMPO ENTRE A INFECÇÃO POR Heterorhabditis baujardi LPP7 E AAPLICAÇÃO NO SOLO DE CADAVERES DE Galleria mellonella SOBRE A EMERGÊNCIA DE JUVENILESINFECTANTES] Del Valle, E.E.1; Dolinski, C.2; Barreto, E.L.S.2; Souza, R.M.2 1Universidad Nacional del Litoral, Facultadde Ciencias Agrarias, Kreder 2805, C. P. 3080, Santa Fe, Argentina; 2Univesidade Estadual do Norte Fluminense, Laboratóriode Entomologia e Fitopatologia, Av. Alberto Lamego, 2000, Pq. Califorrnia, 28015-620 Campos dos Goytacazes, RJ,Brazil. E-mail: [email protected]

Application of entomopathogenic nematodes (EPNs) asinsect cadavers has recently become an alternative to theuse of chemicals for the control of agricultural pests thathave a life stage in the soil. The production cost is very low,because it avoids or decreases concentration and theformulation and stocking costs of infective juveniles (IJs)required in production involving aqueous suspension. Manycharacteristics related to the biology and physiology ofEPNs applied as insect-cadavers are still unknown. Amongthese characteristics, understanding the consequences onIJ emergence of different intervals between infection andsoil application is crucial to establish an ideal applicationmoment in pest control programs with EPNs. The objectiveof the present work was to evaluate the influence ofdifferent time periods between the infection and soilapplication of the Galleria mellonella larva cadavers, infected

with Heterorhabditis baujardi LPP7, on the emergence of theinfective juvenile nematodes. After 6, 8, 10 and 12 days theG. mellonella larvae cadavers infected with H. baujardiLPP7 were placed individually in plastic cups filled withsoil from a commercial guava orchard. Nematodeextraction from the pots was performed twenty days afterinfecting the G. mellonella larvae according to Jenkins’method. Live infective juveniles were differentiated fromother nematode species based on their characteristiclocomotion, size and bucal morphology and counted ina dissecting microscope with the aid of a Peters slide.As a result, the time period of six to ten days betweeninfection and application on soil of Galleria mellonellacadavers resulted in higher emergence of IJs, beingrecommended when insect cadavers were chosen asapplication method.

217 – MANEJO DE NEMATODOS FITOPARÁSITOS Y SU INFLUENCIA EN LA BIODIVERSIDADEDÁFICA [MANAGEMENT OF PLANT PARASITIC NEMATODES AND ITS INFLUENCE ON EDAPHICBIODIVERSITY] Arcos, S.C.1; López-Pérez, J.A.2; Díez-Rojo, M.A.1; García-Dorado, V.1; Torres-Nieto, J.M.3; González-López, M.R.1; Martínez, C.1; Navas, A.4; Bello, A.1 1Dpto Agroecología, Centro de Ciencias Medioambientales, CSIC,Madrid, España; 2Centro Agrario de Marchamalo, JCCM, Guadalajara, España; 3SAT Costa de Níjar, Almería, España;4Dpto Biodiversidad y Biología Evolutiva, Museo Nacional de Ciencias Naturales, CSIC, Madrid, Spain. E-mail:[email protected]

Se ha estudiado el efecto de las principales alternativasquímicas y no químicas a los fumigantes del suelo en elcontrol de nematodos fitoparásitos sobre la diversidadestructural y funcional de los suelos agrícolas. Para ello, sehan estudiado tanto cultivos hortícolas como extensivosde las regiones agroclimáticas más representativas de laPenínsula Ibérica, como modelos de referencia en el estudiodel comportamiento ecológico de los nematodos del sueloen ambientes mediterráneos. Se ha determinado su eficaciaen el control de los nematodos fitoparástos y su influenciasobre los nematodos saprófagos y depredadores, así comosobre los enquitréidos del grupo de los oligoquetos. Enrelación con las alternativas químicas, se ha encontrado quea pesar de su eficacia en el manejo de las poblaciones denematodos fitoparásitos, también se produce una reducciónde las poblaciones de saprófagos, depredarores y

enquitréidos. Por el contrario, las alternativas no químicasensayadas, muestran un incremento del grupo de losrabdítidos y enquitréidos. En relación con el grupo de losdoriláimidos, desaparecen prácticamente con las alternativasquímicas, en el caso de las no químicas sus poblaciones seven reducidas al incrementar las dosis de los tratamientos.Se ha determinado el valor bioindicador de los doriláimidossobre el impacto ambiental de las alternativas de manejoestudiadas, tratando de seleccionar qué especies son las másrepresentativas, encontrando para la Península Ibéricaprincipalmente Aporcelaimellus obtusicaudatus & Discolaimoidesbulbiferus que aparecen en todas las zonas de estudioviéndose afectadas sus poblaciones con los tratamientos,Aporcelaimellus adriaani se muestra susceptible a dosis altasde vinaza de remolacha y Ecumenicus monohystera essusceptible a los tratamientos con estiércol de origen animal.



391

218 – PARASITISMO DEL NEMATODO Strelkovimermis spiculatus EN LARVAS DE MOQUITOS Culexquinquefasciatus [PARASITISM OF NEMATODE Strelkovimermis spiculatus IN MOSQUITO LARVAE OF Culexquinquefasciatus] Pérez-Pacheco, R.1; Canseco Pinacho, M.E.C.1; Vega y, J.R.1; Flores-Ambrosio, G.1 1CIIDIR-IPN-OAXACAdel Instituto Politécnico Nacional. Calle Hornos No. 1003 Colonia indeco-xoxocotlan, C.P. 68000, Oaxaca,Oaxaca, Mexico.E-mail: [email protected]

El nematodo parásito de larvas de mosquitos S. spiculatus,fue encontrado en 1982, en la Provincia de Buenos Aires,Argentina, parasitando larvas de Aedes albifasciatus. A la fechase han realizado pocas investigaciones de su biología yefectividad parasítica. En la presente investigación serealizaron estudios de caracterización biológica delnematodo S. spiculatus, planteando los objetivos: Evaluar lacapacidad parasítica de S. spiculatus en condiciones delaboratorio y criaderos de larvas de mosquitos Culexquinquefasciatus y determinar la capacidad de supervivencia(reciclaje) de S. spiculatus, en criaderos de larvas demosquitos. 1. Para evaluar la ssusceptibilidad de larvas deC. quinquefasciatus, al parasitismo de diferentes dosis de S.spiculatus. Se aplicaron cinco diferentes dosis de nemátodos(20:1, 15:1, 10:1, 5:1 y 3:1 nemátodos/larva), posteriormentese determinaron los porcentajes de parasitismo (PP) ymedias de infestación (MI, número de nematodos queparasitan una larva de mosquito), en los resultadosobtenidos se registraron PP 100% en las cinco dosisaplicadas y MI de 11.15, 9.65, 7.05, 4.20, 2.65 en las dosis20, 15, 10, 5 y 3:1 respectivamente, presentando altadiferencia estadística (Tukey α=0.05). 2.- Para conocer elefecto de la aplicación de diferentes densidades denematodos en criaderos de larvas de mosquitos C.quinquefasciatus. En criaderos de un metro cuadrado de

superficie y una lamina de agua de 25 cm se depositaron500 larvas de II instar de mosquito, para mantener unadensidad larval de 500 larvas por m2, donde se aplicarontres diferentes densidades (dosis) de S. spiculatus (1000, 3000y 5000 nematodos/m2). En los resultados obtenidos seregistraron PP de 100, 97.5 y 80%, y MI de 5.4, 3.5, y 1.2nematodos con las dosis de 5,000, 3000 y 1000 nematodospor m2 respectivamente. Los análisis de varianza y la pruebade medias Tukey α=0.05 para los datos de MI demuestranque existen diferencias altamente significativas entre lostratamientos probados (p<0.01). 3.- Para determinar lasupervivencia (reciclaje) de S. spiculatus en criaderos demosquitos C. quinquefaciatus. En criaderos de 1 m2 de superficiey una lámina de agua de 25 cm. se depositaron 500 larvas deC. quinquefaciatus de instar II y se aplicaron 5000 nemátodospreparasíticos (dosis de10:1). En resultados obtenidos por unperiodo de 24 semanas, se observo la supervivencia (reciclaje)del nematodo, obteniendo PP que oscilan en un rango de 12.5al 100 % y MI de 0.13 a 18.43 nematodos por larva parasitada.Con una sola aplicación de nematodos se logró la sobrevivenciadel nematodo en el criadero, continuando su ciclo biológicodespués de la emergencia logrando eficientemente sucruzamiento, reproducción y eclosión de nuevas generacionesde nematodos preparasiticos en las condiciones de agua y suelousados.

219 – THE USE OF HEBERNEM IN VEGETABLES AND BANANA [O USO DO HEBERNEM EMHORTALIÇAS E BANANEIRA] Mena, J.1; Pimentel, E.1; Smith, E.1; Mesa, L.1; Armas, R.2; Marín, M.1; Hernández, A.1

Nordelo, C.B.3 1Center for genetic Engineering and Biotechnology, Camagüey, Cuba; 2Center for genetic Engineering andBiotechnology, Sancti Spiritus, Cuba; 3Center for genetic Engineering and Biotechnology. La Habana, Cuba. E-mail:[email protected]

Tsukamurella paurometabola bacterium, strain C-924, liquidformulation (HeberNem-L), was registered as a biologicalnematocide under permission N° 001/2007 (at the NationalPlant Protection Registration Entity). A humectable powderformulation has been devised (HeberNem-S), which hasalso been registered in Cuba (permission N° 050/08). Theobjective of this work is to show the results of applyingHeberNem to different productive systems. The total areatreated with HeberNem-L from April 2004 up to 2008, forprotected crops, is of 175.7 ha. Phytoparasitic nematodepopulation was reduced from 4 500 to 18 per 100 g of rootson banana plantations using three treatments during a year.

The insertion of this product in the productive systems throughIntegrated Pest Management (IPM) has taken place, since theTechnical Effectiveness (%TE) of HeberNem-L andHeberNem-S in the control of nematodes was over 70% in allthe areas where the application and handling requisites werefollowed. In addition, results were presented in semi-coveredcultivation systems (lettuce) in which yield reached 28.7 kg pertreated plot with HeberNem-S, and only 16.0 kg per untreatedplot. These results also proved HeberNem’s efficacy inimproving crops since it helped the plants to optimize theabsorption of organic matter by enhancing the intake ofnitrogen and phosphorus.

392 Vol. 33(4) - 2009


220 – INTERACTION EFFECT OF Folsomia candida, Enchytraeus crypticus AND Meloidogyne paranaensisIN RESPONSE TO Paecilomyces lilacinus FUNGUS PRESENCE [EFEITO DA INTERAÇÃO DE Folsomiacandida, Enchytraeus crypticus E Meloidogyne paranaensis EM RESPOSTA À PRESENÇA DO FUNGO Paecilomyces lilacinus]Cadioli, M.C.1; Santiado, D.C.1; Souza, J.P.A.F.2; Abrantes, I. M.O.2 1Universidade Estadual de Londrina, Departamento deAgronomia, C. P. 6001, 86051-990 Londrina, PR, Brazil; 2Universidade de Coimbra, Departamento de Zoologia, 3004-517, Coimbra, Portugal. E-mail: [email protected]

O fungo Paecilomyces lilacinus tem sido relatado como agentede biocontrole de nematóides e, com o interesse por práticasecologicamente corretas, muita ênfase tem sido dada àestrutura da comunidade invertebrada do solo, visandoidentificar um manejo que possa otimizar atividades para ofuncionamento do ecossistema. Este trabalho objetivouavaliar em microcosmos a interação de dois microrganismosbioindicadores do solo em conjunto com Meloidogyneparanaensis em relação à aplicação de P. lilacinus em tomateiro.O trabalho foi realizado na Universidade de Coimbra –PT, onde, foram estudados 16 tratamentos com cincoréplicas utilizando todas as interações entre planta,colêmbolo, enchytraiedae, nematóide e fungo, emdelineamento de blocos ao acaso. Recipientes de 1,5 L foramutilizados contendo 750g de solo artificial, segundo asnormas do ISO. Aos 30 dias de transplantio, plântulas detomateiro ´Easypeel‘ foram inoculadas com 5000 ovos deM. paranaensis. Foram utilizadas populações de 20organismos de Folsomia candida e Enchytraeus crypticus nosmicrocosmos, segundo as normas do ISO. Após, foram

aplicados 650 mg do fungo diluídas em 10 ml de águadestilada. Os microcosmos foram fechados para que nãohouvesse perda dos microrganismos e, após 60 dias foramavaliadas características de desenvolvimento das plantas,população de M. paranaensis nas raízes, número de F. candida,número de E. crypticus e sobrevivência do fungo. Osresultados para a altura das plantas, peso de parte aérea ede raiz mostraram-se variáveis, já o tratamento com fungo+ nematóides + colêmbolos diferiu significativamente dosdemais tratamentos com menor desenvolvimento nas trêsvariáveis. Foi constatado que para número de ovos, ostratamentos com fungo + nematóides + colêmbolos e fungo+ nematóides + enchytraeidae apresentaram FR<1. A presençado fungo proporcionou aumento na reprodução de F. candidae E. crypticus no final do experimento, já para sobrevivênciado fungo foi constatado que os tratamentos com fungo +nematóide + colêmbolos e o fungo + nematóide apresentarammaior sobrevivência e diferiram estatisticamente dos demaistratamentos. Este trabalho foi financiado pelo vínculo decooperação internacional CAPES/GRICES.

221 – INFLUENCE OF Heterorhabditis indica LPP4 AND H. baujardi LPP7 (RHABDITIDA:HETERORHABDITIDAE) ON THE PRE POSTURE AND POSTURE PERIODS OF ENGORGEDFEMALES OF Rhipicephalus (Boophilus) microplus SENSITIVE AND RESISTANT STRAINS [INFLUÊNCIADE Heterorhabditis indica LPP4 e H. baujardi LPP7 NO PERÍODO DE PRÉ POSTURA E POSTURA DE FÊMEASINGURGITADAS DE Rhipicephalus (Boophilus) microplus ESTIRPES SENSÍVEIS] Machado, I.R.1; Minas, R.S.1; Dolinski,C.M.1 1Universidade Estadual do Norte Fluminense Darcy Ribeiro Campos, RJ, Brazil. E-mail:[email protected]

Rhipicephalus (Boophilus) microplus Canestrini, 1887 are numberone ectoparasites of cattle, causing great economic losses,mainly due to lower milk production, mortality andreduction of weight gain. The use of agents for biologicalcontrol of pests, such as entomopathogenic nematodes(EPNs) is an alternative for reducing the use of chemicals.The objectives of this study were to evaluate the use ofEPNs in the pre posture and laying period of females ofR. (B.) microplus (Acari: Ixodidae) strains sensitive and

resistant to tickcides, in order to know the effects of theaction of pathogenic nematodes on these two periods. Wetested seven treatments plus the control, represented bydifferent concentrations of juveniles (15, 30, 60, 120, 240,480 and 960). The nematodes H. indica LPP4 and H. baujardiLPP7 influenced the posture of sensitive and resistantfemales most negatively, the more infective juveniles wereapplied. In the pre-posture period the same interferencewas not observed.



393

222 – INTERFERENCE OF ENTOMOPATHOGENIC NEMATODES Heterorhabditis indica LPP4 ANDH. baujardi LPP7 (RHABDITIDA: HETERORHABDITIDAE) IN THE SURVIVAL OF SENSITIVE ANDRESISTANT ENGORGED FEMALES Rhipicephalus (Boophilus) microplus STRAINS [INTERFERÊNCIADE NEMATÓIDES ENTOMOPATOGÊNICOS Heterorhabditis indica LPP4 E H. baujardi LPP7 (RHABDITIDA:HETERORHABDITIDAE) NA SOBREVIVÊNCIA DE FÊMEAS INGURGITADAS ESTIRPES SENSÍVEIS ERESISTENTES DE Rhipicephalus (Boophilus) microplus] Machado, I.R.1; Minas, R.S.1; Dolinski, C.M.1 1Universidade Estadualdo Norte Fluminense Darcy Ribeiro, Campos, RJ, Brazil. E-mail: [email protected]

The tick Rhipicephalus (Boophilus) microplus (Acari: Ixodidae)is one of the most economically important ectoparasitesof cattle. In Brazil, livestock is suffering great economiclosses in terms of the tick R. (B.) microplus. There are goodprospects for the use of entomopathogenic nematodes(EPNs) of the families Steinernematidae Chitwood &Chitwood, 1937 and Heterorhabditidae Poinar, 1976(Nematoda: Rhabditida) in the control of ectoparasites. This

study aimed to evaluate the influence of H. indica LPP4and H. baujardi LPP7 in the survival period of sensitiveand resistant females. We tested seven treatments plus thecontrol, represented by different concentrations of juveniles(15, 30, 60, 120, 240, 480 and 960). A reduction in survivalwas demonstrated with increasing concentration of juvenilesin both sensitive and resistant females when either nematodewas applied. Further studies in the field need to be done.

223 – EVALUATION OF THE CONTROL OF Meloidogyne paranaensis WITH NEMATOPHAGOUS FUNGIAND ORGANIC AMENDMENTS IN IRRIGATED COFFEE PLANTATION [AVALIAÇÃO DO CONTROLEDE Meloidogyne paranaensis COM FUNGOS NEMATÓFAGOS E PRODUTOS ORGÂNICOS EM CAFEZALIRRIGADO] Soares, P.L.M.1; Ferreira, R.J.2; Barbosa, B.F.F.1; Santos, J.M.1 1UNESP/FCAV, Câmpus de Jaboticabal,Departamento de Fitossanidade, Laboratório de Nematologia; 2Faculdade de Educação São Luis. Jaboticabal, SP, Brazil.E-mail: [email protected]

Brazil is the world’s largest producer of coffee, with 32%of production. Nematodes, especially root-knot nematodes,are among the main factors that limit production in Brazil.Aiming to mitigate the losses caused by these pests, theeffectiveness was evaluated of amixture of equal parts ofthe substrate composed of sugarcane bagasse enriched withrice bran, colonized by the nematophagous fungiArthrobotrys musiformis, A. oligospora, Paecilomyces lilacinus andPochonia clamydosporia alone, applied separately or incombination with products of organic origin, in the controlof Meloidogyne paranaensis on coffee “Catuaí Vermelho Rubi”,eight years old, drip irrigated, in Patrocínio-MG. Thetreatments were: 1.Control without application of anyproduct; 2.Fungi (1.0 L/plant); 3.Fungi + Organomineralfertilizer prepared with filter cake from the mill (1.0 L +0.6 kg); 4.Fungi + Agrolmim ®, a product containing fulvicand humic acids (1.0 L + 80 mL), 5. Organomineral fertilizer(0.6 kg); 6.Agrolmim (80 mL) and the standard 7.Aldicarbe(Temik ® 150 GR at a dose of 20 g/plant) and 8.Terbufós(Counter ® 150, the dose of 20 g/plant). The experimentalplot was composed of five adjacent plants, where all were

treated and only three plants were used as a floor area ofthe plot. The experimental design was a randomized blockwith eight treatments and five replications. We evaluatedthe population of the nematode in the soil and roots,before application of the treatments and at 30, 60, 90and 120 days after application. Both the soil and rootsof the coffee plants, all treatments evaluated, in additionto the standards Temik and Counter, showed averagesmore than 70% of control of M. paranaensis in at least inone of the periods. In the soil, there were treatments3.Fungi + Organomineral fertilizer (1.0 L + 0.6 kg) andstandard 7.Aldicarbe (Temik 150 GR 20 g/plant), withaverages above 75% of control of M. paranaensis in atleast three of the four assessments. In the roots, thetreatments they stood out were 2.Fungi (1.0 L); 3.Fungi+ Organomineral fertilizer (1.0 L + 0.6 kg); 4.Fungi +Agrolmim (1.0 L + 80 mL) and standard 7.Aldicarbe(Temik 150G 20 g/plant) with averages over 69% ofcontrol of M. paranaensis in at least in 3 of 4 ratings,higher than the standard 8.Terbufós (Counter ® 150 20g/plant). Support from Fapesp

394 Vol. 33(4) - 2009


224 – CONTROL OF Tylenchulus semipenetrans IN CITRUS USING NEMATOPHAGOUS FUNGI ANDORGANIC AMENDMENTS [CONTROLE DE Tylenchulus semipenetrans EM CITROS UTILIZANDO FUNGOSNEMATÓFAGOS E PRODUTOS DE ORIGEM ORGÂNICA] Soares, P.L.M.1; Ferreira, R.J.2; Barbosa, B.F.F.1; Santos,J.M.1 1UNESP/FCAV, Câmpus de Jaboticabal, Departamento de Fitossanidade, Laboratório de Nematologia; 2Graduandoem Ciências Biológicas da Faculdade de Educação São Luis. Jaboticabal, SP, Brazil. E-mail: [email protected]

The cultivation of citrus worldwide has average annuallosses of 14.2% caused by nematodes. Aiming to minimizethese losses, the effectiveness was evaluated of the mixtureof nematophagous fungi (Arthrobotrys musiformis, A.oligospora, Paecilomyces lilacinus and Pochonia clamydosporiamultiplied separately in sugar cane bagasse enriched withrice bran) alone or mixed with products of organicamendment, in control of Tylenchulus semipenetrans in areaof commercial production of sweet orange “Valencia” onrootstock of “Lemon lime”, with 18 years in Itápolis-SP.The treatments were: 1.Control without application of anyproduct; 2.Fungi (1 L/plant); 3.Fungi (2 L); 4.Fungi +Organomineral Fertilizer prepared with filter cake fromsugar mill (1 + L 5.6 kg); 5.Fungi + OrganomineralFertilizer (2 L + 5.6 kg); 6.Fungi + Condisolo ® (1 L + 5.0kg); 7.Fungi + Condisolo (2 L + 5.0 kg); 8.Fungi +Agrolmim ® product consists of humic and fulvic acids (1+ 4 L); 9.Fungi + Agrolmim (2 + 4 L), 10. OrganomineralFertilizer (5.6 kg); 11.Condisolo (5.0 kg); 12.Agrolmim (4L); 13.Agrolmim (8 L); 14.Agrolmim (4 L deployment inthe + 4 L at 60 days after deployment) and standard15.Aldicarbe (Temik ® 150 GR 130 g/plant). The

experimental plot was composed of 5 plants, where only 3plants were treated and used for evaluations. Theexperimental design was a randomized block design with15 treatments and 4 replicates. We evaluated the populationof the nematode in the soil and roots before the applicationof treatments, and at 30, 60, 90 and 120 days afterapplication. Under the conditions of this study, both thesoil and roots of citrus, all treatments evaluated, besidesthe default aldicarb showed average above 70% control ofT. semipenetrans, in at least one of the periods. In soil, thetreatments were 6.Fungi + Condisolo (1.0 L + 5.0 kg),8.Fungi + Agrolmim (1.0 + 4.0 L), 9.Fungi + Agrolmim(2.0 + 4.0 L), 10.Organomineral Fertilizer (5.6 kg),13.Agrolmim (8.0 L), 14.Agrolmim (4 + 4 L) and15.Aldicarbe (Temik ® 150 GR 130 g) with averages above65% control of T. semipenetrans, in at least 3 of the 4assessments, after the treatment. In roots, there were thetreatments 7.Fungi + Condisolo (2.0 L + 5.0 kg), 9.Fungi+ Agrolmim (2.0 + 4.0 L), 13.Agrolmim (8.0 L) and15.Aldicarbe (Temik ® 150 GR 130 g), with averages above60% control of T. semipenetrans, in at least 3 of the 4evaluations. Apoio Fapesp

225 – EFFECTIVENESS OF NEMATOPHAGOUS FUNGI AND ORGANIC AMENDMENTS IN THECONTROL OF Meloidogyne mayaguensis IN GUAVA TREE [EFICÁCIA DE FUNGOS NEMATÓFAGOS EPRODUTOS DE ORIGEM ORGÂNICA NO CONTROLE DE Meloidogyne mayaguensis EM GOIABEIRA] Soares,P.L.M.1; Ferreira, R.J.2; Barbosa, B.F.F.1; Santos, J.M.1 1UNESP/FCAV, Câmpus de Jaboticabal, Departamento deFitossanidade, Laboratório de Nematologia; 2Graduando em Ciências Biológicas da Faculdade de Educação São Luis.Jaboticabal, SP, Brazil. E-mail: [email protected]

The root-knot nematode (Meloidogyne mayaguensis) hassignificantly reduced the area under cultivation with guavain the main producing regions. Aiming to minimize theimpacts of nematode, the effectiveness was evaluated ofthe mixture of nematophagous fungi (Arthrobotrys musiformis,A. oligospora, Paecilomyces lilacinus and Pochonia clamydosporiamultiplied separately in sugar cane bagasse enriched withrice bran) alone or mixed with products of organicamendment, in control of M. mayaguensis in area ofcommercial cultivation of eight year old irrigated guava“Paluma”, in Vista Alegre do Alto-SP. The treatments were:1.Control without application of any product; 2.Fungi (1 L/ plant); 3.Fungi (2 L); 4.Fungi + Organomineral Fertilizerprepared with filter cake from sugar mill (1 + L 5.6 kg);5.Fungi + Organomineral Fertilizer (2 L + 5.6 kg); 6.Fungi+ Condisolo ® (1 L + 5.0 kg); 7.Fungi + Condisolo (2 L +5.0 kg); 8.Fungi + Agrolmim ® product consists of humic

and fulvic acids (1 + 4 L); 9.Fungi + Agrolmim (2 + 4 L),10. Organomineral Fertilizer (5.6 kg); 11.Condisolo (5.0 kg);12.Agrolmim (4 L); 13.Agrolmim (8 L); 14.Agrolmim (4 Ldeployment in the + 4 L at 60 days after deployment) andstandard 15.Aldicarbe (Temik ® 150 GR 130 g). Theexperimental plot was composed of 5 plants, where only 3plants were treated and used for evaluations. Theexperimental design was a randomized block design with15 treatments and 4 replicates. We evaluated the populationof the nematode in the soil and roots before the applicationof treatments, and at 30, 60, 90 and 120 days afterapplication. Under the conditions of this study, both thesoil and roots of guava, in all treatments evaluated, besidesthe default aldicarb, showed average above 70% control ofM. mayaguensis in at least one of the periods. In soil, thetreatments were 2.Fungos (1 L/plant); 4.Fungi +Organomineral Fertilizer (1 L + 5.6 kg); 5.Fungi +



395

Organomineral Fertilizer (2 L + 5.6 kg); 7.Fungi +Condisolo (2 L + 5.0 kg); 8.Fungi + Agrolmim (1 + 4 L);10. Organomineral Fertilizer (5.6 kg); 11.Condisolo (5.0 kg);12.Agrolmim (4 L); 13.Agrolmim (8 L); 14.Agrolmim (4 Lin the implementation + 4 L to 60 days after implantation)and standard 15.Aldicarbe (Temik ® 150 GR 130 g), withaverages above 61% control of M. mayaguensis, in at least in3 of 4 ratings, after the treatment. Roots, there are thetreatments 3.Fungos (2 L); 4.Fungi + Organomineral

Fertilizer (1 L + 5.6 kg); 5.Fungi + Organomineral Fertilizer(2 L + 5.6 kg), 6. Fungi + Condisolo ® (1 L + 5.0 kg);8.Fungos + Agrolmim ® (1 + 4 L), 10. OrganomineralFertilizer (5.6 kg); 11.Condisolo (5.0 kg); 12.Agrolmim (4L); 13.Agrolmim (8 L); 14.Agrolmim (4 L deployment inthe + 4 L at 60 days after deployment) and standard15.Aldicarbe (of Temik ® 150 GR 130 g), with averagesabove 67% control of M. mayaguensis, in at least 3 of the 4evaluations. Apoio Fapesp

226 – MANAGEMENT OF NEMATODES USING NEMATOPHAGOUS FUNGI IN AREA OFCOMMERCIAL CULTIVATION OF OKRA [MANEJO DE NEMATOIDES UTILIZANDO FUNGOSNEMATÓFAGOS EM ÁREA DE CULTIVO COMERCIAL DE QUIABEIRO] Soares, P.L.M.1; Ferreira, R.J.2; Santos,J.M.1 1UNESP/FCAV, Câmpus de Jaboticabal, Departamento de Fitossanidade, Laboratório de Nematologia; 2Graduandoem Ciências Biológicas da Faculdade de Educação São Luis. Jaboticabal, SP, Brazil. E-mail: [email protected]

In almost all regions of the world, including Brazil,nematodes are among the most damaging problems for okracrops (Hibiscus esculentus L.). Aiming to minimize the impactof Meloidogyne javanica and Pratylenchus brachyurus on infestedareas and production of commercial cultivation of okra inthe city of Piacatu - SP, this study evaluated the effectivenessof the mixture of nematophagous fungi (Arthrobotrysmusiformis = AM, A. oligospora = AO, Dactylella leptospora =DL, Monacrosporium elegans = ME and Paecilomyces lilacinus =PL) multiplied separately in sugar cane bagasse enrichedwith rice bran) alone or mixed with different products. Eachexperimental plot used two lines of 3 m in length spaced at1.10 m. The 8 treatments evaluated with four replicateseach, distributed in randomized block design were: 1.Control without application of any product; 2. Fungi 4 L(AM, AO, DL, ME and PL) / 2 rows of 3 m length; 3.Fungi 4 L + OM – 15 + OM 21 Organomineral fertilizerprepared with factory filter cake (1000 kg/ha) = 300 g ofeach; 4. Fungi 4 L + Agrolmim product consisting of humicand fulvic acids (300 L/ha) = 90 mL; 5. Fungi 4 L + Nemix(10 kg in 300 L water/ha) = 6 g in 90 mL; 6. OM - 15 +OM - 21 (1000 kg/ha) = 300 g of each; 7. Agrolmim (300

L/ha) = 90 mL and 8. Nemix ® (10 kg in 300 mL of water/ha) 6 g in 90 mL. We evaluated the population of thenematode in the soil and roots before the application oftreatments, and at 30, 60, 90 and 120 days after application.Under the conditions of this study, roots in all thetreatments evaluated, showed higher averages than thecontrol at 63 and 73% of M. javanica and P. brachyurus,respectively, according to Abbott (1925), in at least one ofthe periods. In soil, all treatments evaluated showed higheraverages than the control at 75 and 75% control of M.javanica and P. brachyurus, respectively, in at least one of theperiods. We documented an overview of the plots,illustrating okra plants at 30, 60 and 90 days after sowingthe plots. Also documented were the okra plants at 60 daysafter sowing, and withdrawal of plots, showing cleardifferences in development, depending on the treatmentadopted and the best treatments in descending order bythe visual aspect of development of plants were: 3. Fungi+ OM-15 + OM-21; 2. Fungi; 4. Fungi + Agrolmim; 5.Fungi + Nemix; 6. OM-15 + OM-21; 7. Agrolmim; 8.Nemix and 1. Control without application of any product.Apoio Fapesp

227 – EFFICACY OF NEMATOPHAGOUS FUNGI AND ORGANIC AMENDMENTS IN THE CONTROLOF Meloidogyne exigua ON RUBBER TREE [EFICÁCIA DE FUNGOS NEMATÓFAGOS E PRODUTOSORGANICOS NO CONTROLE DE Meloidogyne exigua EM SERINGUEIRA] Soares, P.L.M.1; Ferreira, R.J.2; Barbosa,B.F.F.1; Santos, J.M.1; Fonseca, F.3 1UNESP/FCAV, Câmpus de Jaboticabal, Departamento de Fitossanidade, Laboratóriode Nematologia; 2Faculdade de Educação São Luis. Jaboticabal, SP, Brazil; 3Pesquisa & Desenvolvimento, Plantações E.Michelin Ltda, Itiquira, MT, Brazil. E-mail: [email protected]

Meloidogyne exigua causes abundant formation of galls onthe roots of rubber predisposing the plant to the action ofLasiodiplodia theobromae opportunistic fungus that causes drysymptoms. Aiming to minimize the impact of this nematode

as a predisposing factor to the action of L. theobromae, theeffectiveness was evaluated of the mixture of equal partsof the substrate composed by sugarcane bagasse enrichedwith rice bran, colonized, individually, by nematophagous

396 Vol. 33(4) - 2009


fungi Arthrobotrys musiformis, A. oligospora, Dactylella leptospora,Monacrosporium elegans and Paecilomyces lilacinus. Thecombination of doses of this material harrowed with soiland doses of the product Agrolmin ®, based on fulvic andhumic acids and a organomineral fertilizer prepared withfilter cake from sugar mill was assessed in a cultivation ofrubber, clone RRIM 600, established in 1983, with 8 mspacing between rows and 3 m between plants, in soil typeOxisol, infested by M. exigua in the geoeconômica regionof Rondonopolis-MT. We tested the following treatments:1.Control - without application of any product withoutrevolving the soil; 2.Fungi + Agrolmim ® at doses of 2 +0.72 L/plant; 3.Agrolmim, at a dose of 0.72 L; 4.Agrolmimin dose of 0.36 L in the deployment and 0.36 L/plant at 30days after implantation of the experiment; 5.Agrolmim, ata dose of 0.72 L and harrowing in the application of theproduct; 6.Harrowing and 7.Fungi in the dose of 2 L/plantin the implementation of the experiment, more than 2 kg/plant of the organomineral fertilizer, 30 days afterimplantation of the test. The experimental plot wascomposed of 3 rows with 8 plants each, totalizing 24 plants,

and the lines of the side and the first two and last twoplants in the middle row were used as borders. Therefore,the useful portion contained the 4 plants of the center.The statistical design was completely randomized blockswith 7 treatments and 4 replicates. We evaluated thepopulation of the nematode in the soil and roots, beforeapplication of treatments and at 30, 60, 90, 120 and 150days after application. Besides these variables the diameterof the trunk was also measured, at breast height, beforethe implementation of treatment and at 6 and 12 monthsafter application. The data showed that both the soil and inroots, all the treatments tested had the control of M. exigua,with averages above 70%, compared to the control of at leastone of the assessments. These treatments also increased thediameter of the trunk of rubber trees, at breast height, whichat 6 months there was a variation from 1.68 to 5.10%, comparedto the control. At 12 months this variation was from 1.68 to4.91%, except for treatment 6 (harrowing) which was negativeto - 0.57 and - 0.63%, respectively, lower than the controltreatment without application of any product without revolvingthe soil. Apoio Fapesp

228 – EFEITO DE METABÓLITOS DE BACTÉRIAS ENDOFÍTICAS NO CONTROLE DE Meloidogyneincognita [EFFECT OF ENDOPHYTIC BACTERIUM METABOLITES ON THE CONTROL OF Meloidogyne incognita]Pinho, R.S.C.1; Campos, V.P.1; Costa, L.S.A.S.1; Souza, R.M.1; Oliveira, D.F.1; Oliveira, M.S.1 1Universidade Federal deLavras, C. P. 3037, 32700-000 Lavras, MG, Brazil. E-mail: [email protected]

O cultivo de bactérias endofíticas em meio de cultura resultana alteração de sua composição devido aos metabólitosproduzidos, os quais podem ser tóxicos aos fitonematóides.Objetivou-se neste trabalho comparar o efeito dosobrenadante de cultura bacteriana na forma bruta,liofilizada e liofilizada sem aminoácidos na mortalidade dejuvenis do segundo estádio (J2) de Meloidogyne incognita.Quarenta e quatro isolados de bactérias endofíticas foramcultivados em meio líquido “tryptic soy broth”. Apósremoção das células bacterianas, o sobrenadante foicolocado em três frascos, sendo submetido a liofilização oconteúdo de dois deles e o terceiro frasco foi mantido naforma bruta. Após a liofilização, foi feita a extração deaminoácidos com diclorometano, em um dos frascos e, em

seguida a solução foi concentrada em evaporador rotatórioaté total remoção do solvente orgânico. Para realização dostestes de mortalidade de J2, adicionaram-se 100 μL dosobrenadante bruto, liofilizado ou liofilizado semaminoácidos em cada célula de placa ELISA. Em seguida,foram adicionados 10 mL de solução de pentabiótico a 3000ppm e 20 μL de suspensão com 20 J2 de M. incognita porcélula. O sobrenadante de cada cultura após a liofilizaçãoproporcionou, sempre, menor mortalidade de J2 quandocomparado com o respectivo, sobrenadante bruto. Aretirada de aminoácidos pelo diclorometano, tambémreduziu a atividade nematicida dos isolados, indicandoser essas substâncias princípios ativos das culturasbacterianas.

229 – APLICAÇÃO DE Pochonia chlamydosporia AO SOLO EM PRÉ-PLANTIO PARA CONTROLE DEMeloidogyne javanica EM TOMATEIRO [APPLICATION OF Pochonia chlamydosporia ON SOIL PRIOR TOPLANTING FOR THE CONTROL OF Meloidogyne javanica IN TOMATO] Podestá, G.S.1; Freitas, L.G.1; Xavier, D.M.1;Amora, D.X.1; Dallemole-Giaretta, R.1; Silva, M.L.N.1; Ferreira, P.A.1 1Universidade Federal de Viçosa, Departamento deFitopatologia, 36571-000 Viçosa, MG, Brazil. E-mail: [email protected]

O fungo Pochonia chlamydosporia atua no controle donematóide das galhas parasitando seus de ovos antes que

os juvenis eclodam. Nesse trabalho avaliou-se o efeito dotempo de contato do fungo com o nematóide no solo antes



397

do transplantio das mudas de tomate para a redução doinóculo inicial do nematóide. O isolado UFV 10 de P.chlamydosporia foi cultivado em arroz por 21 dias a 26°C. Ostratamentos consistiram na incorporação de 6g de substratopor vaso com 2L de solo, mais 4000 ovos de M. javanica,nos tempos: 0, 5, 10, 15, 20 dias antes do transplantio deuma muda de tomateiro, com aproximadamente 15 cm dealtura. Apenas ovos do nematóide foram introduzidos nosolo nos tratamentos testemunhas, nas diferentes épocas.O delineamento experimental foi inteiramente ao acaso,com 9 repetições por tratamento. Os números de galhas e

de ovos por grama de raiz foram determinados 45 dias apóso transplantio. Das cinco épocas de incorporação desubstrato colonizado, 20 dias antes do transplantio semostrou mais eficiente no controle de galhas, com 74% deredução em relação à testemunha. Já para ovos, tanto 15,quanto 20 dias antes do transplantio se destacaram, comreduções de 70 e 82% respectivamente em relação àtestemunha. Conclui-se, portanto, que a introdução dofungo 15 a 20 dias antes do transplantio aumenta suaeficiência no controle do nematóide das galhas. Apoio:FAPEMIG, CNPQ.

230 – INFLUÊNCIA DO NEMATÓIDE ENTOMOPATOGÊNICO Heterorhabditis baujardi LPP7 NAECLOSÃO DE J2 DE Meloidogyne mayaguensis [INFLUENCE OF THE ENTOMOPATHOGENIC NEMATODEHeterorhabditis baujardi LPP7 ON THE ECLOSION OF Meloidogyne mayaguensis J2] Ferreira, T.F.1; Souza, R.M.1; Dolinski,C.1 1Universidade Estadual do Norte Fluminense Darcy Ribeiro/CCTA/LEF, 28015-620 Campos dos Goytacazes, RJ,Brazil. Email: [email protected]

Estudos recentes têm avaliado o uso de nematóidesentomopatogênicos e suas bactérias simbiontes para ocontrole biológico de nematóides fitoparasitas, havendoentretanto poucos estudos abordando as interações entreestes organismos. O objetivo desse trabalho foi investigaro efeito de juvenis infectantes (JIs) de H. baujardi na eclosãode J2 de M. mayaguensis. Vinte e cinco ovos de M. mayaguensiscom J2 formados e móveis foram equitativamente colocadosem cinco lâminas de vidro com uma cavidade centralpreenchida com água destilada. A seguir, em cada cavidadeforam colocados também 10 JIs de H. baujardi. Cincolâminas com J2 mas sem a adição de H. baujardi serviramcomo testemunha. As lâminas foram mantidas em BOD a25ºC até a eclosão de todos os J2. Avaliou-se a eclosão

acumulada dos J2 em função do tempo (às 24, 48, 72, 96,120, 144 e 168 horas após) dos dois tratamentos. Esteexperimento foi realizado duas vezes, para confirmação dosdados. A presença de H. baujardi retardou a eclosão dos J2

de M. mayaguensis, a julgar pela menor eclosão acumuladaaté às 144 horas, em comparação com a testemunha. Às168 horas entretanto, a eclosão foi similar para ambos ostratamentos (96 e 100%, respectivamente). Possivelmente,o retardo na eclosão dos J2 de M. mayaguensis deveu-se àação de metabólitos de Photorhabdus sp. liberada na águapor H. baujardi nas primeiras horas do experimento, eacredita-se que a redução da concentração de bactérias naágua tenha então permitido a eclosão dos J2 ao final doexperimento.

231 – BIOLOGICAL CONTROL OF Meloidogyne mayaguensis ON GUAVA WITH NEMATOPHAGOUSFUNGI [CONTROLE BIOLÓGICO DE Meloidogyne mayaguensis EM GOIABA COM FUNGOS NEMATÓFAGOS]Martins, I.1; Carneiro, R.M.D.G.1; Souza, J.F.1; Silva, K.F.A.S.1; Hidalgo-Díaz, L.2; Tigano, M.S.1 1Embrapa Recursos Genéticose Biotecnologia, C. P. 02372, 70849-949 Brasília, DF, Brazil; 2Centro Nacional de Sanidad Agropecuaria, San José de lasLajas, Apartado 10, C.P. 32700, La Habana, Cuba. E-mail: [email protected]

The root–knot nematode Meloidogyne mayaguensis Rammah& Hirschmann is a recognized limiting factor in commercialguava production in Brazil because it economically affectsguava crops (Psidium guajava L.). Egg-pathogenic fungi areconsidered potential biological control agents of root-knotnematodes. Greenhouse experiments were conducted inorder to evaluate the effect of the fungi Paecilomyces lilacinus(Thom) Samson and Pochonia chlamydosporia (Goddard) ZareW. Gams on M. mayaguensis population on guava plants.Guava seedlings of about 15-20cm in height growing inplastic bags were inoculated with 10,000 eggs/plant of M.

mayaguensis. Two months later, three isolates of P. lilacinusand one isolate of P. chlamydosporia were inoculated in theinfested plants. The effect of the treatments was evaluatedsix months later. Although the nematode plant infectionwas not attenuated, because the gall index was high for alltreatments, the number of eggs/g of roots was significantlyreduced. The number of egg masses infected with thefungus was inversely correlated with the number of eggsfound in the roots. The most effective result (61.5% ofcontrol) was obtained with the isolate of P. chlamydosporia(CG1003), which was originally obtained from eggs of M.

398 Vol. 33(4) - 2009


mayaguensis in Brazil, followed by P. lilacinus (CG177 andCG1038) with about 40% of control. These fungi showed theability to colonize guava roots in greenhouse experiments.

These results suggest that P. chlamydosporia can be selected as apotential biological control agent to be employed integratedwith other strategies to control M. mayaguensis on guava.

232 – THE RELEASE OF THE SYMBIOTIC BACTERIUM Photorhabdus luminescens BY Heterorhabditisbaujardi LPP7 IS EQUALLY STIMULATED BY Meloidogyne mayaguensis J2, INSECT LARVAE ANDTOMATO ROOTS [AVALIAÇÃO DA LIBERAÇÃO DA BACTÉRIA Photorhabdus luminescens DO NEMATÓIDEHeterorhabditis baujardi LPP7 NA PRESENÇA DO NEMATÓIDE FITOPARASITA Meloidogyne mayaguensis E DE OUTROSESTÍMULOS] Ferreira, T.F.1, Souza, R.M.1; Dolinski, C.M.1 1Universidade Estadual do Norte Fluminense Darcy Ribeiro/CCTA/LEF, 28015-620 Campos dos Goytacazes, RJ, Brazil. Email: [email protected]

Entomopathogenic nematodes of the genus Heterorhabditishave been used on a broad scale by man in agriculture dueto their effectiveness in controlling soil pests. Thesenematodes carry in their intestines bacteria from the genusPhotorhabdus that causes the insect’s fast death. However,the cues perceived by the nematode which lead to bacterialrelease are not known. This work evaluated different juvenile(J2) concentrations of Meloidogyne mayaguensis, testing if therewould be liberation of P. luminescens in the soil, and evaluatedother stimuli for bacteria liberation, such as Galleria mellonella

(Pyralidae: Lepidoptera) larva and tomato root explants(Lycopersicum sculentum). In the test with differentconcentrations of M. mayaguensis (100, 200, 300 and 400eggs), in all treatments the bacteria was recovered, but notin the plates where only sterile water was added. As for thedifferent stimulus (G. mellonella larva and tomato plants),both were positive for bacteria regurgitation. We concludedthat insect larva, J2 and plants can serve as stimuli, withCo2 being a possibly common element among those stimulifor bacteria regurgitation.

233 – BACTERIAL METABOLITES ACTIVE AGAINST THE ROOT-KNOT NEMATODE Meloidogyneexigua [METABÓLITOS BACTERIANOS ATIVOS CONTRA O NEMATÓIDE DE GALHAS Meloidogyne exigua]Santos Júnior, H.M.1; Nunes, A.S.1; Oliveira, D.F.1; Campos, V.P.2; Silva, R.C.1 1Universidade Federal de Lavras, Departamentode Química, C. P. 3037, 37200-000 Lavras, MG, Brazil. 2Universidade Federal de Lavras, Departamento de Fitopatologia,C. P. 3037, 37200-000 Lavras, MG, Brazil. E-mail: [email protected]

Meloidogyne exigua is widely distributed throughout Braziliancoffee plantations, causing considerable losses to farmers.Since the use of bacteria that produce nematicidalmetabolites is considered a promising tool to control thisnematode, the present work aimed to isolate and identifymetabolites with nematicidal properties from bacterialsources. Initially, metabolites produced by severalendophytic bacteria in liquid medium were tested for invitro activity against M. exigua second stage juveniles (J2).The highest values of dead J2 were obtained for Acinetobacterjohnsonii and Staphylococcus aureus, isolated from tomato andpepper plants, respectively. Consequently, the metabolitesproduced by such bacteria were separated from bacterial

cells, freeze-dried and extracted with dichloromethane toafford amino acid-free metabolites, which underwentfractionation by column chromatography and highperformance liquid chromatography. Through nuclearmagnetic resonance and mass spectrometry, the isolatedsubstances were identified as uracil, 9H-purine anddihydrouracil. All structures were active against J2,dihydrouracil being the most efficient. This substancepresented LC50 of 204µg/mL against the nematode, whilea LC50 of 30µg/mL was observed for the commercialnematicide aldicarb. Further studies should be carried outto evaluate the potential of A. johnsonii, S. aureus and theirmetabolites to control M. exigua in coffee plants.

234 – ESTUDO IN VITRO DA COLONIZAÇÃO DE OVOS E DA AGRESSIVIDADE A JUVENIS DESEGUNDO ESTÁDIO DE Meloidogyne mayaguensis POR ALGUNS FUNGOS NEMATÓFAGOS [IN VITROSTUDY OF THE COLONAIZATION OF EGGS AND AGGRESSIVENESS OF SECOND STAGE JUVENILESOF Meloidogyne mayaguensis BY SOME NEMATOPHAGOUS FUNGI] Becaro, C.K.¹; Soares, P.L.M.²; Franco, D.³; Santos,J.M.² ¹UNESP/FCAV, Jaboticabal; ²UNESP/FCAV Jaboticabal; ³ Farm Consultor/GTACC. E-mail: [email protected]

Os fungos nematófagos estão entre os principais agentesdo controle biológico de nematoides. As restrições ao uso

de nematicidas cada vez mais rigorosas, em função dapericulosidade dessas moléculas, têm motivado a busca por



399

soluções alternativas. O controle biológico tem despertadointeresse crescente, em função dos resultados promissoresobtidos por pesquisadores de diferentes regiões do mundoe por se tratar de uma prática que não agride o ambiente.Este estudo foi conduzido com o objetivo de avaliar acolonização de ovos de Meloidogyne mayaguensis pelos fungosPochonia clamydosporia, isolados Jab1 e Jab2, Paecilomyceslilacinus, isolados Jab1, Jab-BA1 e Jab-GO1, assim como acapacidade predatória de juvenis de segundo estádio dessenematoide pelos fungos Arthrobotrys musiformis, Arthrobotryssp., Dactylella leptospora e Monacrosporium elegans. O estudo foiconduzido no Laboratório de Nematologia doDepartamento de Fitossanidade da UNESP/FCAV,Câmpus de Jaboticabal. Quatro discos de micélio de 5 mmde diâmetro de culturas de cada fungo, em BDA, foramtransferidos para placas de Petri contendo ágar-água 2%,depositados no centro das placas, eqüidistantes entre si. Asculturas foram mantidas em B.O.D. a 25 ±1°C, no escuro,até a completa colonização da superfície do meio. A seguir,adicionram-se 0,5 mL de suspensão aquosa de ovos de M.mayaguensis, contendo 150 unidades, ou 200 juvenis desegundo estádio do nematoide por placa, com cincorepetições. As avaliações da percentagem de ovos

colonizados foram feitas as 24 e 48 h após adição desses àsculturas dos fungos, enquanto as avaliações da predaçãode juvenis foram efetuadas as 24, 48, 72 e 96 horas, após aadição da suspensão às culturas. As médias de ovoscolonizados por Pochonia clamydosporia Jab1 foram de 39,47e 96,27% em cada avaliação, respectivamente, enquanto oisolado Jab2 desse fungo colonizou 43,1 e 93,8% dos ovosnas respectivas avaliações. Paecilomyces lilacinus Jab1 colonizou39,5 e 96,3%, enquanto os isolados Jab-BA1 e Jab-GO1colonizaram, respectivamente, 29,2 e 97,3% e 56,5 e 100%dos ovos nos respectivos períodos aval iados. Apercentagem de predação de juvenis de segundo estádiodo nematoide por Artrobotrys musiformis foi de 10,9; 40,4;77,30 e 100% nas respectivas avaliações. Artrobotrys sp.predou 0,0; 1,2; 43,9 e 45,7% dos juvenis, Dactylellaleptospora predou 0,3; 16,8; 95,5 e 96,7%, enquantoMonacrosporium elegans predou 0,3; 10,0; 95,9 e 96,4%,respectivamente. Entre os fungos parasitos de ovos deM. mayaguensis testados, os dados sugerem que o isoladoJab-GO1 de P. lilacinus é o mais promissor, enquantoentre os predadores de juvenis de segundo estádio donematoide, os isolados de A. musiformis, D. leptospora eM. elegans são os mais agressivos.

235 – RHIZOBACTERIA ASSOCIATED WITH Vitis vinifera ROOT SYSTEMS AND THEIR EFFECTS ONTHE PARASITISM CAUSED BY Xiphinema index [RIZOBACTERIAS ASSOCIADA A SISTEMASRADICULARES IN Vitis vinifera E SEUS EFEITOS SOBRE O PARASITISMO CAUSADO POR Xiphinema index]Aballay, E.1; Persson, P.2; Mårtensson, A.2 1Crop Protection Department, Universidad de Chile. P.O. Box 1004, Santiago,Chile; 2Swedish University of Agricultural Sciences, Dept. of Crop Production Ecology, Box 7043, SE- 750 07 Uppsala,Sweden. E-mail: [email protected]

A survey of different soils was performed to determinethe presence of rhizobacteria associated with root systemof grapevine grown on their own rootstock and with a lowdensity of plant parasitic nematodes (PPN). During spring/summer of 2006, soil samples were taken with a shoveland small roots and soil were separated to identify and countPPN species and also to choose roots from plants with alow number of Xiphinema index, the main root pest ofcultivated vineyards in Chile. Rhizobacteria were isolatedfrom roots of four different soils using TSBA and identifiedusing fatty acid extraction and analysis (FAMEs). 48 strainsfrom more than 400 isolates were finally selected for studiesto determine their antagonistic action against X. index.Selected isolates were assayed in experiments bacterizingroots of two-month-old plants, obtained by cuttingThompson Seedless variety and growing in a steamed substratecomposed of sand, loamy soil and vegetal soil in the sameproportions. Root systems were soaked in a bacterialsuspension of c,a. 106-107 c.f.u./ml and a 100 ml suspensionwas also inoculated into the three liter pots with the new plants.

Fourteen days later, 2000 specimens of X.index per pot wereinoculated. Reliable controls for inoculation were ensured.Plants were kept under controlled conditions, with 2 irrigationsper week, pest control and no fertilization. After 5 monthsgrowth, nematode population was evaluated together with rootdamage and plant growth parameters. It was expected that thenatural phenomenon of suppressiveness would be reproducedin greenhouse conditions. Results obtained, based on thenumber of roots showing symptoms of parasitism, point outthat strains of Pseudomonas chlororaphis, Bacillus mycoides GCsubgroup A, Micrococcus luteus GC subgroup B, Pantoea aglomeranswere able to keep roots with a very low parasitism, less than 5new roots per root system, while Pseudomonas corrugata,Pseudomonas fluorescens biotype F, Pseudomonas putida biotype Band Bacillus megaterium show more than 150 small rootsparasitized. Data are still under process and analysis, but thispreliminary evaluation shows that rhizobacteria associated withgrapevine plants, with scarce presence of the ectoparasitenematode X. index, may have some influence on rootsprotection.

400 Vol. 33(4) - 2009


236 – SCREENING OF POTENTIAL BIOLOGICAL CONTROL AGENTS WITH NEMATICIDE ACTION[SELEÇÃO DE AGENTES DE CONTROLE BIOLÓGICO POTENCIAL COM AÇÃO NEMATICIDA] Ornat, C.1;Alcalà, S.1; Lara, J.M.2; Sarro, A.2; Sorribas, F.J.1; Fernández, C.2 1DEAB-UPC; 2FUTURECO BIOSCIENCE S.L.; 1,2ParcMediterrani de la Tecnologia, c/ Esteve Terrades 8, Castelldefels 08860, Spain. E-mail: [email protected]

Soil micro-organisms with nematicidal activity are commonin nematode infested soils. These Biological Control Agents(BCAs) share metabolic pathways and physiological traits,which can be used as selective tools to separate them fromthe whole soil microbial population. A survey wasconducted in some agricultural areas in Spain infested withplant parasitic nematodes to determine the presence ofpotential BCAs and their effectiveness on Meloidogyne eggshatching in in vitro bioassays. In a first stage, soil and plantmaterial was collected from agricultural fields at differentlocations in Spain. The samples were subjected to a standardextraction process that led to the identification of 12 speciesof plant parasitic nematodes. Then, serial dilutions of soilsamples and aqueous suspensions from extraction fractions

containing eggs or juveniles of Meloidogyne sp. and Globoderasp. were plated on Petri dishes with different media. A totalof 328 micro-organisms were isolated. In a second stage, theisolates were inoculated on specific culture media (chitinolyticand proteolytic). Following incubation, 109 isolates wereselected as potential BCAs. From these, 14 bacteria and 13fungi were assessed for their ability to inhibit the hatching ofMeloidogyne incognita eggs in vitro conditions. The egg masseswere exposed to isolates of the selected BCAs in aqueoussuspensions and hatching was measured after 1, 2, 7, 14, 21and 28 days. Ten out of 27 isolates tested inhibited hatchingof Meloidogyne eggs by more than 75%. In an early stage ofresearch, the 10 selected strains are promising candidates forthe further development of bionematicides.

237 – FUNGI ASSOCIATED WITH POTATO CYST NEMATODE EGGS IN PORTUGAL [FUNGOSASSOCIADOS A OVOS DE NEMÁTODES DE QUISTO DA BATATEIRA] Santos, M.C.V.1; Esteves, I.1; Mesquita,N.2; Portugal, A.2; Kerry, B.3; Abrantes, I.1 1IMAR-CMA, Departamento de Zoologia, Faculdade de Ciências e Tecnologia,Universidade de Coimbra, 3004-517 Coimbra, Portugal; 2Centre for Functional Ecology, Departamento de Botânica,Universidade de Coimbra, 3001-455 Coimbra, Portugal; 3Nematode Interactions Unit, Plant Pathology and MicrobiologyDepartment, Rothamsted Research, Harpenden, AL5 2JQ, U.K. E-mail: [email protected]

Potato cyst nematodes (PCN), Globodera pallida and G.rostochiensis, are among the most economically importantnematodes in agriculture and can cause significant losseson potato (Solanum tuberosum L.). There is an increasingdemand for alternative, non chemical, sustainable strategiesfor nematode control. Biological control may have animportant role and fungal antagonists such as Pochoniachlamydosporia are among the most studied biological controlagents. In this study, the occurrence of P. chlamydosporia andother egg parasitic fungi associated with PCN eggs wasinvestigated. Cysts extracted from 46 soil samples collectedin potato fields in the major regions for potato productionin Portugal (Aveiro, Beja, Coimbra, Guarda, Madeira,Setúbal and Vila Real) were disrupted mechanically and theeggs were plated onto 0.8% water agar with antibiotics. Thepercentage of egg parasitism was estimated after 3 days at20 ºC. Fungi growing out of eggs were isolated and

identified using morphological and molecular techniques.The percentage of infected eggs/cyst varied from 0 to 51%.The numbers of full eggs/cyst ranged from 1 to 164.Chemical control strategies which are still routinely used inPortugal may explain the low numbers of full eggs/cystfound. Pochonia chlamydosporia was detected only in threePCN populations collected in Aveiro, Guarda and Setúbal.Other fungi belonging to the genera Bjerkendera, Chaetomium,Fusarium, Mortierella, Paecilomyces and Penicillium were foundassociated with eggs in 48% of the PCN populations.Chaetomium was the predominant genus detected in 25%of the fungi isolated. Molecular characterization of theP. chlamydosporia isolates showed that those from Aveiro andSetúbal shared a similar ERIC-PCR profile, whereas theisolate from Guarda had a different profile. Further studiesare being carried to investigate the biocontrol potential ofthese P. chlamydosporia isolates against Globodera spp.



401

Section 7 - Nematode management

238 – A COMPARISON OF CULTURAL, PHYSICAL AND CHEMICAL METHODS FOR CONTROL OFMeloidogyne spp. ON CARNATION IN SOUTHWESTERN SPAIN [COMPARAÇÃO DE MÉTODOSCULTURAIS, FÍSICOS E QUÍMICOS PARA O CONTROLE DE Meloidogyne spp. EM CRAVO NO SUL DA ESPANHA]Vela M.D.1; Macias F.J.1; Prados A.M.2; Melero J.M.3; López C.3; Basallote M.J.4; Talavera M.5 1IFAPA Centro de Chipiona;2IFAPA Centro Alameda del Obispo; 3Instituto de Agricultura Sostenible, CSIC; 4IFAPA Centro Las Torres, Tomejil.5IFAPA Centro Camino de Purchil. E-mail: [email protected]

The aim of this work was to evaluate several alternatives tothe use of methyl bromide for root-knot nematode control(Meloidogyne spp.) in carnation crops in Southwestern Spain.Microplot experiments were carried out during threeconsecutive cycles in an experimental protected greenhouseat IFAPA Centro de Chipiona, Cádiz, Spain. The use ofresistant (cv. Master) or susceptible (cv. Picaro) carnationcultivars combined with different chemical treatmentsincluding chloropicrin, 1-3 dichloropropen, dimethyl-disulphide, furfural or propylene oxide and physicaltreatments, such as soil solarization, chicken manureamendment or steam soil disinfestation were tested in field.Treatments were applied to soil in 24 m2 microplotsdistributed under a randomized block design in a protectedplastic greenhouse infested naturally by Meloidogyne arenaria+ M. incognita (Pi: 31-190 J2 per 100 cm3 of soil). For the

resistant cultivar cv. Master no symptoms were observedand nematode densities were reduced down to 5 juvenilesper 100 cm3 of soil in all treatments after 9 months ofcropping. For the susceptible cultivar cv. Picaro, treatmentswith 1-3 dichlropropen or dimethyl disulphide reducednematode densities in soil by 81%-98% and severity (gallindex) and incidence (plants with symptoms in roots)of the disease by 75-87%, giving commercial yieldssimilar to those of methyl bromide soil fumigation. Soilsolarization treatments were more effective in reducingnematode densit ies and increasing commercialproduction of cut flowers when combined with chickenmanure, reaching reductions in nematode densities ofabout 61-80% and maintaining the commercialproduction similar to that of fumigation with methylbromide.

239 – EFFECT OF NEEM SEED AND KERNEL EXTRACTS ON INDIVIDUALS OF Cephalobus persegnis[EFEITO DE SEMENTES DE NEEM E EXTRATOS DE KERNEL EM INDIVÍDUOS DE Cephalobus persegnis]Ardakani, A.S.1; Gaur, H.S.2; Kamara, A.2 1Agricultural and natural resources research center of Kohgyloyeh va Boyreahmadprovince (Iran) 2Division of Nematology, IARI, New Delhi, 110012, India. Email: [email protected]

Active individuals of C. persegnis were treated in vitro withaqueous extracts of neem seed kernel (NSKE) and neemseed (NSE) at 0 (control), 1, 2 and 4% w/v for 24 and 48 hto observe immobility and mortality, if any. At aconcentration of 1%, the NSKE caused immobility of19.9% of the C. persegnis exposed for 24 h which increasedto 21.3% by 48 h. Some immobile nematodes werereactivated when transferred to water, hence the mortalitycaused due to 24 and 48 h exposure was 16.3 and 19.6%,respectively. At lower dilution of 2%, the NSKE resultedin significantly lesser immobility of 33.1% at 24 h whichincreased to 36.1% at 48 h causing percentage mortality of26.3 in 24 h and 24.8% at 48 h, with a revival of 37.7 and

75.2% after 24 h and 48 h exposure, respectively. NSKE at4% caused an immobility of 52.7 at 24 h which increasedto 57.5% at 48 h. The revival in mobility on placing themin water for 24 h was about 56%, in individuals treated for24 h resulting in mortality of 44.1%. The revival inindividuals kept in NSKE for 48 h was 52.3% resulting in amortality of 47.7%. Thus, the different dosages of NSKEshowed significant differences in percentage immobility andmortality caused in C. persegnis. The NSE at 4% caused aninsignificant immobility of 3.9% at 24 h and 3.6 per cent at48 h. All these individuals when placed in distilled waterrevived within 24 h. No effect on mobility was observed inindividuals at lower dilutions of 2% or 1%.

402 Vol. 33(4) - 2009


240 – EFFECT OF MANIPUEIRA, LIQUID WASTE PRODUCED BY THE CASSAVA INDUSTRY, ONTHE CONTROL OF Meloidogyne incognita ON TOMATO CROP CULTIVATE IN THE SUMMER SEASON[EFEITO DE MANIPUEIRA, RESÍDUO LÍQUIDO PRODUZIDO PELA INDÚSTRIA DA MANDIOCA, NOCONTROLE DE Meloidogyne incognita EM TOMATEIRO CULTIVADO NO VERÃO] Nasu, E.G.C.1; Formentini, H.M.2;Cruz, M.I.F.2; Furlanetto, C.3 1Universidade Federal de Viçosa, Departamento de Fitopatologia, UFV, Viçosa, MG, Brazil;2Universidade Estadual do Oeste do Paraná, Centro de Ciências Agrárias, 85.960-000 Marechal Cândido Rondon, PR,Brazil; 3Universidade de Brasília, Departamento de Fitopatologia, 70.910-900 Brasília, DF, Brazil. E-mail:[email protected]

Meloidogyne incognita is an important parasite of tomato cropin Western Paraná, Brazil. The strategies currently adoptedon the control of this nematode emphasize the search foralternative methods, especially those that contribute toenvironmental preservation. The liquid waste produced bythe cassava industry, during processing of cassava roots, isknown as ‘manipueira’. This residue presents high amountsof cyanogenic glycosides, which are hydrolized to yieldcyanide, a potent nematicide. Manipueira is also a greatsource of nutrients to plants. As this residue is found inlarge amounts in Western Paraná, where more than 15cassava industries are based, this work aimed to study theeffect of manipueira on Meloidogyne incognita in fieldconditions. The field experiment was carried out in acompletely randomized design with 4 treatments(manipueira diluted in water at 10%, 25% and 50% and thecontrol water) and 4 replications. The plots were installedin a field infested with M. incognita. The tomato crop cv.

‘Rio Grande’ was cultivated in the plots. The manipueiratreatments were soil-applied on the plant base three timesduring the crop cycle (4 L/plant/application). Before eachapplication, the cyanide content (CN-) of each manipueirasample was determined using the Microquant kit (Merck).The variables studied were number of galls and eggs perroot system, number of J2/100 cc of soil, fresh and dryweight of shoot and weight of fruits. Around 40 mg.L-1 ofCN- was detected in manipueira 100% for the manipueirasamples applied. All the manipueira treatments were higherthan the control water for most of the variables studied.Also, there were no statistical differences among themanipueira treatments for all the variables analyzed. Tomatoplants treated with manipueira 10 or 25% showed the lowestReproduction Factor (RF) for M. incognita, whereas tomatoplants treated with manipueira 50% had a betterdevelopment of their shoots, roots and fruits. Supportedby: FAPEMIG/CNPq/CAPES.

241 – EFFICACY OF PLANT CRUDE EXTRACTS AS VARIOUS PLANT ORGANS USED ASBIONEMATICIDES ON A NEMATODE POPULATION SUPPRESSION UNDER GLASSHOUSE,MICROPLOT AND FIELD CONDITIONS [EFICÁCIA DE EXTRATOS CRUS DE PLANTAS OBTIDOS APARTIR DE VÁRIOS ORGÃOS, USADOS COMO BIONEMATICIDAS NA SUPRESSÃO DE POPULAÇÕES DONEMATÓIDE, EM CASA DE VEGETAÇÃO, MICROPARCELAS E CONDIÇÕES DE CAMPO] Kkhosa , M.C.1;Daneel, M.1; Mc Donald, A.H.2; Waele, D.3 1ARC-Institute of Tropical and Subtropical Crops, Private Bag X11208,Nelspruit 1200, South Africa; 2ARC-Grain Crop Institute, Private Bag X1251, Potchefstroom 2520, South Africa; 3Laboratoryfor Tropical Crop Improvement; Catholic University of Leuven, Kasteelpark Arenberg 13, 3001, Heverlee, Belgium

Cissus cactiformis, Tabernaemontana elongens, Maerua angolensis,Synadenium cupulare, Euphobia ingens and Cucumis myriocarpusare indigenous plants with known toxic properties. Theyare widely distributed in the Mopani and Vembe Ddistrictsof Limpopo Province. Powdered products of these toxicplant organs were tested for their effeicacytiveness incontrolling Meloidogyne incognita race 2 on tomato uinder amicroplot and field experiments at Joppie and ARC-ITSC,respectively.s A randomized complete trial layout was usedwith eleven treatments at Joppie and seventeen treatmentsat ARC-ITSC and untreated control, replicated 6 times.Each Pplants wasere inoculated with ca. 3000 M. incognitarace -2 eggs and , juveniles, followed three days later with

planting of the tomato seedling (L. esculentum L. var.Floradate) and the same day the treatment was appliedaround the base of the plantplant. Due to Trials wereResultsin the microplot and field experiments at both localitiesshowed that two plant species could be identified as beingan effective bionematicide, namely T. elongens and Maeruaangolensis. These treatments reduced nematode larva juvenileand egg numbers/ 1 g roots statisticalignificantly andenhancstimulated plant growth. The treatments have aneffect on leaf nutrients elements and enhance the fertilityof the plant crop. This compared well with the C.cactiformis and in E. ingens Nemacur (femaniphos)treatment. Results indicated that various toxic plant



403

organs could have potential as bionematicides for M.incognita race 2 in tomato production, however moreresearch is needed. In addition to the observed

nematicidal effects of these indigenous plant products,the variable effects on eggs and juveniles warrant furtherin-depth investigation.

242 – Meloidogyne exigua POPULATION IN COFFEE PLANTS INTERCROPPED WITH LEGUMINOUSALLEYS [POPULAÇÃO DE Meloidogyne exigua EM CAFEEIROS CONSORCIADOS COM ALÉIAS DELEGUMINOSAS] Salgado, S.M.L.2; Cunha, R.L.2; Alvarenga, M.I.N.3 1Apoio financeiro da Fapemig; 2Empresa de PesquisaAgropecuária de Minas Gerais, C. P. 176, 37200-000 Lavras, MG, Brazil; 3Universidade Federal de Itajubá, C.P. 50, 37500-903 Itajubá, MG, Brazil. E-mail: [email protected]

Meloidogyne exigua is commonly found as a parasite on coffeeroot systems in Latin America. The temperature increasefrom global warming can intensify the damage on affectedplants. For this reason, intercropped alleys with coffeeplants can promote coffee development and production aswell as contribute to fertilization when the intercrop ispruned. The objective of this research is to evaluate thebiomass of pigeon pea (Cajanus cajan), bracatinga (Mimosascabrella), leucaena (Leucoena leucocephala) and acacia (Acaciamangium) plants in relation to nutritional aspects of biomassand influence of M. exigua population. The leguminousplants in strips 5 meters wide, parallel to coffee rows, weremanaged to stimulate biomass production. Sampling andpopulation evaluation of M.exigua was done in the dry

season, four months after pruning and distributing the cutbiomass over soil surface among coffee plants. Thechemical composition of dry matter from acacia plantspresented the largest quantities (gKg-1) of Nitrogen,Phosphorus and Potassium. M. exigua population on coffeeroots was the same (P≤0.05) on all treatments compared tonon intercropped plants. Soil samples collected from areastreated with acacia biomass presented the largest (P≤0.05)population of M. exigua second stage juveniles (J2). Thissuggested that the maintenance of soil moisture in the dryseason by acacia biomass as well as the higher nutrient levelsfound contributing to root growth, especially new roots,promoted the increase in the population of J2 M. exigua insoil treated with such a biomass.

243 – ALTERNATIVE CONTROL OF Meloidogyne paranaensis ON COFFEE PLANTS TREATED WITHMANIPUEIRA [CONTROLE ALTERNATIVO DE Meloidogyne paranaensis EM PLANTAS DE CAFÉ TRATADASCOM MANIPUEIRA] Estevez, R.L.1; Furlanetto, C.2; Casagrande, C.Jr.1; Chambo, A.P.S.1; Cruz, M.I.F.1; Formentini,H.M.1 1UNIOESTE, C. P. 91, 85.960-000, Marechal Cândido Rondon, PR, Brazil; 2Universidade de Brasília, Departamentode Fitopatologia, 70.910-900. E-mail: [email protected]

Manipueira is a liquid waste produced during processingof cassava roots and also a potent nematicide and a goodsource of nutrients to plants. Regarding the abundance ofthis residue in Paraná State, this work aimed at studyingthe effect of manipueira at different concentrations on thecontrol of Meloidogyne paranaensis on coffee plants cv. ‘CatuaíVermelho’. The field experiment was carried out in acompletely randomized design with 6 treatments and 5replications. The treatments were water, as the positivecontrol, the nematicide Terbufos (Counter 50g - 17.5grams/plant), as the negative control, and dosages ofmanipueira at 10%, 25%, 50% and alternate applications at10% and 50%. Single coffee plants were considered as onereplication. The nematicide was applied once during thecoffee cycle while the manipueira treatments, soil-appliedon the plant basis, had a total of 8 applications. The variablesassessed were number of J2/100 cc of soil, yield of coffeeplants (grams), concentration of macro and micro nutrients

on leaves and analysis of the coffee drink group. Thecyanide amount (CN-) in manipueira was determined beforeeach application using the Microquant Kit (Merck).Around 40 mg.L-1 of CN- was detected in manipueira100%. The lowest values for the variable J2/100 cc ofsoil were found for the treatments alternate manipueira10% and 50% and manipueira 10%, which differedstatistically from the other treatments but not from eachother. For the variable yield, the manipueira treatmentsand the nematicide did not differ statistically from eachother but showed statistical differences from the controlwater. The yield (weight of grains/plant) obtained foreach treatment was: manipueira 10% and 50% - 4.5 Kg,nematicide - 2.8 Kg, manipueira 10% - 2.2 Kg,manipueira 50% - 2 Kg and control water - 0.5 Kg. Nostatistical differences were observed among treatmentsfor the other variables studied. Research supported byCNPq.

404 Vol. 33(4) - 2009


244 – EFECTO DE LAS VINAZAS SOBRE LOS NEMATODOS DEL SUELO: Meloidogyne arenaria YXiphinema index [EFFECT OF VINASSES ON SOIL NEMATODES Meloidogyne arenaria and Xiphinema index] López-Pérez, J.A.1; Díez-Rojo, M.A.2; Arcos, S.C.2; González-López, M.R.2; García Romero, E.3; Martínez Gascueña, J.3; ChacónVozmediano, J.L.3; Bello Pérez, A.2 1Centro Agrário de Marchamalo, JCCM, Guadalajara; 2Centro de CienciasMedioambientales, CSIC, Madrid; 3Instituto de la Vid y del Vino de Castilla-La Mancha, IVICAM, Tomelloso, CiudadReal, España. E-mail: [email protected]

La retirada de los fumigantes del suelo para el control denematodos por su efecto nocivo para la salud y el ambiente,ha creado la necesidad de encontrar alternativas de manejoviables económicamente. En esta línea de investigación, seestá estudiando el efecto de ciertos subproductosagroindustriales para el manejo de organismosfitopatógenos, planteándose la necesidad de utilizarsubproductos de origen local para reducir costes detransporte, que constituye el principal factor limitante, altiempo que cerrar ciclos de materia en el cultivo. En el casode los viñedos de la zona mediterránea continental de laPenínsula Ibérica, se han elegido las vinazas de vino para elmanejo de nematodos fitoparásitos formadores de nódulos(Meloidogyne arenaria) y transmisores de virus (Xiphinemaindex). Se analizaron varias extracciones del subproductocon el fin de poder programar la fertilización del suelo,dada la variabilidad de su composición en cada campaña.Las vinazas resultaron efectivas en el manejo de M. arenaria

& X. index, mejorando además la fertilidad del suelo. Lareducción de poblaciones de fitoparásitos es de gran interésno sólo para los casos de replantación de viñedo por lapresencia de vectores de virus (X. index), sino también paraaquellos de reconversión a cultivos hortícolas o frutales porla presencia de nematodos formadores de nódulos (M.arenaria & M. incognita) que se pueden transformar enproblemas. Se plantean para el futuro estudiosencaminados a reducir dosis y optimizar los métodos deaplicación, con el fin de evitar gastos de transporte eincrementar su eficacia en el manejo de nematodosparásitos de plantas, sin afectar a las otras poblacionesde saprófagos, tanto rhadítidos como enquitreidos, asícomo doriláimidos y monónquidos de alto valorbioindicador. Se considera de gran interés incorporarestos subproductos en el diseño de sistemas deproducción, especialmente para el manejo de suelos deviñedo basados en criterios ecológicos.

245 – APLICAÇÃO DA TORTA DE MAMONA (Ricinus comunis) PARA O CONTROLE DE Meloidogyneincognita EM POMAR DE FIGO (Ficus carica) [APPLICATION OF CASTOR-OIL CAKE FOR Meloidogyne incognitaCONTROL IN FIG.] Salgado, S.M.L.2; Pereira, T.B.2; Oliveira, L.P.2; Carvalho, V.L.2 1Apoio Financeiro Prodesag/EPAMIG,FAPEMIG; 2Unidade Regional da Epamig do Sul de Minas, Caixa Postal 176, 37200-000 Lavras, MG, Brazil

O intenso parasitismo de Meloidogyne incognita em plantas defigo (Ficus carica) cv. Roxo de Valinhos em vários pomaresda região de São Sebastião do Paraíso, Minas Gerais, Brasil,tem causado o declínio de muitas plantas e sérios prejuízosaos produtores e à indústria local. O controle dessenematóide, por meio de medidas alternativas, é uma daspoucas opções disponíveis, uma vez que o uso de produtosnematicidas não é recomendado para essa cultura. A tortade mamona (Ricinus communis), subproduto da extração doóleo das sementes é conhecida por apresentar atividadenematicida, além de fornecer matéria orgânica e nutrientesao solo. Buscando controlar esse nematóide, foram feitas

seis aplicações trimestrais de torta de mamona, nas dosagensde 0; 500; 1000; 1500 e 2000 gramas por planta. Cadaaplicação da torta foi precedida da coleta de amostras desolo e raízes para quantificação da população nostratamentos e épocas. O experimento foi instalado emdelineamento de blocos ao acaso com 4 repetições de 5 plantaspor parcela. A população de Meloidogyne incognita nas raízes eno solo, ao final das seis épocas de aplicação, foi estatisticamenteigual em todos os tratamentos. Acredita-se que a ausência deefeito nematicida da torta de mamona seja devido às dosagens,talvez inadequadas, e à elevada população de M. incognita (173espécimes/g raiz) nas plantas do pomar.

246 – BIODIGESTED CABBAGE IN THE CONTROL OF Meloidogyne incognita [REPOLHO BIODIGERIDONO CONTROLE DE Meloidogyne incognita] Mattos, R.M.1; Cosmo, D.A.1; Dias-Arieira, C.R.1; Cunha, T.L.P.1; Chiamolera,F.M.1; Puerari, H.H.1; Sassaki, T.C.1 1Universidade Estadual de Maringá, Campus Regional de Umuarama, C.P. 65, 87501-970 Umuarama, Paraná, Brazil. E-mail: [email protected]

Cabbage has been shown to have an effect on the controlof root knot nematodes, whereas after harvest, the vegetable

remains of the plant are usually eliminated by the producer.Therefore, the aim of this work was to evaluate the effect



405

of biodigested cabbage on the control of Meloidogyneincognita. For this, 500 g of cabbage was mixed with twoliters of water in drums properly prepared to function as abiodigestor. After 60 days the material was removed forapplication. For this, previously germinated seedlings oftomato cv. Santa Cruz were transplanted to pots of 1 literand were inoculated with a suspension of 4000 eggs +juveniles of the nematode. One day after inoculation, thesoil was treated with 40 ml of the following treatments:concentrated suspension of biodigested material,biodigested material diluted in water in the proportion 1:1,1:2 and 1:3. The control were 40 ml water and 40 grams of

cut cabbage incorporated in the soil. After 60 days ofcultivation, the plants were collected to for evaluate freshand dry weight of shoots, fresh weight of roots, and numberof nematode galls and eggs. The experiment was conductedin completely randomized design with five repetitions and themeans obtained were compared by Duncan test 5%. Freshand dry weight of shoot and root fresh weight were significantlyincreased when using the treatment with cut cabbage. Lowernumber of juveniles was obtained for treatment withbiodigested concentrate (8,510), compared with treatment withwater (18,369) and diluted at 1:3 (17,694). There was nostatistical difference in the number of eggs.

247 – EFEITO DE QL 35 NA REPRODUÇÃO DE Meloidogyne incognita EM CENOURA [EFFECT OF QL35 ON THE REPRODUCTION OF Meloidogyne incognita ON CARROTS] Lourenço, O.1; Bessi, R.1; Inomoto, M.M.11Escola Superior de Agricultura “Luiz de Queiroz”, Universidade de São Paulo, 13418-900 Piracicaba, SP, Brazil. E-mail:[email protected]

Atualmente, são escassos e pouco efetivos os métodoscontrole de nematóides em cenoura (Daucus carota). O QL35 é um extrato obtido de uma planta nativa do Chile e éutilizado comercialmente como nematicida de origemnatural, embora seu modo de ação não seja conhecido. Opresente trabalho teve como objetivo avaliar o efeito doproduto na reprodução de Meloidogyne incognita em raízes decenoura cultivar Brasília. Utilizaram-se vasos plásticos com1.700 cm³ de capacidade, contendo 1.600 cm³ de substratomédio-arenoso desinfestado por calor úmido, sob condiçõesde casa de vegetação. O substrato foi infestado na proporçãode 5.000 indivíduos (ovos + juvenis de segundo estádio)por vaso. Após cinco dias, foram distribuídas vinte sementesem sulco circular acompanhando o perímetro do vaso e foifeita a aplicação dos tratamentos: (1) testemunha semproduto e sem nematóide; (2) testemunha sem produto e

com nematóide; (3) QL 35, 15 litros/ha, dosagem divididaem 3x (plantio, 15 e 30 dias após germinação); (4) QL 35,30 litros/ha, dosagem dividida em 3x; (5) carbofurano –60 kg p.c. Furadan 50G/ha dosagem única. Foram feitosdois desbastes, aos vinte e cinco e aos quarenta e cincodias após a germinação, deixando-se duas plantas porvaso. O experimento foi conduzido em delineamentointeiramente ao acaso, com cinco tratamentos e seisrepetições. A avaliação foi efetuada mediante extração econtagem dos nematóides aos 100 dias após agerminação. Os tratamentos apresentaram populaçõesfinais (soma das densidades nas radicelas e na raizprincipal) de 0 (tratamento 1), 79.404 (2), 2.341 (3), 4.736(4) e 96 (5). Portanto, os tratamentos mais efetivos sobrea reprodução de M. inconita foram 5 (carbofurano) e 3(QL 35, 15 litros/ha).

248 – UTILIZACIÓN DE VINAZAS DE REMOLACHA EN BIOSOLARIZACIÓN DEL SUELO PARA ELCONTROL DE Meloidogyne EN CULTIVOS DE PIMIENTO [UTILIZATION OF BEET VINASSE IN SOILBIOSOLARIZATION TO CONTROL Meloidogyne IN CHILI CULTIVATION] Lacasa, C.M.1; Diez-Rojo, M.A.2; Ros,C.1; Guerrero, M.M.1; Fernández, P.3; Martínez V.1; Lacasa A.1; A. Bello A.2 1Biotecnología y Protección de Cultivos,IMIDA, C/Mayor s/n 30150, La Alberca Murcia, España; 2Agroecología, Centro de Ciencias Mediambientales, CSIC, C/Serrano 115, 28006 Madrid, España; 3CIFEA Jumilla, Murcia. E-mail: [email protected]

En los invernaderos de la Región de Murcia (Sureste deEspaña) el pimiento es un monocultivo desde hace más deveinte años. Hasta 2005 los suelos se desinfectaban todoslos años con bromuro de metilo para el control de lospatógenos (Phytophthora capsici y Meloidogyne incognita) y parapaliar los efectos de la fatiga del suelo. Desde 2006 lasuperficie desinfectada mediante biosolarización conestiércol de ovino aumentó de forma progresiva hasta unas

45 ha en 2008. La eficacia en el control de hongos mejoraal reiterar la desinfección tres años consecutivos,mostrándose aleatoria en el control del nematodo. Con elfin de mejorar el control de Meloidogyne se ensayan nuevasenmiendas orgánicas, tanto sólidas como líquidas. En uninvernadero experimental se evaluó la eficacia de la solarizacióncon vinaza de remolacha azucarera aplicada a 1,5 kg/m2 y a0,75 kg/m2 combinada con estiércol de ovino, en comparación

406 Vol. 33(4) - 2009


al bromuro de metilo, al suelo no desinfectado y a labiosolarización con estiércol de ovino, en un ensayo de bloquesal azar. Al asociar la vinaza al estiércol mejoró el control delnematodo (índice de nodulación (IN) = 0,7; % de plantasinfestadas (%PI) = 20,0) en relación al estiércol solo (IN =1,2; % PI = 35,0), siendo mejor que el del bromuro de metilo(IN = 2,8; % PI = 48,0) y el testigo no desinfectado (IN = 5,6;

% PI = 86,7). La producción de los tratamientos debiosolarización fue (12,3 a 13,8 kg/m2) similar a la del bromurode metilo (13,1 kg/m2) y muy superior a la del suelo nodesinfectado (11,2 kg/m2). Se discute la eficacia de la aplicaciónde la biosolarización con vinaza de remolacha en distintasfechas (verano y otoño) asociada a estiércol de ovino eninvernaderos comerciales.

249 – MANEJO AGROECOLÓGICO DE Meloidogyne EN CULTIVOS HORTÍCOLAS DE ALMERÍA,ESPAÑA [AGROECOLOGICAL MANAGEMENT OF Meloidogyne ON VEGETABLE CULTIVATION IN ALMERIA,SPAIN] Díez-Rojo, M.A.1; Torres-Nieto, J.M.2; López-Pérez, J.A.3 García-Dorado, V.1; Arcos, S. C.1; González-LópezM.R.1; Martínez, C.1; Robertson, L.1; Bello, A1. 1Dpto Agroecología, Centro de Ciencias Medioambientales, CSIC, Madrid,España; 2SAT Costa de Nijar, Almería, España; 3Centro Agrario de Marchamalo, JCCM, Guadalajara, España. E-mail:[email protected]

El trabajo se fundamenta en el manejo de nematodos delgénero Meloidogyne mediante alternativas no químicas. Paraello, se pretende recuperar las técnicas tradicionales deaplicación de materia orgánica en los enarenados de Almería,que podemos considerar están fundamentadas en las basescientíficas que regulan los procesos de biodesinfección desuelos. Se evalúa también el efecto de la utilización de losrestos del cultivo, así como el efecto de un fertilizanteorgánico de origen agroindustrial, las vinazas de remolacha.Se propone la biodesinfección combinada con otrasalternativas de manejo, entre ellas el empleo de variedadesresistentes, para lo que previamente se ha estudiado sucomportamiento en relación con distintos biotipos deMeloidogyne incognita & M. javanica. Las técnicas empleadasse han evaluado económicamente con el fin de optimizarla utilización de los diferentes factores productivos. Se hatratado de seleccionar aquellas alternativas que permitan

cerrar ciclos de nutrientes y estén basadas en la utilizaciónde recursos locales. Se observa que la eficacia de labiodesinfección depende fundamentalmente del métodode aplicación, estando los costes determinados por elmétodo empleado, que debe tratar de reducir dosis y gastosde transporte. Se comprobó la importancia del enarenadotradicional en el control de nematodos, encontrando quetambién modifica la distribución en profundidad del sistemaradicular de los cultivos, lo que es un factor limitante alrequerir un diseño de un sistema de manejo agronómicoadaptado a cada cultivo. La frecuente presencia en losenarenados de Almería de complejos de especies o biotiposde nematodos del género Meloidogyne, hace que para su controlsea necesario el diseño de un sistema de manejo agronómicobasado en el conocimiento de sus características agroecológicas,que tenga en cuenta la experiencia de los agricultores y lastécnicas tradicionales de cultivo.

250 – EFEITO DE DIFERENTES CONCENTRAÇÕES DE FARINHA DE CARNE E OSSO INCORPORADAAO SOLO SOBRE Meloidogyne mayaguensis, EM CASA-DE-VEGETAÇÃO [EFFECT OF DIFFERENTCONCENTRATIONS OF BONE-MEAL AND MEAT-MEAL INCORPORATED INTO THE SOIL ON Meloidogynemayaguensis, UNDER GREENHOUSE CONDITIONS] Gomes, V.M.1; Almeida, A.M.1; Souza, R.M.1; Corrêa, F.M.21Universidade Estadual do Norte Fluminense Darcy Ribeiro/CCTA/LEF. 28015-620, Campos dos Goytacazes, RJ, Brazil;2Universidade Federal de Lavras, Dept. Estatística e Experimentação Agropecuária, Lavras, MG, Brazil. E-mail:[email protected]

Dentre os principais problemas fitossanitários do cultivoda goiaba destaca-se o nematóide-das-galhas, M. mayaguensis,o qual causa acentuada queda de produção e redução davida útil do pomar. Até o momento, a incorporação dematéria orgânica ao solo tem se mostrado a melhoralternativa de convívio com este nematóide. Neste trabalho,avaliou-se o efeito de diferentes concentrações (de 1 a 5%v/v) de farinha de carne e osso (FCO) sobre o nematóidee sobre o desenvolvimento de mudas de goiabeira. Dois

mil J2 e ovos do nematóide foram homogeneamenteaplicados a areia lavada em vasos de 2L, para os quais mudasde goiabeira foram transplantadas. Trinta dias após a FCOfoi superficialmente incorporada à areia, nas concentraçõescitadas acima. O delineamento experimental adotado foiinteiramente casualizado, com seis repetições (uma muda/vaso) por tratamento. Plantas inoculadas que não receberama FCO serviram como testemunha. Cento e vinte dias apósa inoculação com o nematóide, dados relativos ao nematóide



407

e às mudas foram submetidos à análises de variância e deregressão. Observou-se uma correlação negativasignificativa (P<0,05) entre o aumento da concentração deFCO e o número de ovos + J2/g de raiz e o FR (Pf/Pi),bem como em relação às variáveis vegetativas (altura dasplantas, massa fresca da parte aérea e da raiz e volumeradicular). Os melhores resultados relativos ao controle do

nematóide e ao desenvolvimento das mudas foram obtidoscom a concentração de 3% v/v. Resultados anteriores (nãopublicados) sugerem que o efeito nematicida da FCO deve-se à liberação de amônia no solo durante o processo dedegradação microbiana. Ensaios a campo estão sendodesenvolvidos para se avaliar a viabilidade do manejo deM. mayaguensis com aplicações de FCO ao solo.

251 – EFEITO DE DIFERENTES FONTES DE MATÉRIA ORGÂNICA INCORPORADAS AO SOLO SOBREMeloidogyne mayaguensis, EM CASA DE VEGETAÇÃO [EFFECT OF DIFFERENT ORGANIC AMENDMENTSINCORPORATED INTO THE SOIL ON Meloidogyne mayaguensis, UNDER GREENHOUSE CONDITIONS] Almeida,A.M.1; Gomes, V.M.1; Souza, R.M.1; Correa, F.M.2 1Universidade Estadual do Norte Fluminense Darcy Ribeiro/CCTA/LEF, Av. Alberto Lamego 2000, 28015-620, Campos dos Goytacazes, RJ, Brazil; 2Universidade Federal de Lavras, Dept.Estatística e Experimentação Agropecuária, Lavras, MG, Brazil. E-mail: [email protected]

A meloidoginose da goiabeira, causada por M. mayaguensis,já causou elevados danos à goiabicultura brasileira, comprejuízos diretos calculados acima de R$ 112 milhões. Atéo momento, a aplicação de resíduos orgânicos ao soloinfestado, combinada com a adubação correta das plantas,tem se mostrado a melhor estratégia de convívio com estenematóide. Objetivou-se avaliar o efeito da incorporaçãono solo da farinha de carne e osso (FCO), torta de nim,casca de camarão e quitosana na reprodução do nematóidee no desenvolvimento vegetativo de mudas de goiabeiras.Dois mil J2 e ovos do nematóide foram homogeneamentemisturados a 2L de areia lavada em vasos, para os quaisas mudas foram transplantadas. Trinta dias após, as fontesde matéria orgânica l istadas acima foram,superficialmente, incorporadas à areia em dosagenscor respondentes a 12, 0,4, 8 e 0,2 Ton.ha-1,respectivamente. Plantas inoculadas, mas não tratadas

serviram como testemunhas. O delineamento estatísticofoi em blocos ao acaso, com cinco tratamentos e seisrepetições (uma planta/vaso). Quatro meses após ainoculação com o nematóide, dados relat ivos àreprodução do nematóide (número de ovos + J2/g deraiz e FR) e ao desenvolvimento vegetativo (altura dasplantas, peso de parte aérea e raízes e volume radicular)foram analisados por ANOVA e teste de Tukey a 5%.Observaram-se diferenças significativas entre ostratamentos para todas as variáveis avaliadas, com a FCOa 12 Ton.ha-1 (equivalente a 3% v/v) destacando-se pelaredução da população do nematóide e maior crescimentodas mudas de goiabeira. As demais fontes de matériaorgânica não proporcionaram controle do nematóide.Experimentos estão sendo conduzidos para ser avaliar oefeito da FCO sobre a população de M. mayaguensis e aprodutividade de pomares infestados.

252 – EFEITO DA URINA DE VACA E FARELO DE MAMONA EM MUDAS DE MAMOEIRO INFESTADASPOR Meloidogyne Javanica [EFFECT OF COW URINE AND CASTOR BEAN ON SEEDLING OF PAPAYAINFECTED BY Meloidogyne javanica] Damasceno, J.C.A.¹; Ritzinger, C.H.S.P.²; Luquine, L.S.³; Vieira, R.S.³; Santa Bárbara,M.³ ¹Universidade Federal do Recôncavo da Bahia, Campus de Cruz das Almas, 44380-000 Cruz das Almas, BA, Brazil;²Embrapa Mandioca e Fruticultura Tropical, Rua Embrapa s/n, Chapadinha, C.P. 007 44380-000 Cruz das Almas, BA,Brazil; ³Agronomia- UFRB-BA. E-mail: [email protected]

O Brasil é o maior produtor mundial de mamão. Todavia,nesta cultura ocorrem perdas significativas devido àpresença de patógenos e, nesse contexto, os fitonematóidespodem causar danos diretos e indiretos. O presente trabalhoobjetivou avaliar o efeito da urina de vaca e farelo demamona no controle de Meloidogyne javanica em plantas demamoeiro. O experimento foi desenvolvido na EmbrapaMandioca e Fruticultura Tropical, em 2007, utilizando farelode mamona em cobertura e urina de vaca, aplicadosmensalmente. O delineamento experimental foi

inteiramente casualizado, estudando cinco tratamentos ecinco repetições: Testemunha absoluta (sem resíduo e semnematóide); testemunha relativa(1500 J2); 1500 J2 + 30 mlurina 50% + 6g mamona; 1500 J2 + 30 ml urina 30% + 6gmamona; 1500 J2 + 30 ml urina 10% + 6g mamona. Asplantas foram inoculadas com M. javanica quinze dias apóso transplantio. Aos 120 dias, avaliou-se altura, diâmetro,número de folhas, comprimento radicular total, massa aéreae radicular fresca e seca, índice de galhas e massa de ovos.Houve diferença significativa para todas as variáveis

408 Vol. 33(4) - 2009


analisadas. O tratamento com urina de vaca a 50% + farelode mamona proporcionou menor desenvolvimento dasplantas. Houve maior redução no número de galhas e massade ovos em todos os tratamentos com urina de vaca + farelo

de mamona. O menor desenvolvimento das plantas, nessestratamentos pode ser devido ao efeito tóxico do excessode nitrogênio conferido pelo farelo de mamona e a urinade vaca.

253 – EFFECTS OF Colocasia esculenta ON Meloidogyne megadora [EFEITO DE Colocasia esculenta EM Meloidogynemegadora] Galhano, C.I.C.1,2; Ryan, M.F.3; Santos, M.S.N.A.4 1Departamento de Ciências Exactas e do Ambiente, EscolaSuperior Agrária de Coimbra, Bencanta, 3040-316 Coimbra, Portugal; 2Unidade de Investigação CERNAS, Bencanta,3040-316 Coimbra, Portugal; 3Department of Zoology, University College Dublin, Dublin 4, Ireland; 4Departamento deZoologia, Faculdade de Ciências e Tecnologia, Universidade de Coimbra, 3004-517 Coimbra, Portugal. E-mail:[email protected]

Plants of the coffee species Coffea arabica L., C. canephoraPierre, and C. liberica Hiern are severely attacked by the root-knot nematode, Meloidogyne megadora, in the DemocraticRepublic of São Tomé and Príncipe. However, plants seemless parasitized if an Araceae species, Colocasia esculenta(colocasia), is present. Based on this observation weinvestigated: 1) post-embryonic development of M. megadoraon colocasia, and 2) effects of colocasia extracts onM. megadora. Few (6.3%) second-stage juveniles (J2)penetrated colocasia roots two days after soil infestationwith 100 J2/plant. Sixty days after inoculation all females

(4.5%) were without eggs. Nor did M. megadora reproduceon colocasia after soil infestation with 5000 J2/plant. Noroot galls were observed. A water rhizome extract ofcolocasia was tested for effects on M. megadora in terms ofJ2 hatching and mortality. The highest tested concentrationof the extract (50g rhizome macerated in 150 mL distilledwater) caused 100% inhibition of J2 hatching and 100% J2mortality of M. megadora, after 168 hours exposure. Hatchinginhibition and mortality was dose responsive. These resultsseem to justify further research on active compounds fromcolocasia against M. megadora.

254 – MANEJO AGROECOLÓGICO DE Meloidogyne EN CULTIVO DEL TABACO E IMPORTANCIA DELAS ROTACIONES CON HORTÍCOLAS Y OTROS CULTIVOS [AGROECOLOGICAL MANAGEMENT OFMeloidogyne IN TOBACCO CULTIVATION AND IMPORTANCE OF ROTATIONS WITH VEGETABLE ANDOTHER CROPS] Castro Lizazo, I1.; López-Pérez, A.2; Díez-Rojo, M.A.3; Villalón Hoffman, A.4; González-López, M.R.3;Martínez, C.3; Urra Sayas, I.1; Hernández Escobar, I.1; Rodríguez Hernández, M. G.5; Díaz Viruliche, L1; Bello, A.3 1UniversidadAgraria de La Habana “Fructuoso Rodríguez Pérez”, San José de Las Lajas, Cuba; 2Centro Agrario de Marchamalo, JCCM,Guadalajara, España; 3Centro de Ciencias Medioambientales, CSIC, Madrid, España; 4Instituto de Investigaciones del Tabaco,San Antonio de Los Baños, Cuba; 5Centro de Sanidad Agropecuaria, CENSA, San José de Las Lajas, Cuba. E-mail:[email protected]

La agroecología plantea que la diversidad, tanto biológicacomo ambiental o cultural, es la clave en la gestión de lossistemas agrarios. Se toma como referencia el cultivo detabaco en Cuba y Extremadura (España) encontrando, quepor ser un monocultivo de ambientes termófilos, puedeseleccionar poblaciones de Meloidogyne arenaria, M. incognita(raza 2 & 4) y M. javanica, según los bioensayos dehospedadores diferenciales para determinar las razas deMeloidoyne spp., encontrandose que M. javanica no aparece enlos cultivos de tabaco en Extremadura. Se pretende diseñarsistemas de manejo mediante rotación con hortícolas, quedeben ser evaluados teniendo en cuenta las condicionesagroecológicas de cada país, y fundamentarse en lacaracterización de especies, razas y biotipos. Se han estudiadocultivares de boniato, pimiento y tomate, teniendo en cuentaademás de la biodiversidad funcional, la diversidad ambiental

relacionada con las técnicas de cultivos. Se encuentran quetodas las variedades de pimientos ensayadas son resistentes aM. arenaria (raza 2) y M. javanica (raza 1), existiendo tambiénvariedades resistentes de boniato y tomate. El algodón esresistente a M. arenaria, M. incognita (raza 1 & 2) y M. javanica, almismo tiempo que el cacahuete es resistente a M. arenaria (raza2 & 3), M. incognita y M. javanica. Son frecuentes la mezcla depoblaciones de M. arenaria, M. incognita y M. javanica, que puedenparasitar a pimientos susceptibles, en ese caso se utilizan comoalternativa portainjertos resistentes. Por todo ello, cabe señalarque cuando se mantiene un monocultivo varios años laspoblaciones de Meloidogyne por lo general se especializan, siendonecesario un manejo agroecológico mediante el diseño desistema de rotación con hortícolas, que puede estarcomplementado con cultivos extensivos de algodón ocacahuete como plantas resistentes.



409

255 – EFECTO AGRONÓMICO DE LODOS EN EL MANEJO DE Meloidogyne Incognita EN TABACO YTOMATE [AGRICULTURAL EFFECT OF MUD IN Meloidogyne incognita MANAGEMENT ON TOBACCO ANDTOMATO] Castro-Lizazo, I.1; López-Pérez, A.2; Díez-Rojo, M.A.3; Villalón-Hoffman, A.4; González-López, M.R.3; Martínez,C.3; Urra-Sayas, I.1; Hernández-Escobar, I.1; Rodríguez-Hernández, M.5; Díaz-Viruliche, L.1; Bello, A.3 1Universidad Agrariade La Habana “Fructuoso Rodríguez Pérez”, San José de Las Lajas, Cuba; 2Centro de Investigación Agraria de Marchamalo,JCCM, Guadalajara, España; 3Centro de Ciencias Medioambientales, CSIC, Madrid; 4Instituto de Investigaciones del Tabaco,San Antonio de Los Baños, Cuba; 5Centro de Sanidad Agropecuaria (CENSA), San José de las Lajas, Cuba. E-mail:[email protected]

Es de gran interés encontrar alternativas que nos permitanun desarrollo agrario sostenible, tratando como objetivofundamental la conservación del medio ambiente y losrecursos naturales. Para lograr este objetivo, se estánrealizando en Cuba varios proyectos multidisciplinares deinvestigación, coordinados por varios organismos, tratandode seleccionar alternativas para una gestión agroecológicade los sistemas agrarios. Entre estas investigaciones destacanlas relacionadas con la aplicación de residuos osubproductos con un gran contenido de elementos de unalto valor nutricional para los cultivos. Dentro de estosproyectos se han iniciado trabajos preliminares para evaluarel efecto de biosólidos extraídos de la depuración de aguasresiduales sobre parámetros de interés en el cultivo detabaco & tomate, así como disminuir el efecto defitonematodos formadores de nódulos sobre las plantasestudiadas. Para estas investigaciones, se eligió un suelo

ferralítico éutrico, estableciendo un diseño completamentealeatorizado de cuatro tratamientos con cinco repeticiones.Los tratamientos consistieron en mezclar el suelo con elbiosólido a las proporciones de 170 g, 180 g & 190 g, ademásde un suelo testigo sin biosólido, en macetas de 1 kg. Losresultados obtenidos señalan que las dosis más eficaces seobtienen en los tratamientos donde se aplicó biosólido arazón de 180 g & 190 g, alcanzando el testigo los valoresmás bajos en el comportamiento de las plantas, por otrolado, se observó una disminuyó de las poblaciones M.incognita en los cultivos estudiados, si se tiene en cuenta losindice de nodulación, que no sobre pasan el índice 1 en losque se aplicó los biosólidos a las dosis de 180 g & 190 g ,mientras que en el testigo llega a alcanzar un índice 7, porotro lado las plantas tratadas con los biosólidos presentabanun mayor vigor y calidad, aunque las dosis de 170 gpresentaban valores intermedios .

256 – PARTIAL RESULTS ON INTEGRATED MANAGEMENT OF Meloidogyne paranaensis ON COFFEEUSING CROP ROTATION, BIOLOGICAL CONTROL AND GENETIC RESISTANCE [RESULTADOSPARCIAIS SOBRE O MANEJO INTEGRADO DE Meloidogyne paranaensis EM CAFEEIROS USANDO ROTAÇÃODE CULTURA, CONTROLE BIOLÓGICO E RESISTÊNCIA GENÉTICA] Carneiro, R.M.D.G.1; Costa, S.B.1; Sousa,F.R.1; Moita, A.W.2; Carneiro, R.G.3 1Embrapa Recursos Genéticos e Biotecnologia, C. P. 02372, 70849-970 Brasília, DF,Brazil; 2Embrapa Hortaliças, C. P. 218, 70351-970, Brasília, DF, Brazil; 3Instituto Agronômico do Paraná - IAPAR, C. P.481, 86047-902, Londrina, PR, Brazil. E-mail: [email protected]

In Brazil root-knot nematodes have contributed to thegradual decay of the best coffee-growing regions in thestates of São Paulo, Paraná, Rio de Janeiro and Minas Gerais.Meloidogyne paranaensis is one of the most aggressive species,causing serious damage to coffee. The use of resistantvarieties is one of the most economical and efficient waysto produce in areas infested with nematodes. Anothereconomic and efficient method to reduce populations ofnematodes in soil is the use of crop rotations with non-host plants. At the same time, recent studies using thebacterium Pasteuria penetrans in biocontrol of nematodes oncoffee have showed very encouraging results in greenhouseconditions (about 80% of control). The objective of thiswork was to test different control methods (crop rotation,biological control and genetic resistance) in integratedtreatment, for the management of M. paranaensis in two

areas with soils of different textures (sand, Mirasselva clay,Rolandia) heavily contaminated by this nematode. Theseareas were partially managed with crop rotation sequencewith non-host plants: black oat (Avena strigosa L.), peanut(Arachis hypogaea L.) and gray mucuna (Mucuna cinereum); theother half retained coffee. The results showed that thesuccession: oat, peanut and gray mucuna, for 18 months,showed a significant effect in reducing the nematodepopulations, both in clay soil and in sandy soil. In the secondstep of the study the management tests were establishedafter crop rotation sequence, biological control and geneticresistance. After the first year the experiment was completelyimpossible in Mirasselva due to Fusarium disease, whichkilled all the plants. In the first three years of evaluation asignificant effect of crop rotation and genetic resistancecan be observed in Rolândia, especially in the two treatments

410 Vol. 33(4) - 2009


with integration of both methods. In the first two years,the presence of bacteria spores was not observed in the J2and females. In the third year, spores adhered to J2 andinside females could be observed. However, the levels ofbacteria were still very low, both in females and on J2. Although

the reduction in the number of eggs was not statisticallysignificant, we can observe a slight decrease in all treatmentswith the bacterium. We could also observe an improvement inthe production in treatments with crop rotation and resistantcultivar, especially with the combination of both.

257 – BIOSOLARIZACIÓN DE SUELOS CON PELLETS DE BRASICAS PARA EL CONTROL DEMeloidogyne Incognita EN INVERNADEROS DE PIMIENTO [SOIL BIOSOLARIZATION USING PELLETSOF BRASSICA TO CONTROL Meloidogyne incognita ON CHILI IN GREENHOUSE] Guerrero, M.M.1; Lacasa, C.M.1;Ros, C.1; Martínez, V.1; Díez-Rojo, M.A.2; Martínez, M.A.1; Bello, A.2; Lacasa A.1 1Biotecnología y Protección de Cultivos,IMIDA, C/Mayor s/n 30150, La Alberca Murcia, España; 2Agroecología, Centro de Ciencias Mediambientales, CSIC, C/Serrano 115, 28006 Madrid, España. E-mail: [email protected]

En el monocultivo de pimiento de los invernaderos de laRegión de Murcia (Sureste de España) se desinfectan lossuelos todos los años para reducir la incidencia de lospatógenos (Phytophthora spp. y Meloidogyne incognita) y paramitigar el efecto de la fatiga del suelo. Más del 20% de lasuperficie (2.000 ha) de estos invernaderos se biosolarizóen 2008 utilizando estiércol de ovino en diferentes gradosde compostaje. Las posibles limitaciones del uso deestiércoles frescos de origen animal para biosolarizaciónhicieron que se ensayaran los pellets de brasicas comoenmiendas biofumigantes. En invernaderos con cultivoscomerciales y de la estación experimental del IMIDA seevaluó la eficacia en el control de los nematodos de pelletsde Brassica carinata (Biofence) a dosis de 150 y 300 g/m2,mezclados o no con estiércol de ovino y suelo nodesinfectado en ensayos de bloques al azar con tres

repeticiones. En algunos invernaderos comerciales el controldel nematodo fue total mientras en otros los niveles deinfección y la proporción de plantas infectadas fueron tanbajos que no repercutieron en la producción. En elinvernadero experimental, la mezcla de pellets con estiércolproporcionó los mejores resultados cuando se aplicó enpleno verano (índice de nodulación (IN) = 0,5; % de plantasinfectadas (%PI) = 13,3) que los pellets solos (IN = 2,3;%PI = 46,7) y que el estiércol solo (IN = 4,1; %PI = 86,7),fueron similares al bromuro de metilo (IN = 0,0; %PI =0,0) y mucho mejor que los del suelo no desinfectado (IN= 5,6; %PI = 100,0). Las producciones comerciales en lostratamientos de biosolarización fueron superiores (14,1 a15,6 kg/m2) a las del bromuro de metilo y del testigo nodesinfectado (12,8 y 12,7 kg/m2). Se analizan los resultadosobtenidos al aplicar la biosolarización en el otoño.

258 – MUSTARD ESSENTIAL OIL TO CONTROL Meloidogyne spp. ON SUBSTRATES FOR SEEDLINGPRODUCTION [CONTROLE DE Meloidogyne spp. PELO USO DO ÓLEO ESSENCIAL DE MOSTARDA EMSUBSTRATOS PARA PRODUÇÃO DE MUDAS] Aguiar, N.D.C.1; Oliveira, R.D.L.1; Dhingra O.D.1; Castro, D.B.1;1Departamento de Fitopatologia, UFV, Viçosa, MG, Brazil. E-mail: [email protected]

Várias culturas são implantadas por meio de mudasproduzidas em substratos preparados ‘in loco’. Arecomendação é que se faça a sua desinfestação, a fim deeliminar pragas do solo, especialmente nematóides. Existempoucas possibilidades para esse tratamento, e dentre elasestá o óleo essencial de mostarda (OEM), rico emisotiocianato de alila, cuja eficiência sobre Meloidogyne spp.já é conhecida. Objetivou-se viabilizar a forma deaplicação com possível redução da dose do OEM, parao tratamento de substratos infestados com M. exigua paraa formação de mudas. Quinhentos litros de substratoinfestado (1000 ovos de M. exigua por litro) foramtratados distribuindo-se o produto por meio de cilindrosde papel embebidos com óleo de mostarda (100 mL/m3

de substrato). Brometo de metila e testemunha semaplicação foram os outros tratamentos. O tempo defumigação foi de 5 dias. Visando minimizar a dose doOEM, em outro ensaio avaliou-se a sua incorporaçãonas doses de 0, 20, 40, 60, 80 e 100 mL/m3 de substratoinfestado. Após a aplicação, os substratos foram vedadoscom lona plástica e mantidos por 5, 10 e 15 dias. Emambos os ensaios, a avaliação se deu aos 60 dias depoisdo transplantio de mudas de pimentão, pela contagemdo número de galhas e ovos por sistema radicular. Aaplicação do OEM, via bastão de papel, reduziu 100%dos nematóides presentes no substrato, uma vez que nãoforam encontrados galhas ou ovos nas raízes das plantasde pimentão. Aumentar o tempo de fumigação para 10



411

dias, ao invés de 5, permitiu reduzir a dose do óleo para60 mL/m3, com 100% de controle do nematóide. Obastão de papel impregnado com OEM revelou-se um

possível substituto para o brometo de metila notratamento de substrato para produção de mudas. Apoiofinanceiro: FAPEMIG.

259 – MANEJO DO NEMATÓIDE DAS GALHAS EM MUDAS DE MAMOEIRO COM RESÍDUOSORGÂNICOS [MANAGEMENT OF ROOT-KNOT NEMATODES IN PAPAYA SEEDLINGS USING ORGANICAMENDMENTS] Damasceno, J.C.A.¹; Ritzinger, C.H.S.P.²; Coelho Filho, M.A.²; Caldas, R.C.²; Luquine, L.S.³; Vieira,R.S.³ ¹Universidade Federal do Recôncavo da Bahia Cruz das Almas, BA, Brazil; ²Embrapa Mandioca e FruticulturaTropical, C. P. 007, Cruz das Almas, BA, Brazil; ³Agronomia da UFRB/BA. E-mail: [email protected]

Os fitonematóides formadores das galhas causam grandesprejuízos à cultura do mamoeiro. Os resíduos agroindustriaisbem manejados possuem potencial para agir comofertilizantes e/ou bionematicidas. Com o objetivo de avaliaro efeito de diferentes resíduos orgânicos e agroindustriaissobre a população de Meloidogyne javanica em plantas demamoeiro, instalou-se um experimento na Embrapa Mandiocae Fruticultura Tropical, utilizando farelo de mamona, rocksil®

e/ou nim, em cobertura, e aplicados, ou não, junto da águade irrigação em intervalos de 15 dias, juntamente com urinade vaca e/ou manipueira a 50%. O delineamentoexperimental foi inteiramente casualizado, estudando onzetratamentos e cinco repetições: Testemunha absoluta;testemunha relativa com nematóides; 6g de nim; 6g de farelode mamona; 6g de rocksil; 6g de nim + 30 mL de urina; 6g

de nim + 30 mL de manipueira; 6g de farelo de mamona +30 mL de urina; 6g de farelo de mamona + 30 mL demanipueira; 6g de rocksil + 30 mL de urina, 6g de rocksil +30 mL de manipueira. As mudas foram inoculadas com1000 indivíduos J2 de M. javanica, quinze dias após otransplantio. Aos 120 dias, avaliou-se a altura, diâmetro,número de folhas, área foliar total, número de galhas emassas de ovos. Houve diferença significativa para todasas variáveis analisadas. A irrigação dos tratamentos, compresença de urina ou manipueira, promoveu redução nonúmero de galhas e massa de ovos. A mamona e o nimaplicados com manipueira promoveram melhordesenvolvimento das plantas. Os tratamentos com urinade vaca apresentaram menor desenvolvimento da parteaérea.

260 – ESTRATEGIAS BIOLÓGICAS DE REDUCCIÓN DE LA POBLACIÓN DE Meloidogyne spp. ENINVERNADERO [BIOLOGICAL STRATEGIES IN GREENHOUSE FOR REDUCING Meloidogyne spp.] Gauna,P.1 1EEA INTA Bella Vista CC Nº 5 (3432) Bella Vista, Corrientes. E-mail: [email protected]

Los abonos verdes (Crotalarias, Desmodium, Panicum, Ricinusy cereales de invierno reducen las poblaciones de Meloidogynespp. Por la ocupación continua del suelo en el invernaderose planteó la consociación con el cultivo sin afectar laslabores ni el rendimiento. El objetivo de este trabajo fuecomparar algunas alternativas biológicas realizadassimultáneamente con un cultivo de tomate susceptible, paraevitar las infecciones de Meloidogyne spp. Medir elrendimiento y relacionarlo a la presencia de nematodos. Seplantó tomate Río Grande en dos invernaderos de la EEAINTA Bella Vista (Argentina). Los tratamientos fueron:Panicum maximun Var. Tanzania (68 g), Desmodium(68g), trigo(250 g), expeller de ricino (350 g/m2) y Testigo. Se utilizóun diseño en bloques completamente aleatorizados con 4repeticiones. El segundo año de cultivo comenzó solo con

tomate para medir el efecto de la incorporación de lasplantas de los abonos verdes y de la planta de trigo. Elanálisis de nematodos en las raíces se hizo al final del cultivoy los análisis de nematodos de suelo se realizaronperiódicamente. Todos los tratamientos ensayadossuperaron en rendimiento al testigo tanto en el primer añocomo en el segundo. En el primer año el mejor tratamientofue la aplicación en el suelo del expeller de ricino. En elsegundo año el mejor rendimiento fue la consociación contrigo. No fueron significativos al 5%. Los abonos verdes(Leguminosas y Gramíneas) consociados con el tomate sepueden emplear para mejorar el rendimiento. Tambiénaumentan el contenido de materia orgánica en el suelofavoreciendo la flora y fauna que limita el aumento denematodos fitófagos.

412 Vol. 33(4) - 2009


261 – EVALUACION DE ESTRATEGIAS BIOLÓGICAS PARA DISMINUIR LA DENSIDAD DE UNAPOBLACIÓN DE Meloidogyne incognita EN INVERNADEROS [EVALUATION OF BIOLOGICALSTRATEGIES TO REDUCE POPULATION DENSITY OF Meloidogyne incognita IN GREENHOUSE][AVALIAÇÃO DAS ESTRATÉGIAS BIOLÓGICAS PARA DIMINUIR A DENSIDADE DA POPULAÇÃO DEMeloidogyne incognita EM CASA DE VEGETAÇÃO] Gauna, P.1 1EEA INTA Bella Vista CC Nº 5 (3432) Bella Vista,Corrientes. E-mail: [email protected]

Los abonos verdes (Crotalaria, Desmodium, Panicum, Ricinus)y cereales de invierno pueden reducir las densidades deMeloidogyne spp. Debido al continuo uso del suelo eninvernaderos se sembraron semillas de abonos verdes enel mismo lugar del cultivo para evaluar la reducción de ladensidad de población. El objetivo de este trabajo fuecomparar algunas alternativas biológicas realizadassimultáneamente con un cultivo de tomate susceptible parareducir las infecciones de Meloidogyne incognita. Se plantótomate perita “Río Grande” en dos invernaderoscontaminados con M. incognita de la EEA INTA Bella Vista,Corrientes (Argentina). Los tratamientos, en 6 metroslineales por cada repetición donde ya estaba trasplantadoel tomate, fueron: siembra de 68 g de P. maximun Var.Tanzania, siembra de 68 g de D. heterocarpon, siembra de250 g de Triticum aestivum, incorporación de desechos desemillas prensadas de R. communis (350 g/m2) y Testigo solocon tomate. Se utilizó un diseño en bloques completamente

al azar con 4 repeticiones. El segundo año solo se cultivótomate para medir el efecto de la incorporación de losabonos verdes y de trigo. El análisis de nematodos en lasraíces para evaluar agallas se hizo al final del cultivo y losanálisis de nematodos de suelo se realizaron al inicio y alfinal. Todos los tratamientos evaluados superaron enrendimiento al testigo pero no fueron significativos al 5%según el análisis de varianza, tanto en el primer año comoen el segundo. En el primer año el que dio mayorrendimiento fue la aplicación en el suelo de desechos desemillas prensadas de ricino. En el segundo año el mejorrendimiento se obtuvo con la incorporación de trigo.En el análisis de 1 g. de raíces se encontraron 37 agallasen el testigo, 24 con Desmodium heterocarpon, 16 conTriticum aestivum, 3 con Panicum maximun y 2 con losdesechos de semillas prensadas de Ricinus communis. Enel análisis de suelo no se encontraron individuos deMeloidogyne incognita.

262 – INCIDENCIA DE LA COBERTURA VEGETAL Y DEL ORUJO DE UVA FRESCO EN LOSRENDIMIENTOS Y LAS POBLACIONES DE NEMATODOS PRESENTES, EN UN VIÑEDO DE LACULTIVAR MALBEC, EN LA PROVINCIA DE MENDOZA, ARGENTINA [INFLUENCE OF COVER CROPAND GRAPE POMACE INCORPORATED INTO THE SOIL, ON YIELD AND ON NEMATODE POPULATION,IN A VINEYARD CV. MALBEC, IN MENDOZA PROVINCE, ARGENTINA] Martinotti, M.D.1; Castellanos, S.J.1;Toro, M.S.1; Tonda, M.M.1 1Departamento de Ciencias Biológicas, Facultad de Ciencias Agrarias, UNCuyo, Chacras deCoria, Luján de Cuyo, Mendoza. Argentina. E-mail: mdeltoroca.uncu.edu.ar

Meloidogyne incognita y Pratylenchus neglectus, se encuentran entrelos principales nematodos fitoparásitos que atacan viñedosde Argentina. En la Provincia de Mendoza se han realizadovarios trabajos de manejo integrado de nematodosutilizando enmiendas de suelo y pies resistentes. El objetivode la presente investigación fue evaluar la incidencia de unacobertura vegetal de Lolium perenne L. y Lotus corniculatus y laincorporación de orujo de uva fresco, sobre la densidad depoblación de nematodos endoparásitos en suelo y raícesde vid de la cv. Malbec, conducido en espaldero y con riegosuperficial. Los tratamientos efectuados fueron: 1)Testigo:control de malezas con glifosato al pie de la planta y labranzamecánica en el interfilar; 2) cobertura perenne en el interfilary control de malezas con glifosato al pie de la planta y 3)incorporación de orujo de uva fresco durante el recesoinvernal, al pie de la planta en dosis de 20 t.ha-1 con control

de malezas con glifosato al pie de la planta y labranzamecánica en el interfilar. Se evaluó: a) poblacionesnematodos endoparásitos y saprófitos antes de la aplicaciónde la enmienda (poscosecha 2005) y en poscosecha 2009,b) índice de reproducción; c)rendimientos y d)peso demadera de poda. Los resultados obtenidos indicaron quelas poblaciones de M. incognita disminuyeron desde 2005 a2009 en los tres tratamientos. El IR en los tres tratamientosfue inferior a 1, con el menor IR=0,37 en el tratamientotestigo. En P. neglectus las poblaciones finales seincrementaron en los tres tratamientos. La población denematodos saprófitos en orujo de uva se incrementaroncinco veces. Los rendimientos de uva en el 2009 fue inferiora los años anteriores debido a condiciones climáticasdesfavorables. La mayor producción en 2009 se incrementócon orujo de uva en un 39% respecto al tratamiento con



413

cobertura vegetal y un 6% con respecto al testigo. Seconcluye que la cobertura vegetal permanente con la mezclade Lolium y Lotus, no es adecuada como manejo de suelo enun viñedo infestado con M. incognita y P. neglectus ya quemantiene las poblaciones de ambas especies y no incrementalas poblaciones de saprófitos en el tiempo, y disminuyó la

producción en un 36% respecto al 2005. Se recomienda laaplicación invernal de orujo de uva fresco ya que noincrementó las poblaciones de M. incognita ni de P. neglectus,respecto al 2005 incrementó en un 500% las poblacionesde nematodos saprófitos respecto a la cobertura vegetal yal testigo y dio el mayor rendimiento en el 2009.

263 – WATER EXTRACTS OF Calea urticifolia MILL. FOR CONTROLLING Meloidogyne incognita INTOMATO, YUCATAN, MEXICO [EXTRACTOS ACUOSOS DE Calea urticifolia MILL. PARA EL CONTROL DEMeloidogyne incognita EN TOMATE, EN YUCATÁN, MÉXICO] Herrera-Parra, E.1; Cristóbal-Alejo, J.2; Tún-Suárez, M.2;Gamboa-Angulo, M.M.3; Marbán-Mendoza, N.4 1INIFAP Campo Experimental Mocochá, Yucatán, México; 2InstitutoTecnológico de Conkal, Yucatán, México; 3Unidad de Biotecnología, Centro de Investigación Científica de Yucatán, Mérida,Yucatán, México; 4Universidad Autónoma Chapingo, Km 38.5 Carr. México-Texcoco, Texcoco, México, C.P. 56230. E-mail:[email protected]

Water extracts of roots and leaves of Calea uriticfolia Mill.were evaluated for controlling Meloidogyne incognita in Tomato(CV Rio Grande) growing under lathhouse conditions inConkal, Yucatan, Mexico. The number of galls per plants,numbers of eggs per g of macerated roots at applicationstime of 0, 24, 48 and 72 h and extract concentrations of 0,50 and 100% were the main parameters assessed. For thevariable number of galls per plant both kinds of extractprovided about the same control (Tuckey, P= 0.05). Thiswas also true with extract concentrations where 50 and 56%

galling reduction were obtained with both 50 and 100%concentrations respectively, compared with the untreatedplants. Root extract concentrations inhibited egg numbersper plant 20% more than those treated with leaf extracts.Here, the 100% concentration inhibited 72% egg productioncompared with the untreated and the 50% concentration (31%inhibition), regardless of the kind of extracts. The lowest eggnumber per plant was obtained when extracts were applied atplanting (45%) and 72 h after planting (48%) as comparedwith the untreated control plants.

264 – NEMATICIDAL ACTIVITY OF ESSENTIAL OIL OF VERBENA (Verbena officinalis) AND THYME(Thymus vulgaris) AGAINST Meloidogyne mayaguensis [ATIVIDADE NEMATICIDA DOS ÓLEOS ESSENCIAISDE VERBENA (Verbena officinalis) E TOMILHO (Thymus vulgaris) SOBRE Meloidogyne mayaguensis] Amora, D.X.1; Ferraz,S.1; Figueiredo, L.D.1; Xavier, D.M.1; Podestá, G.S.1; Ferreira, F.C.1; Lopes, E.A.1; Ferreira, P.A.1 1Universidade Federal deViçosa, 36570-000 Viçosa, MG, Brazil. E-mail: [email protected]

Essential oils extracted from plants represent an alternativein the protection of plants against pathogens, especially inorganic agriculture. The effect of essential oils of verbena(Verbena officinalis) and thyme (Thymus vulgaris) on themortality of second-stage juveniles (J2) of Meloidogynemayaguensis was evaluated in vitro. The test was conducted inPetri dishes, seven replicates per treatment. On each dish,containing the different oils solubilized in dimethyl sulfoxideDMSO, were added 300 J2 of M. mayaguensis with Phosphatebuffered saline. Nematodes (J2) immersed in distilled water,

and distilled water containing DMSO were used as controls.The dishes were sealed with plastic film and kept in BODat 26 °C for 24 hours. To determine mortality rate thejuveniles were washed and kept in water for 24 h andthen the percentage of living and dead juveniles wasevaluated. The data of each treatment were subjected toANOVA, and compared among them by Tukey test at5%. Both essential oils tested were highly effective tokill the nematodes. Financial support:CAPES/CNPq/FAPEMIG.

265 – EVALUATION OF ESSENTIAL OILS OF MEDICINAL PLANTS FOR THE CONTROL OFMeloidogyne javanica IN TOMATO PLANTS [AVALIAÇÃO DE ÓLEOS ESSENCIAIS DE PLANTASMEDICINAIS NO CONTROLE DE Meloidogyne javanica EM TOMATEIRO] Amora, D.X.1; Ferraz, S.1; Figueiredo,L.D.1; Xavier, D.M.1; Podestá, G.S.1; Ferreira, F.C.1; Lopes, E.A.1; Ferreira, P.A.1 1Universidade Federal de Viçosa, 36570-000 Viçosa, MG, Brazil. E-mail:[email protected]

Plant essential oils can be a potential source of nematicidalcompounds. Thus, the objective of this work was to evaluate

the effect of spraying the essential oils of oregano (Origanumvulgare), lemon grass (Cymbopogon citratus), eucalyptus

414 Vol. 33(4) - 2009


(Eucalyptus citriodora), mint (Mentha s.p) and basil (Ocimumbasilicum) on tomato plants for controlling Meloidogyne javanicaunder greenhouse conditions. Each pot was infested 15 daysbefore transplanting with 5,000 eggs of the nematode. Theessential oils were diluted in dimethyl sulfoxide solution toa final concentration of 0.05%. Application of the oils

started either 24 h before or seven days after transplanting,and plants were sprayed weekly for eight weeks. After thisperiod, the plants were assessed for number of galls andnumber of eggs. None of the plant essential oils was ableto suppress the number of galls and eggs of M. javanica.Financial support:CAPES/CNPq/FAPEMIG.

266 – MULTIPLICAÇÃO DOS NEMATÓIDES DAS GALHAS (Meloidogyne javanica e M. mayaguensis) EMPLANTAS UTILIZADAS COMO ADUBO VERDE [MULTIPLICATION OF ROOT-KNOT NEMATODES(Meloidogyne javanica AND M. mayaguensis) ON PLANTS USED AS GREEN MANURE] Rosa, J.M.O.1; Wilcken, S.R.S.11FCA/UNESP, Departamento de Produção Vegetal/Defesa Fitossanitária, C.P. 237, 18610-307 Botucatu, SP, Brazil. E-mail: [email protected]

A prática da adubação verde é uma das maneirasrecomendadas para o controle de nematóides,principalmente em áreas infestadas com Meloidogyne sp. Opresente trabalho teve como objetivo determinar o fatorde reprodução de duas espécies dos nematóides das galhas,Meloidogyne javanica e M. mayaguensis, em cinco plantasrecomendadas como adubo verde (mucuna preta, mucunacinza, azevém, milheto e lab lab). O experimento foiconduzido em casa-de-vegetação, sendo cada parcelaconstituída de uma planta por vaso contendo 2 litros desubstrato autoclavado, na proporção de 1:2:1 (solo: areia:matéria orgânica). A infestação do solo foi realizada com5.000 ovos e eventuais juvenis de segundo estádio para

cada espécie de nematóide/vaso após as plantasatingirem 10 cm de altura. Tomateiros ‘Rutgers’ foramutilizados como padrão de viabilidade do inóculo. Odelineamento experimental foi inteiramente casualizadocom seis repetições por tratamento. A avaliação do pesofresco da raiz, número total de nematóides presentes nosolo e na raiz, número de nematóides/g de raiz e dofator de reprodução foi realizada 60 dias após ainoculação. Com exceção ao lab lab que proporcionouum fator de reprodução igual a 2,65 para M. javanica, osoutros adubos verdes testados não proporcionaram amult ipl icação das espécies de nematóidesestudadas.CAPES/FAPESP

267 – INVESTIGATION OF MOLECULES FROM A SOLANACEAE SPECIES FOUND IN THEBRAZILIAN CERRADO EFFECTIVE AGAINST PLANT NEMATODES [INVESTIGAÇÃO DE MOLÉCULASDE UMA ESPÉCIE SOLANACEAE PROVENIENTES DO CERRADO BRASILEIRO EFETIVAS CONTRAFITONEMATÓIDES] Silva, T.S.1; Firmino, A.A.P.2; Del Sarto, R.P.3; Grossi de Sa, M.F.1; Rocha, T.L.1 1Embrapa RecursosGenéticos e Biotecnologia, C. P. 02372, 70849-970 Brasília, Brazil; 2Universidade Federal do Rio Grande do Sul, C. P.15005, 91501-970 Porto Alegre, RS, Brazil; 3Universidade de Brasília, 70910-900 Brasília, Brazil. E-mail:[email protected]

Meloidogyne incognita is a plant parasite responsible for croplosses reaching millions of dollars worldwide yearly. Itattacks plant roots causing galls and later the host’s death.Its control is heavily based on chemicals which aredetrimental to humans and the environment. Consequently,new and safer strategies for managing this pathogen areurgently required. Plants are a source of natural productswhich may possess nematicidal compounds. In this context,this work aims to screen for specific and effective moleculesfrom coat, pulp and seed aqueous extracts of a Solanaceaespecies from the Cerrado effective against J2 of M.incognita.To achieve that, 10 g of each biological material was groundand solubilized individually in 60 mL of distilled water andmaintained under gentle agitation for 16 hours in a coldroom. After this procedure, the samples were filtered in

gauze and centrifuged at 17200 g for 45 minutes at 4°C.The coat, pulp and seed crude extracts were fractioned bydialysis in a 3.5 kDa membrane, generating internal dialysatewith molecules larger than 3.5 kDa and another fraction ofexternal dialysate with molecules smaller than 3.5 kDa. All thefractioned samples were lyophilized and bioassays were carriedout using around 200 μg against approximately 100 J2 in a finalvolume of 300 μL. The J2 were exposed for 48 hours, thentransferred to water for another 12 hours and counted in aPeter’s slide using optical microscopy. According to the results,coat external dialysate, pulp internal and external dialysatesand seed external dialysate exhibited a mortality rate of 100%.The future steps of this work include the purification and thebiochemical and biophysical characterization of the activemolecules. EMBRAPA, FAP-DF, CNPq



415

268 – ACTIVITIES OF ORGANIC SUBSTANCES AGAINST Meloidogyne spp.. [ATIVIDADES DESUBSTÂNCIAS ORGÂNICAS CONTRA Meloidogyne spp.] Silva, W.J.R.1; Machado, A.R.T.1; Campos, V.A.C.1; Oliveira,D.F.1; Campos, V.P.2; Silva, E.H.2 1Universidade Federal de Lavras, Departamento de Química, C. P. 3037, 37200-000Lavras, MG, Brazil; 2Universidade Federal de Lavras, Departamento de Fitopatologia, C. P. 3037, 37200-000 Lavras, MG,Brazil. E-mail: [email protected]

Due to environmental and food contamination withharmful substances used to control plant-parasiticnematodes, less toxic and more efficient nematicides arewelcomed. Thus, some substances commonly used inchemical laboratories that can be easily produced by thechemical industry were tested for motility, mortality andhatching of second-stage juveniles (J2) of Meloidogyneincognita and M. exigua. To carry out the motility and mortalityassays, J2 were put into contact with solutions of thesubstances in 300 µL wells of 96-well polypropylene plates,using the commercial nematicide as positive control. Mobileand dead J2 were counted 12 and 24 h after the beginningof the experiment, respectively. For the hatching assays,which were also done by the use of the same plates, eggs

were kept in contact with substances to be evaluated for 15days, during which hatched J2 were counted. The mostactive substance was 2,3,5- triphenyltetrazolium chloride,which presented CL50 of 130 µg/mL for both nematodespecies during the J2 mortality assays, while the CL50 foraldicarbe was 20 µg/mL. Picric acid was also very activeagainst the nematodes, but the corresponding CL50 duringthe mortality assay was 400 µg/mL. Although not so activein the J2 motility and mortality assays, circlegrow presentedhigh activity against eggs of both M. incognita and M. exigua.Further studies should be carried out to evaluate the effectof such substances on Meloidogyne spp. in nematode-inoculated plants. SUPPORTED BY: Fapemig, CNPq andCapes.

269 – EFFECT OF CASTOR BEAN CAKE ON NEMATODE POPULATION AND SUGARCANEPRODUCTIVITY [EFEITO DA TORTA DE MAMONA SOBRE AS POPULAÇÕES DE NEMATÓIDES E APRODUTIVIDADE DA CANA-DE-AÇÚCAR] Dinardo-Miranda, L.L.1; Fracasso, J.V.1 1Instituto Agronômico, Centrode Cana-de-açúcar, C.P. 206, 14001-970 Ribeirão Preto, SP, Brazil. E-mail: [email protected]

The suppression of plant-parasitic nematodes caused byfruit meal castor bean (Ricinus communis) and others organicamendments is well-known, but there is no informationabout the amount of organic amendment necessary forconsistent suppression of the nematode population onsugarcane fields. The objective of this study was to evaluatethe role of castor bean cake in suppressing the nematodepopulation and improving sugarcane yield. One experimentwas carried out in field infested by Meloidogyne javanic andmixed population of Pratylenchus zeae and P. brachyurus, atRibeirão Preto, São Paulo, Brazil, using a randomizedcomplete block design, with six treatments (check, aldicarb150G 12 kg/ha, carbofuran 350SC 6.5 L/ha, castor bean

cake at 600, 1,200 and 1,800 kg/ha) applied at planting,and six replications. Significant nematode populationdifferences between the treatments were observed in thesampling carried out at three months after planting. Onthis occasion, the treatments with nematicides reduced M.javanica and Pratylenchus populations, whereas the treatmentwith castor bean cake at 1,800 kg/ha reduced the Pratylenchuspopulation. At the harvest, the productivity in the checktreatment (89.3 t/ha) was significantly lower than the valuesobtained for treatments with carbofuran (99.9 t/ha) andwith castor bean cake at 600 (101.5 t/ha) or 1,800 kg/ha(99.9 t/ha), suggesting that this organic amendment canbe useful in a nematode integrated pest management.

270 – EFEITO DO SILÍCIO SOBRE AS POPULAÇÕES DE NEMATÓIDES FITOPARASITOS EM QUATROVARIEDADES DE CANA-DE-AÇÚCAR [EFFECT OF SILICON ON NEMATODE POPULATION IN FOURSUGARCANE VARIETIES] Dias, F.L.1; Rossetto, R.1; Dinardo-Miranda, L.L.1; Landell, M.G.A.1; Figueiredo, P.1 1InstitutoAgronômico, Centro de Cana-de-açúcar, C. P. 206, 14001-970 Ribeirão Preto, SP, Brazil. E-mail: [email protected]

A cana-de-açúcar absorve uma enorme quantidade de silíciodo solo e, embora as funções desse elemento ainda nãoestejam completamente esclarecidas, há evidências de queele contribui para aumentar a resistência das plantas ao

ataque de certas pragas e de alguns patógenos. Assim, paraavaliar o efeito do silício sobre as populações de nematóidesfitoparasitos, foram conduzidos 2 experimentos, emLatossolo vermelho de textura média, utilizando o

416 Vol. 33(4) - 2009


delineamento de blocos ao acaso, com parcelas subdivididase quatro repetições. Às parcelas correspondeu o plantiodas variedades (SP81-3250, SP83-2847, RB72454,RB867515) e às subparcelas, a aplicação ou não de silicatode cálcio, na dose de 940 kg/ha. As áreas experimentaisestavam infestadas por Meloidogyne javanica e por umapopulação mista de Pratylenchus zeae e P. brachyurus. Em

ambos os experimentos, não se observaram diferençassignificativas entre as variedades quanto às populaçõesde nematóides. Também não foram obser vadasdiferenças entre as parcelas com ou sem sil ício,mostrando que este produto não interferiu na resistênciaou suscetibilidade das plantas aos nematóides emquestão.

271 – BIODIGESTOR EFFLUENTS FROM CABBAGE, MUSTARD AND PEPPER ON Meloidogyne incognitaCONTROL [EFLUENTE DE BIODIGESTOR A BASE DE REPOLHO, MOSTARDA E PIMENTA NOCONTROLE DE Meloidogyne incognita] Cosmo, D.A.1; Dias-Arieira, C.R.1; Mattos, R.M.1; Cunha, T.L.P.1; Puerari, H.H.1;Chiamolera, F.M.1; Sassaki, T.C.1 1Universidade Estadual de Maringá, Campus Regional de Umuarama, C.P. 65, 87501-970Umuarama, Paraná, Brasil. E-mail: [email protected]

This work aimed to evaluate the control of Meloidogyneincognita using biodigestor effluent from cabbage, mustardand pepper. For this, the following treatments wereprepared: 450 g of cabbage + 50 g of pepper (RP), 350 gof cabbage + 150 g of mustard (RM) and 300 g of cabbage+ 150 g of mustard + 50 g of pepper (RMP ) were addedto two liters of water in drums properly prepared tofunction as biodigestor. After 60 days the material wasremoved for application. For this, previously germinatedseedlings of tomato cv. Santa Cruz were transplanted topots with a capacity of one liter and were inoculated with asuspension of 4000 eggs + juveniles of the nematode. Oneday after the inoculation, the soil was treated with 40 ml ofconcentrated suspension of biodigested material, and ofbiodigested material diluted in water in the proportion 1:1,

1:2 and 1:3. As a control, 40 ml of water and 40 grams ofcut cabbage incorporated in the soil were used. After 60days of cultivation, the plants were collected for evaluationof the fresh and dry weight of shoot, fresh weight of root,number of galls and number of nematode eggs. Theexperiment was conducted in a completely randomizeddesign with five replicates and the means obtained werecompared by Duncan test 5%. Increases in weights of shootand root were obtained for treatments RP and RMconcentrated. The treatments that allowed best nematodecontrol were RM concentrated and diluted 1:1 and 1:2 andRP diluted 1:2 and 1:3. The RMP concentrated treatmentpromoted the death of plants, and their concentrations didnot reduce the number of eggs (P<0.05) when comparedto control.

Section 8 - Chemical control

272 – EVALUACIÓN DE LA PERDURACIÓN DE LA ACCIÓN NEMATICIDA DEL RUGBY 200 CS[EVALUATING THE DURABILITY OF THE NEMATICIDAL ACTION OF RUGBY 200 CS] Magunacelaya, J.C.1;Mancilla, R.1; Ahumada, M.T.1; Lunsdted, J.2 1Pontificia Universidad Católica de Valparaíso. Avenida Brasil 2950, Casilla4059, Valparaíso, Chile; 2ASP Chile. Av. Américo Vespucio 2680 Piso 11 Conchalí Santiago. E-mail: [email protected]

Los objetivos de estos trabajos (2) fueron determinar laperduración de la actividad nematicida del rugby(cadusafos), en condiciones de plantas en bolsa eninvernadero. Se aplicó Rugby 200 CS al suelo de plantas detomate (var. Cal Ace) en bolsas, todas el mismo día. Paraevaluar la perduración del efecto nematicida del Rugby seinoculó huevos de Meloidogyne ethiopica directamente a lasraíces de tomate, en diferentes períodos de tiempo respectoa la aplicación del producto. Dos tratamientos tuvieron 5días de diferencia respecto a la aplicación del Rugby, uno 5días antes y el otro, 5 días después. Las otras inoculacionesde huevos se realizaron hasta 150 días después de laaplicación de Rugby. El tratamiento de inóculo 5 días antes

de la aplicación del Rugby es un testigo que intenta imitarla condición de campo en que los nemátodos están en elsuelo antes de la aplicación del nematicida. El suelo semantuvo a Capacidad de Campo mediante riegos cada doso tres días. No se realizaron aplicaciones de productosinsecticidas, fungicidas y fertilizantes. Las plantas de tomateusadas tenían 60 días para disponer de un sistema radicalatractivo para los nemátodos, y eran de la var. Cal Ace. Lasmacetas fueron de 500 ml., y el sustrato constituido por 50 %arena y 50% tierra de hoja, todo esterilizado con vapor. En lascondiciones de estudio se concluyó que el efecto nematicidadel Rugby perduró 150 días, y que presentó baja actividadnematicida en las dos primeras semanas post-aplicación.



417

273 – AVALIAÇÃO DA TOLERÂNCIA DE JUVENIS INFECTANTES DE Heterorhabditis baujardi LPP7 ADIFERENTES SOLUÇÕES ESTERILIZANTES [TOLERANCE OF INFECTIVE JUVENILES OF Heterorhabditisbaujardi LPP7 TO DIFFERENT STERILIZING SOLUTIONS] Ferreira, T.F.1; Dolinski, C.M.1; Souza, R.M.1; Almeida,A.M.1 1Universidade Estadual do Norte Fluminense Darcy Ribeiro, CCTA, LEF, 28015-620 Campos dos Goytacazes RJ,Brazil. Email: [email protected]

Nematóides entomopatogênicos do gênero Heterorhabditisatuam em associação simbiótica com bactérias do gêneroPhotorhabdus no controle biológico de pragas em váriasculturas agrícolas. Em muitos estudos envolvendo estesorganismos faz-se necessária a esterilização superficial dejuvenis infectantes (JIs) sem que estes percam a suainfectividade ou morram. Este trabalho visou comparar osseguintes protocolos de esterilização superficial de JIsHeterorhabditis baujardi LPP7: solução 1, composta de 0,5mL de NaOCl a 12% + 1,5 mL de NaOH a 4 mol + 10 mLde água destilada, com tempo de incubação dos JIs de 4minutos; solução 2, composta de 1mL de NaOCl a 12% +1mL de NaOH 4 mol + 10 mL de água destilada, comincubação de 3 minutos; e solução 3, composta de 1 mL deNaOCl a 6% + 1mL de NaOH 4 mol + 10 mL de água

destilada, com incubação de 2 minutos. O design estatísticofoi inteiramente casualizado, com três tratamentos e cincorepetições (suspensões de 500 JIs) por tratamento. Asobrevivência dos JIs foi avaliada pela mobilidade em águaapós os tratamentos. As três soluções testadas forameficientes na esterilização superficial dos JIs, a julgar pelonão crescimento de contaminantes quando os JIs tratadosforam transferidos para placas de Petri com meio N sólido.A solução 3 apresentou menor índice de mortalidade dosJIs (média de 0,7 %), a qual foi significativamente distinta(P<0,05) em relação às soluções 2 e 1, cujas mortalidadesmédias foram de 4,7 e 5,3 %, respectivamente. Conclui-seque a solução 3 pode ser utilizada na esterilização externade JIs de Heterorhabditis baujardi LPP7 sempre que se fizernecessária a sua utilização em condições assépticas.

274 – CHEMICAL MANAGENT OF Meloidogyne chitwoodi ON POTATO IN IDAHO, USA [CONTROLEQUÍMICO DE Meloidogyne chitwoodi EM BATATA EM IDAHO, EUA] Hafez, S.L.1; Sundararaj, P.1 1University of Idaho,Parma Research and Extension Center, 29603 U of I Ln, Parma, Idaho 83660, USA. E-mail: [email protected]

Experiments were conducted at the University of Idaho,Parma Research and Extension Center, Parma, Idaho, USAto study the efficacy of Telone II or Vydate CLV alone orTelone II in combination with Vapam HL or differentapplication methods of fosthiazate for control of Meloidogynechitwoodi in potato. Both experiments were laid out in arandomized complete block design with five and sixtreatments and six replications in a sandy loam field. In theprevious fall, Telone II and Vapam were applied broadcastby ripper and fumigation bar to a depth of 16-18" and 8-10" respectively. Vydate was applied at planting andchemigated six times at two week intervals. Preplanttreatments of fosthiazate were broadcast sprayed to deliver27 gal/acre or shanked at 6 inch deep or shanked followedby rototilling or broadcast surface spray with the nozzlesattached to the front of the rototiller. Potato seed pieceswere machine planted at 10" drop spacing. Plant protection

practices, weeding and other standard cultural practices werefollowed. Potatoes from the central 25 feet of the centertwo rows from each plot were mechanically harvested andgraded for size and inspected for symptoms of nematodeinfection. In the first experiment there was an increase intotal yield in different combinations of all treatmentscompared to the control plots. Percentage of infected tubersin treated plots ranged from 0.9 to 30.5. Lowest level ofnematode infection was recorded in the Telone 15 g/A +Vapam 30 gal/A than other treatments. In the secondexperiment different application methods of Fosthiozateindicated that percentage of tubers with nematode infectionin treated plots ranged from 5.6 to 35.5. Lowest level ofnematode infected tubers was observed in Fosthiazate 4.5 ai/A Temik 20lbs at planting (5.6 %) applied plots. This studyindicated that application of fosthiazate by standard broadcastsurface method is more effective than the shank injection.

418 Vol. 33(4) - 2009


275 – NEMATICIDAL ACTIVITY OF PLANT DEFENSINS [ATIVIDADE NEMATICIDA DE DEFENSINASVEGETAIS] Del Sarto, R.P.1,2; Lacerda, A.F.2,4, Firmino, A.A.P.2,3; Grossi Sá, M.2,4; Rocha, T.L.2; Grossi Sá, M.F.2,4. 1Embrapa/Cenargen, C.P. 02372, 70849-970 Brasília, DF, Brazil; 2Brasilia University, UnB, Cellular Biology Department, DarcyRibeiro Campus, 70910-900 Brasília, DF, Brazil; 3Rio Grande do Sul Federal University, UFRGS, Av. Paulo Gama, 110,90040-060 Porto Alegre, RS, Brazil; 4 Brasilia Catholic University, UCB, SGAN 916 norte, 70.790-170 Brasília, DF, Brazil.E-mail:[email protected]

Plant defense mechanisms make use of several moleculesto block physical and chemical attacks. Among them aredefensins, which are 5-6 kDa cationic proteins, with 45-54amino acids folded on tertiary structure of a cysteine-stabilized-motif, maintained by disulfide bridges. They havediverse activities, as antimicrobial, antifungal, antiviral,protease, amylase and protein synthesis inhibitor, besidesacting on cell cycle. Because of their characteristics, thesemolecules are extensively studied to obtain new drugsagainst phytopathogenic microorganisms. However, fewstudies have been reported in order to verify a possiblenematicidal activity. Defensins are obtained in limitedquantities from natural source, which makes studies likeevaluation of activity, action mode and structuralcharacterization difficult. Thus, heterologous expressionovercomes this limitation by providing a way to producethem in correct folding and suitable quantities. One

microorganism used to express proteins is themethylotrophic yeast, Pichia pastoris. Many defensins havebeen produced in this system, such as Pisum sativumDefensin1 (PsD1), Mung bean defensin (VrD1), sugar beetdefensins (AX2), DFN1, Sugarcane Defensins 1 (SD1). Inthis work, two plant defensins, Drr230a and SD2, frompea and sunflower, were produced in P. pastoris. Afterpurification on IMAC (immobilized metal ion affinitychromatography) the proteins were assayed against root-knot nematode (Meloidogyne incognita) and phytopathogenicfungi. Surprisingly, both proteins showed bi-functionaleffect, nematicidal and fungicidal activity in vitro assay. Thisrare nematicidal action was observed in other cationicpeptides from bacteria and pigs. The activity titration curvewill be drawn to determine the minimal concentration fornematicidal activity. EMBRAPA, Genetics Resources andBiotecnology; UCB, UNB, UFRGS, CAPES, CNPq

276 – EFEITO DE DOSES E MODOS DE APLICAÇÃO DE ACIBENZOLAR-S-METYL SOBRE Heteroderaglycines [EFFECT OF ACIBENZOLAR-S-METHYL DOSES AND APPLICATION METHODS ON Heteroderaglycines] Ferreira, C.S.1; Rezende Neto, U.R.1; Teixeira, R.A.1; Santos, L.C.1; Rocha, M.R.1; Araújo, F.G.1; Alves, T.G.1;Barbosa, K.A.G.1 1Universidade Federal de Goiás, Escola de Agronomia e Engenharia de Alimentos, C. P. 131, 74001-470Goiânia, GO, Brazil. E-mail: [email protected]

O nematóide H. glycines tem se mostrado um fator limitantena produtividade da cultura da soja infestada, sendo asmedidas de controle baseadas em rotação de culturas e usode cultivares resistentes. O acibenzolar-S-metyl é um indutorde resistência que tem se provado eficiente para algumasculturas, conferindo resistência a diversos patógenos. Oobjetivo do presente trabalho foi verificar o efeito de dosese modos de aplicação de acibenzolar-S-metyl sobre adensidade populacional de Heterodera glycines em plantas desoja (BRSGO Luziânia), em condições de casa de vegetação.Em delineamento inteiramente casualizado, em esquemafatorial 4 x 2, com cinco repetições, foram testados ostratamentos compostos pela combinação entre quatro doses

de acibenzolar-S-metyl (0; 1,25; 5 e 10 g/100 L) e duasformas de aplicação do produto (pulverização na parte aéreaou no solo). As sementes foram pré-germinadas em areia eno momento do transplantio foram inoculadas,depositando-se uma suspensão contendo 4.000 ovos maisJ2 nas raízes. Aos 7, 15 e 21 dias após a inoculação, foramrealizadas as pulverizações do acibenzolar-S-metyl, e aos30 dias foram feitas as avaliações do número de fêmeas, deovos por fêmea, de cistos e ovos por cisto. As doses deacibenzolar-S-metyl não exerceram influência sobre asvariáveis avaliadas, ao passo que a pulverização aéreapossibilitou a formação de menor número de ovos por cistoao se comparar à pulverização no solo.



419

277 – EFEITO DE TANINO NO CONTROLE DE Meloidogyne incognita [EFFECT OF TANNIN ON Meloidogyneincognita CONTROL] Mattos, R.M.1; Cosmo, D.A.1; Dias-Arieira, C.R.1; Puerari, H.H.1; Sassaki, T.C.1 Biela, F.1 1UniversidadeEstadual de Maringá, Campus Regional de Umuarama, C.P. 65, 87501-970 Umuarama, Paraná, Brazil. E-mail:[email protected]

Taninos são compostos fenólicos presentes emconcentrações relativamente altas, em diversas plantas.Apresenta sabor adstringente servindo como repelentecontra diversos insetos. Seu efeito bactericida também jáfoi comprovado. Contudo poucas são as informações arespeito do efeito destes compostos sobre os nematóidesfitopatogênicos. Assim, objetivou-se avaliar a atividadenematicida do tanino extraído de diferentes plantas nocontrole de Meloidogyne incognita em tomateiro. Ostratamentos consistiram em tanino, extraído de caqui, cocoverde, coco seco, chá verde e chá branco, extrato aquosode tiririca e água destilada, como testemunha. A extraçãodo tanino seguiu a metodologia proposta por Trugillho etal. (Cerne, 3:1-13, 1997) e o extrato de tiririca foi obtidopor trituração em liquidificador com água destilada. Mudasde tomateiro transplantada para vasos, com 15 dias degerminadas, foram inoculadas com 4000 ovos+juvenis

de M. incognita e, após três dias, foram tratadas com 10ml dos extratos concentrados, sendo o tratamentorepetido semanalmente, totalizando quatro aplicações.Após 30 e 60 dias as plantas foram coletadas e avaliadasquanto ao número de galhas e ovos por sistema radicular,peso fresco e seco da parte aérea e peso fresco da raiz.Os teores de tanino condensado na solução foram 22,6,22,8, 32,3, 12,8 e 22,7% para caqui, coco verde, chá verde,chá branco e coco seco, respectivamente. Após 30 dias,no tratamento com chá verde o número de galhas foisuperior ao observado para a testemunha, enquanto osdemais não diferiram estatisticamente da mesma. Aos60 dias também não houve controle significativo donematóide. Os tratamentos com chá verde, chá branco,coco verde, coco seco e tiririca promoveram aumentono peso seco e fresco da parte aérea e no peso fresco daraiz.

278 – EFEITO DO NÚMERO DE LÂMINAS DE IRRIGAÇÃO NA EFICIÊNCIA DE NEMATICIDAS EMCANA-DE-AÇÚCAR NO NORDESTE DO BRASIL [EFFECT OF NUMBER OF IRRIGATION BLADES ONEFFICIENCY OF NEMATICIDES ON SUGAR CANE IN THE NORTHEAST REGION OF BRAZIL] Novaretti,W.R.T.1; Guimarães, M.V.C.2; Silva, J.B.2 1ANNA, Laboratório de Nematologia, Rua Francisco Prestes Maia, 100, 13405098Piracicaba, SP, Brazil. 2Usina Estivas, C.P. 46, 59173000 Goianinha, RN, Brazil. E-mail: [email protected]

O volume de chuvas a que são submetidos os nematicidasutilizados em cana-de-açúcar é fundamental para a eficiênciado controle dos nematóides que prejudicam esta cultura.O produto Aldicarb, que tem alta solubilidade, 6.000 ppm,apresenta melhores resultados quando utilizado em épocassecas; enquanto que o produto Carbofuran, cuja solubilidadeé menor, 700 ppm, é mais eficiente quando aplicado nosmeses de maior precipitação pluviométrica. Entretanto, emcanaviais da Região Nordeste submetidos ao regime deirrigação, o comportamento desses nematicidas pode serdiferente. O objetivo deste experimento foi estudar o efeitode quatro regimes de irrigação: zero mm de água, 03 lâminasde 30 mm de água, 03 lâminas de 60 mm de água e 03lâminas de 90 mm de água na eficiência dos nematicidas

Aldicarb 150 a 10,0 e 12,0 kg/ha e Carbofuran 350 SC a5,0 e 7,0 L/ha de produto comercial. Os dados deprodutividade de cana em toneladas por hectare, nomomento da colheita revelaram que: a) na ausência deirrigação (zero mm), os melhores resultados foramalcançados com Aldicarb a 10,0 kg/ha; b) nos tratamentoscom 03 lâminas de 30 mm de água, não se observaramdiferenças entre os tratamentos nematicidas, mas todosresultaram em acréscimos de produtividade (13,0 t/ha,aproximadamente); c) nas maiores faixas de irrigação: 03lâminas de 60 mm e 03 lâminas de 90 mm de água, os melhoresvalores de produtividade foram assinalados com o produtocarbofuran 350 SC a 7,0 L/ha, com aumentos de produtividadede 11,13 e 13,47 t de cana, respectivamente.

420 Vol. 33(4) - 2009


279 – EFFICACY OF FUMIGANT AND NON FUMIGANT NEMATICIDES FOR THE MANAGEMENTOF Meloidogyne chitwoodi IN POTATO [EFICÁCIA DE NEMATICIDAS FUMIGANTE E NÃO FUMIGANTEPARA O CONTROLE DE Meloidogyne chitwoodi EM BATATA] Hafez, S.L.1; Sundararaj, P.1 1University of Idaho, ParmaResearch and Extension Center, 29603 U of I Ln, Parma, Idaho 83660, USA. E-mail: [email protected]

Two experiments were conducted at the University ofIdaho, Parma Research and Extension Center, Parma,Idaho, USA to study the efficacy of Telone II alone or incombination with Vapam HL or different combinations ofVapam HL, Temik 15G, Mocap 6EC, and Vydate C-LV forcontrol of Meloidogyne chitwoodi in potato. A silt loam withindigenous population of Columbia root-nematodes(Pretreatment nematode population 2500/500 cc soil) wasselected. The experiment was laid out in a randomizedcomplete block design with five and seven treatments andsix replications. Mocap treatments were surface broadcastusing a hand held sprayer. For the first experiment, in thefall, Telone II and Vapam were applied broadcast by ripperand fumigation bar to a depth of 16-18 and 8-10 inches,respectively. For the second experiment, Vapam was appliedbroadcast by fumigation bar. Temik was applied at planting

and Admire was applied in furrow at planting by using theCO2 powered plot sprayer, Vydate was applied in a three-inch band over each row with spray nozzles mounted behindthe planting shoe in front of the packing wheel. Foliarapplications of Vydate were made with a hand held CO2 plotsprayer. Potato cv. Russet Burbank seed pieces were planted inrows three feet apart. Five months after planting, the tuberswere harvested from 20 feet of the middle two rows of eachplot, and weighed, graded and evaluated for nematodeinfection. The percentage of nematode infected tubers weresignificantly reduced by the treatments compared to controlplots. Percentage of tubers with nematode infection in treatedplots ranged from 0.0 to 35.6. The lowest level of nematodeinfection was recorded in the Telone 15 g/A + Vapam 30 gal/A (0.0 %) and Mocap 2gal + Temik 20 lb + Vydate 2.2 pt (6.0%) for the first and second experiment respectively.

280 – EFFICACY OF NEMATICIDAL SEED TREATMENT AGAINST Meloidogyne javanica ON SOYBEANGlycine max IN FIELD AND GLASSHOUSE [EFICÁCIA DO TRATAMENTO DE SEMENTES COMNEMATICIDA NO CONTROLE DE Meloidigyne javanica EM SOJA, Glycine max, EM CAMPO E CASA DEVEGETAÇÃO] Lovato, B.V.1; Trafane, L.G.2; Ferreira, H.J.1; Aramaki, P.H.1; Martinho, L.1; Goes, R.1 1Syngenta CropProtection Ltda., Av. Nações Unidas, 18001, 04795-900 São Paulo, SP, Brazil; 2Unicampo Work of Cooperative ofAgronomy Professionals Ltda, Maringá, PR, Brazil. E-mail: [email protected]

Soybean is an important agricultural commodity worldwide,and Brazil is one of the largest soybean-producing countries.The root-knot nematode (Meloidogyne javanica and M.incognita) is a significant economic pathogen in manyproductive areas. The objective of this study was todetermine the efficiency of abamectin as a seed treatmentfor control of root-knot nematode (M. javanica) on soybean.Two experiments were conducted in a Brazilian SyngentaCrop Protection Field Station (glasshouse) and inUberlândia-MG, Brazil (field experiment). M. javanica-susceptible soybean was treated with 0.37; 0.5; 0.62 and0.75 g of abamectin (Avicta® 500 FS) per kilogram of seeds.All treatments received 70 g of thiamethoxam (Cruiser®

350 FS) and 2.5 g of fludioxonil and 1 g of metalaxyl-m(Maxim® XL) per kilogram of seeds, using the plastic bagmethod. For glasshouse trial pots with 1 L of sterilized soilwere inoculated with 3500 M. javanica (eggs+juveniles) andthen soybean seeds were sowed according to the treatments.Height, fresh mass and nematode penetration were assessed15 days after emergence (DAE) and number of egg masses,reproduction factor and number of galls were assessed 50DAE. The experiment was planted in a fully randomized

design with each treatment replicated eight times perassessment date. For field trial, the nematode distributionwas assessed by a previous sampling. For this, beforeplanting all replications were distributed and four soil sub-samples were taken per replicate. The samples were sent tothe nematological laboratory to quantify nematodes in eachreplicate. After this, the replications were classified on fourlevels: 0 (absent); 0.2-1 (low); 1-2 (medium) and >2 M.javanica/cc soil (high level). All treatments were sowed infive replicates (2 high, 2 medium and 1 low nematode level).Number of nematodes in the roots, root-galling severity,crop canopy and yield were assessed. The experiment wasa randomized complete block design. The glasshouse resultsshow all abamectin doses reduced 78-99% of nematodeinfection until 15 DAE and 75-82% until 50 DAE. Height,number of egg mass and reproduction factor of allabamectin doses differed from the untreated plants.However, fresh mass did not differ from the untreatedplants. The field results show 0.62 and 0.75 g of abamectin/Kg protect the roots (53-61%) until 20 DAE under naturalconditions. These same doses reduce root-galling severityand increase crop canopy and yield (15-22%). The results



421

show that abamectin (Avicta® 500 FS) at 0.62 and 0.75 g ofabamectin/Kg applied over the seeds protect roots against

root-knot nematode and may be used as an effectivemanagement tool against this nematode on soybean crop.

281 – EFFICACY OF NEMATICIDE ABAMECTIN (AVICTA® 500 FS) AGAINST Rotylenchulus reniformisON COTTON Gossypium hirsutum THROUGH SEED TREATMENT [EFICÁCIA DO NEMATICIDAABAMECTINA (AVICTA ® 500 FS) NO CONTROLE DE Rotylenchulus reniformis EM ALGODOEIRO Gossypium hirsutumATRAVÉS DO TRATAMENTO DA SEMENTES] Lovato, B.V.1; Trafane, L.G.2; Ferreira, H.J.1; Aramaki, P.H.1; Martinho,L.1; Goes, R. 1 1Syngenta Crop Protection Ltda., Av. Nações Unidas, 18001, 04795-900 São Paulo, SP, Brazil; 2UnicampoCooperative of Agronomy Professionals Ltda, Maringá, PR, Brazil. E-mail: [email protected]

Cotton crop (Gossypium hirsutum L.) is widely grown inBrazilian agriculture, due to its importance for the textileindustry. This crop is causing drastic alterations in fieldmanagement, including nematode management. One ofthese nematodes is R. reniformis, which can attack more than140 vegetable species, among them 56 agricultural crops.The management of this and other nematodes can be donewith crop rotation; however, this practice frequently facesgreat resistance from farmers. Thus, an effective earlynematode control through seed treatment, target of thiswork, can be a tool for nematode management. Anexperiment was carried out in the Brazilian Syngenta FieldStation (Holambra-SP) under glasshouse conditions toassess the efficiency of Abamectin through seed treatmentfor early nematode control (Rotylenchulus reniformis) oncotton. For this, cotton seeds were treated with 300 ml ofAvicta® 500 FS per 100 kg of seeds (150 g of Abamectinper 100 Kg of seeds) in three population levels of R.reniformis (0; 3,000 and 6,000 eggs + juveniles per plant).Abamectin treatment was compared with Aldicarb (Temik®

150) applied in the planting furrow at 12 Kg per hectare.The seeds still received in all treatments 70 g ofThiamethoxam (Cruiser® 350 FS) and 2.5 g of Fludioxoniland 1 g of Metalaxyl-m (Maxim® XL) per kilogram of seeds.The seed treatment was done using the plastic bag method.For the planting of the cotton seeds (Variety FiberMax 966),plastic pots were used with capacity for 1 L of sterilizedsoil. The nematode inoculations were done at theplanting date. Two assessments were used: height at 18,30 and 45 days after the inoculation (DAI) andpenetration at 18 DAI. For this assessment, roots werecolored by Floxin B method (Taylor & Sasser, 1978) andevaluated under a stereoscope. The results showed thatAbamectin (Avicta® 500 FS) reduced 81-85% of earlynematode penetration, in both nematode levels, beingbetter than Aldicarb, which reduced penetration byaround 40%. The present results agree with Monfort et.al. (2006), who tested Avicta against Meloidogyne incognitaon cotton. Significant height difference and phytotoxicityamong treatments was not observed.

282 – EFICIÊNCIA DO TRATAMENTO DE SEMENTES DE ALGODOEIRO NO MANEJO DE Meloidogyneincognita RAÇA 4 [EFFICIENCY OF COTTON SEED TREATMENT IN THE MANAGEMENT OF Meloidogyneincognita RACE 4] Amorim, L.D.¹; Calábria, Z.K.P¹.; Silva, R.A.¹ Chitarra, L.G.² ¹Agronomia, UNIVAG, Av. Dom OrlandoChaves, 2655, Cristo Rei, 78118-000 Várzea Grande, MT, Brazil; ²EMBRAPA, CNPA, Alameda Aníbal Molina, S/N,Ponte Velha, 78115-901 Várzea Grande, MT, Brazil. E-mail: [email protected]

O nematóide Meloidogyne incognita, tem sido responsável porperdas significativas na cultura do algodoeiro no estado deMato Grosso. Nesse sentido, uma das ferramentaspromissoras no manejo do patógeno é o tratamento dassementes com nematicidas. Portanto, o objetivo do trabalhofoi avaliar a eficiência de produtos no tratamento desementes de algodoeiro da cultivar Fibermax 966, visandoo manejo de Meloidogyne incognita raça 4. O experimento foiconduzido em telado de sombrite 50% no CampoExperimental do UNIVAG, Várzea Grande, MT, emdelineamento experimental inteiramente casualizado, comseis tratamentos e quatro repetições. Os tratamentos foram:1 – testemunha (sementes não tratadas); 2 – Avicta +Crusier; 3 – Avicta + Dynasty + Crusier; 4 – Dynasty +

Crusier; 5 – Euparem + Monocerem + Baytan + Gaucho e6 – Furadan + Vitavax + Thiran. Foi utilizado 1200 juvenise ovos de M. incognita por recipiente obtidos de raízes detomateiro misturado com solo, após duas semanas emrepouso. As raízes das plantas de algodoeiro foramprocessadas após 65 dias da semeadura e os nematóidesquantificados em lâmina de Peters sob microscópio óptico.O tratamento 3 permitiu menor fator de reprodução donematóide (1,21) e os tratamentos 2 (2,0); 5 (2,41); 1 (3,23)e 6 (3,71) não diferiram estatisticamente. O tratamento 4(5,38) possibilitou maior fator de reprodução. Portanto emsementes de algodoeiro, o tratamento comAvicta+Dynasty+Crusier pode ser uma alternativa eficientepara o manejo de Meloidogyne incognita raça 4.

422 Vol. 33(4) - 2009


283 – EVALUATION OF CHEMICAL AND BIOLOGICAL NEMATICIDES FOR THE MANAGEMENTOF Pratylenchus thornei ON POTATO [AVALIAÇÃO DE NEMATICIDAS QUÍMICOS E BIOLÓGICOS NOCONTROLE DE Pratylenchus thornei EM BATATA] Hafez, S.L.1; Sundararaj, P.1 1University of Idaho, Parma Research andExtension Center, 29603 U of I Ln, Parma, Idaho 83660, USA. E-mail: [email protected]

Two field experiments were conducted at the Universityof Idaho, Parma Research and Extension Center, Parma,Idaho, USA to study the efficacy of Vapam HL, Temik15G, and Admire Pro Systemic and SYT-100 for controlof lesion nematode Pratylenchus thornei in potato. Bothexperiments were laid out in a randomized complete blockdesign with five treatments, each with five replications, in asilt loam field. Soil samples were collected before treatmentand nematodes were extracted (pre plant P.thornei population2580/500 cc soil). Potato cv. Russet Burbank seed pieceswere planted on 29th April in rows three feet apart. Weedingand other standard crop management practices werefollowed. Four weeks after planting soil samples were taken,nematode population was analyzed and percentagereduction from the initial population was calculated. Fourmonths after planting on 29th August vine health rating was

recorded. Five months after planting, the tubers wereharvested on 19th September from 15 feet of the middletwo rows of each plot and weighed. The tubers were graded;total and saleable yield were recorded. In the firstexperiment, there was an increase in total yield and saleableyield due to treatments as compared to control plot.Percentage increase of saleable yield in treated plots rangedfrom 9.6 to 20.3. Maximum percentage reduction ofnematode population was in the Vapam treated plots (91.1)with the highest total yield (645.7 cwt/A) and saleable yield(515.2 cwt/A). In the second experiment, percentageincrease of saleable yield in treated plots ranged from 11.3to 19.9. Maximum percentage reduction of nematodepopulation was in the SYT-100 treated plots (47.8) withthe highest total yield (626.3 cwt/A) and saleable yield (492.6cwt/A).

284 – MANAGEMENT OF Meloidogyne mayaguensis IN COMMERCIAL GUAVA ORCHARDS WITHCHEMICAL FERTILIZATION AND ORGANIC AMENDMENTS [MANEJO DE Meloidogyne mayaguensis EMPOMARES COMERCIAIS DE GOIABEIRA COM FERTILIZAÇÃO QUÍMICA E ORGÂNICA] Gomes, V.M.1; Souza,R.M.1; Corrêa, F.M.2; Dolinski, C.1 1Universidade Estadual do Norte Fluminense Darcy Ribeiro, CCTA, LEF. Av. AlbertoLamego, 2000, 28015-620 Campos dos Goytacazes, RJ, Brazil; 2Universidade Federal de Lavras, Departamento de Estatísticae Experimentação Agropecuária, Lavras, MG, Brazil. E-mail: [email protected]

In an effort to devise strategies to sustain guava productionin the large Brazilian areas infested by M. mayaguensis, fivetreatments that combined chemical fertilization and organicsoil amendments were assessed in a two-year experimentconducted in two locations: i) a newly planted orchard withlight M. mayaguensis infestation, and ii) a mature, heavilyinfested, declining orchard. One of the treatmentsrepresented the routine practices of local growers: hand-spread soil and foliar fertilizations without previous fertilityanalysis, coupled with applications of cow manure (30 Kg/tree) in a single spot under the tree canopy, twice a year.The remaining four treatments combined monthly soil andfoliar fertilizations according to previous fertility analysis,coupled with quarterly applications of cow manure (appliedeither locally or uniformly under the canopy), sugarcanefilter cake or poultry compost (these applied uniformlyunder the canopy). These amendments were applied at 20or 40 Kg/tree in the young and mature orchards,

respectively. The following variables were assessed duringthe experiment: nematode J2/100 cm3 of soil, root galls/10 g of roots, root galls and mass per auger sampling (~500cm3 of soil), productivity in two harvests and fruit quality(oBrix and diameter). An economic analysis was conductedfor each treatment considering the gross profit and the costsof guava production and of the different organicamendments. The poultry compost and the cow manureapplied uniformly under the canopy provided the highestnematode suppression and productivity. The economicanalysis indicated that it is not worthwhile managingguava orchards which are heavily infested by M.mayaguensis. On the other hand, it indicated that it isfeasible and profitable to manage moderately infestedorchards with proper chemical fertilization coupled withapplications of organic soil amendments, particularlypoultry compost and cow manure spread uniformlyunder the canopy.



423

285 – EFEITO DE DOSES DE SILICATO DE POTÁSSIO APLICADO NA SEMEADURA DA SOJA NOCONTROLE DE Meloidogyne incognita EM TUBO DE ENSAIO [EFFECT OF DOSES OF POTASSIUMSILICATES APPLIED AT SOYBEAN SEEDTIME TO CONTROL Meloidogyne incognita IN TEST TUBES] Freire,E.S.1; Carli, M.C.¹; Toyota, M.¹; Faria, M.R.¹; Campos, V.P.¹; Oliveira M.S.¹ ¹Laboratório de Nematologia, Área deFitopatologia, DFP, UFLA, C. P. 3037, 37200-000 Lavras, MG, Brazil. E-mail: [email protected]

A cultura da soja [Glycine Max (L.) Merril] é uma das maisimportantes na agricultura brasileira, contudo, esta culturavem sofrendo graves prejuízos devido ao ataque denematóides em todo o Brasil. Dessa forma, objetivou-seestudar o efeito de doses de silicato de potássio (SiK) nocontrole de Meloidogyne incognita em soja. Soluções de SiKnas concentrações de 0, 0,8, 1,6 ou 3,2 mL por litro deágua foram aplicadas em tubos de ensaio contendo 45 g deareia. Sementes de soja cv. Doko foram semeadas nessestubos e foram incubados, por três dias, em fotoperíodo de12 horas, 80% de umidade e temperatura de 28ºC. Para aobtenção do inóculo, utilizaram-se ovos de M. incognitaextraídos de tomateiros, cultivados em casa de vegetação.Em seguida, os ovos foram colocados em câmara de eclosãoa 28ºC. Coletaram-se os juvenis do segundo estádio (J2),eclodidos entre 48 e 72 horas para utilização no ensaio.

Cento e cinqüenta J2 de M. incognita foram inoculados porplântula de soja três dias após a semeadura. Os tubos foramorganizados em delineamento inteiramente casualizados comoito repetições por tratamento. Aos oito dias após a inoculação,coletaram-se quatro plântulas de cada tratamento e suas raízesforam lavadas em água parada e coloridas para contagem dosJ2 no interior das raízes de soja. Aos 21 dias após a inoculação,foram colhidas as plantas dos demais tubos de cada tratamento.As raízes foram cortadas em pedaços de 0,5 cm e foramextraídos os ovos. A penetração de J2 de M. incognita não foiafetada pelo SiK quando comparada com a testemunha.Entretanto, a reprodução de M. incognita, expressa em númerode ovos por sistema radicular, decresceu com o aumento dadose de SiK, chegando a reduzir em 90% na maior dose (3,2mL.dm-3) quando comparada com a testemunha. APOIO:Fapemig e CNPq.

286 – EFEITO DE DOSES DE SILICATO DE CÁLCIO E POTÁSSIO NO CONTROLE DE Heteroderaglycines EM SOJA EM CASA DE VEGETAÇÃO [EFFECT OF DOSES OF CALCIUM AND POTASSIUMSILICATES ON THE CONTROL OF Heterodera glycines ON SOYBEAN IN GREENHOUSE] Campos, V.P.¹; Freire,E.S.¹; Faria, M.R.¹; Silva, E.H.S.¹; Oliveira, M.S.¹ ¹Laboratório de Nematologia, Área de Fitopatologia, DFP, UFLA, C. P.3037, 37200-000 Lavras, MG, Brazil. E-mail: [email protected]

Apesar de não constituir elemento essencial para ocrescimento vegetal, o silício tem sido estudado no controlede muitas doenças e sua eficácia ainda precisa ser investigadano controle de fitonematóides. Diante disso, objetivou-seestudar o efeito de doses de silicato de cálcio (SiCa) epotássio (SiK) no controle de Heterodera glycines em soja.Sementes de soja foram plantadas em bandejas de isoporcom substrato agrícola contendo as seguintes doses de SiK:0, 0,8, 1,6 ou 3,2 mL.dm-3 ou de SiCa: 0, 1,0, 2,0 ou 4,0g.dm3 de substrato. Após uma semana, cada muda foitransplantada para vasos de barro com quatro repetiçõespor tratamento. Quatro dias depois do transplantio, asplantas foram inoculadas com 500 J2 de H. glycines emantidas em casa de vegetação. Aos quarenta dias apósa inoculação, realizou-se a contagem de ovos dosomatório do número de cistos, fêmeas e de ovo/cistomais fêmeas por sistema radicular, além do número de

cistos e ovos dos cistos encontrados no solo. O númerototal de cistos e fêmeas por sistema radicular da sojadecresceu com as aplicações de 0,8 e 1,6 mL de SiK pordm-3 de substrato. Contudo, quando se aplicou a dose3,2 mL.dm-3 o número de cisto não diferiu da testemunha(0). Nenhuma dosagem aplicada de SiCa reduziu onúmero de cisto e fêmeas por sistema radicular da soja.A aplicação de SiCa e SiK reduziu o número de ovospor cisto mais fêmeas de H. glycines do sistema radicular.Contudo, as doses 4,0g de SiCa e 3,2mL de SiK nãoreduziram o número de ovos por sistema radicular,quando comparadas com a testemunha. As doses quepromoveram maior redução no número de ovos/sistemaradicular foram 1,90 g de SiCa e 1,20 mL de SiK.Também o número de ovos por cisto de H. glycinesextraídos do solo decresceu com as aplicações de SiCa eSiK. APOIO: Fapemig e CNPq.

424 Vol. 33(4) - 2009


287 – EFFICACY OF SYSTEMIC AND NON SYSTEMIC NEMATICIDES IN THE MANAGEMENT OFLESION NEMATODE Pratylenchus penetrans ON POTATO [EFICÁCIA DOS NEMATICIDAS SISTÊMICOSE NÃO SISTÊMICOS NO MANEJO DE Pratylenchu penetrans EM BATATA] Hafez, S.L.1; Sundararaj, P.1 1Universityof Idaho, Parma Research and Extension Center, 29603 U of I Ln, Parma, Idaho 83660, USA. E-mail: [email protected]

Systemic and non-systemic nematicides were tested tocontrol lesion nematode on potato at the University ofIdaho, Parma Research and Extension Center, Parma,Idaho, USA. Nematicides tested were Vydate L, Temik 15Gand Mocap EC. A silt loam field with an indigenouspopulation of lesion nematodes (pre-treatment nematodepopulation of 3500/500 cc soil) was selected. Twoexperiments were laid out in a randomized complete blockdesign with five and four treatments and six replications.Temik 15G was applied in a 4-6 inch band at planting infront of the planter shoe. Vydate C-LV was applied on thesoil surface using a handheld sprayer followed by a shortirrigation. This chemical was applied in a similar mannertwo times before row closure and two weeks after. Potatocv. Russet Burbank seed pieces were planted in rows threefeet apart. Plant protection practices, weeding and other

normal crop management practices were followed. Fivemonths after planting, the tubers were harvested from 15feet of the middle two rows of each plot and weighed. Inthe first experiment, maximum reduction in nematodepopulation from the untreated control was with Mocap +Temik treatments followed by Temik + Vydate combinatuin.In the second experiment the total yield was significantlyincreased by all Vydate and Temik treatments compared tothe control plots. In both experiments, there was no increasein saleable yield in different combinations of all treatmentscompared to the control plots. Maximum reduction ofnematode population from the untreated control was withTemik application followed by Vydate applied before rowclosure and two applications at 14 days interval. Inconclusion, suppression of P.neglectus populationsignificantly increased the potato yield.

288 – CHEMICAL MANAGEMENT OF Meloidogyne chitwoodi ON POTATO IN IDAHO, USA [MANEJOQUÍMICO DE Meloidogyne chitwoodi EM BATATA EM IDAHO, E.U.A.] Hafez, S.L.1; Sundararaj, P.1 1University of Idaho,Parma Research and Extension Center, 29603 U of I Ln, Parma, Idaho 83660, USA. E-mail: [email protected]

Experiments were conducted at the University of Idaho,Parma Research and Extension Center, Parma, Idaho, USAto study the efficacy of Telone II or Vydate CLV alone orTelone II in combination with Vapam HL or differentapplication methods of fosthiazate for control of Meloidogynechitwoodi in potato. Both experiments were laid out in arandomized complete block design with five and sixtreatments and six replications in a sandy loam field. In theprevious fall, Telone II and Vapam were applied broadcastby ripper and fumigation bar to a depth of 16-18" and 8-10" respectively. Vydate was applied at planting andchemigated six times at two-week intervals. Preplanttreatments of fosthiazate were broadcast sprayed to deliver27 gal/acre or shanked at 6 inch deep or shanked followedby rototilling or broadcast surface spray with the nozzlesattached to the front of the rototiller. Potato seed pieceswere machine planted at 10" drop spacing. Plant protectionpractices, weeding and other standard crop management

practices were followed. Potatoes from the central 25 feetof the center two rows from each plot were mechanicallyharvested and graded for size and inspected for symptomsof nematode infection. In the first experiment there wasan increase in total yield in different combinations ofall treatments compared to the control plots. Percentageof infected tubers in treated plots ranged from 0.9 to30.5. Lowest level of nematode infection was recordedin the Telone 15 g/A + Vapam 30 gal/A compared toother treatments. In the second experiment differentapplication methods of Fosthiozate indicated thatpercentage of tubers with nematode infection in treatedplots ranged from 5.6 to 35.5. Lowest level of nematodeinfected tubers was observed in Fosthiazate 4.5 ai/ATemik 20lbs at planting (5.6 %) applied plots. This studyindicated that application of fosthiazate by standardbroadcast surface method is more effective than theshank injection.



425

289 – EFFECT OF VOLATILE ORGANIC SUBSTANCES ON THE METABOLIC PRODUCTION ANDRESISTANCE OF Phaseolus vulgaris TO THE ROOT-KNOT NEMATODE Meloidogyne incognita [EFEITODE SUBSTÂNCIAS ORGÂNICAS VOLÁTEIS NA PRODUÇÃO METABÓLITA E NA RESISTÊNCA DE Phaseolusvulgaris AO NEMATÓIDE DAS GALHAS Meloidogyne incognita] Machado, A.R.T.1; Campos, V.A.C.1; Chagas, R.C.R.1;Oliveira, D.F.1; Campos, V.P.2 1Laboratório de Produtos Naturais, Universidade Federal de Lavras, C. P. 3037, 37200-000Lavras, MG, Brazil; 2Laboratório de Nematologia, Universidade Federal de Lavras, C.P. 3037, 37200-000 Lavras, MG,Brazil. E-mail: [email protected]

In order to contribute to the development of new methodsto control plant-parasitic nematodes, this work aimed toevaluate the effect of volatile organic substances (VOS) onthe resistance of Phaseolus vulgaris to Meloidogyne incognita.Consequently, solutions containing the followingcombinations of VOS were applied to the aerial part ofplants: jasmone+ methyl jasmonate; (Z)-hex-3-en-1-ol +(E)-hex-3-en-1-ol + (Z)-hex-2-en-1-ol + (E)-hex-2-enal;(E)-2-hexenyl acetate+ hexyl acetate; meso-2,3-butanediol+ 1,2-butanediol +1,3-butanediol + 1,4-butanediol; 3-hydroxy-2-butanone + 4-hydroxy-2-butanone; and linalylacetate + nerolidol. Each substance was used at 0.5 mM,since at higher concentrations they were toxic in vitro toM. incognita second-stage juveniles (J2). Although all

solutions caused variations in the amounts of alkaloids,free amino acids, soluble carbohydrates or phenols inthe roots, only those plants treated with a combinationof linalyl acetate and nerolidol afforded number ofnematode eggs statistically lower than the one observedfor the control. Apparently, such a reduction, whichamounted to 40 %, was due to the production ofnematicidal substances by plants treated with linalylacetate and nerolidol, since the corresponding rootextract caused 45 % more in vitro J2 death than the otherplant extracts. This is the first time the potential of theabove-mentioned VOS for nematode control has beendemonstrated. SUPPORTED BY: Fapemig, CNPq andCapes.

290 – EVALUATION OF DIFFERENT METHODS OF APPLICATION OF OXAMYL IN THE CONTROLOF Meloidogyne exigua ON FIVE–YEAR-OLD COFFEE [AVALIAÇÃO DE DIFERENTES MÉTODOS DEAPLICAÇÃO DE OXAMIL NO CONTROLE DE Meloidogyne exigua EM CAFEEIRO COM 5 ANOS] Soares, P.L.M.1;Gonring, A.H.R.2; Ferreira, R.J.4; Santos, J.M.3 1,3UNESP, FCAV, Câmpus de Jaboticabal, Departamento de Fitossanidade,Laboratório de Nematologia; 2,4Desenvolvimento DuPont do Brasil, Paulínia, SP, Brazil; 1Faculdade de Educação SãoLuis, Jaboticabal, SP, Brazil. E-mail: [email protected]

Coffee crops record significant average annual lossesworldwide, due to the presence of nematodes. Aiming tomitigate the losses caused by these pests, the effectivenessof different methods of application of Oxamyl (Vydate ®L) was evaluated in the period February to June of 2008for the control of Meloidogyne exigua in a commercialcultivation area of five-year-old coffee “Obatã” inAltinópolis-SP. The treatments were Oxamyl (Vydate L 20mL of the commercial product (cp)/plant), applied in pureform on the trunk, by Spot Gun (wetting the trunk); thesame dose, diluted in water, as Drench (jet) on the neck ofthe plant; application of dose diluted in water as Furrow(tracks on both sides of the plant, in the direction of thelines in the projection of the crown) and applying the samedose diluted in water in the form of Drip (dripping, onboth sides of the plant); Aldicarb (Temik ® 150 GR 20 g

cp/ plant, as standard treatment) and control (without anytreatment). The experimental plot was composed of fiveplants, where all were treated and only three plants wereused as a floor area of the plot. The experimental designwas a randomized block design with six treatments and fivereplications. The evaluations consisted of measurementsof changes in the nematode population in soil and rootsbefore the application of treatments and at 30, 60, 90 and120 days after application, compared to control. On 22/02/2008 a preliminary sampling of soil and roots took place,followed by the application of different treatments. Underthe conditions of this study, both the soil and roots, VydateL (20 mL cp/plant), applied in a single dose in differentways (Spot Gun, Drench, Furrow and Drip) and thestandard (Temik 20 g cp/plant) had averages over 80% ofcontrol of M. exigua, at least in one of the periods evaluated.

426 Vol. 33(4) - 2009


291 – EFFICACY OF DOSES AND APPLICATION METHODS OF OXAMYL ON THE CONTROL OFMeloidogyne exigua ON FIVE-YEAR-OLD COFFEE PLANTS [EFICÁCIA DE DOSES E MÉTODOS DEAPLICAÇÃO DE OXAMIL NO CONTROLE DE Meloidogyne exigua EM CAFEEIROS COM 5 ANOS] Soares, P.L.M.1;Gonring, A.H.R.2; Ferreira, R.J.2; Santos, J.M.1,3 1UNESP,FCAV, Câmpus de Jaboticabal, Departamento de Fitossanidade,Laboratório de Nematologia; 2Desenvolvimento DuPont do Brasil, Paulínia, SP, Brazil; 3Faculdade de Educação São Luis,Jaboticabal, SP, Brazil. E-mail: [email protected]

Nematodes are responsible for significant losses in theaverage annual coffee crop worldwide. Aiming to mitigatethese losses, from December 2007 to June 2008 theeffectiveness of different doses and methods of applicationof Oxamyl (Vydate ® L) it was evaluated in the control ofMeloidogyne exigua in an area of commercial cultivation offive-year-old “Obatã” coffee plants in Altinópolis-SP. Thetreatments were Oxamyl (Vydate L) at doses of 5 mL ofthe commercial product (cp)/plant (Trat. 1), 7.5 mL cp/plant (Trat. 2) and 10 mL cp/plant (Trat. 3), applied bySpot Gun (application of pure commercial product in theform of splash for wetting the trunk). Treatments 4, 5 and6 corresponded to the same doses applied via Drench(splash at the base of the plant). Treatments 7, 8 and 9correspond to the same doses applied via Furrow(commercial product diluted with water and applied inbands under the skirt of the coffee towards the line ofplanting). Treatments 10, 11 and 12 also correspond to thesame dose diluted in water and applied as a Drip (simulationof drips on the projection of the exit of coffee, in theline). Treatment 13, considered standard, was Aldicarb(Temik ® GR 150 at the dose 20 g cp/plant) and treatment14 was the control without any treatment. The experimental

plot was composed of five plants, where all were treated,but only three plants were used for evaluations. Theexperimental design was a randomized block with 14treatments and five replications. We evaluated the nematodepopulation in the soil and roots, before application oftreatments and at 30, 60, 90 and 120 days after application.A preliminary sampling of soil and roots took place on17/12/2007, followed by the application of differenttreatments. The second application was given about 60 daysafter the first. For the standard treatment, the applicationwas performed just once. Six months after first application,the production was also evaluated. Under the conditionsof this study, in both the soil and roots, all the treatmentsevaluated with Temik (standard) and Vydate L had averagesof over 80% control of M. exigua, in at least one of theperiods. Treatments 1 and 3 (Vydate L 5 and 10 mL cp/plant, respectively - Spot Gun), 6 (Vydate L 10 mL cp/plant - Drench), 7 (Vydate L 5 mL cp/plant - Furrow), 10and 12 (Vydate L 5 and 10 mL cp/plant, respectively - Drip),provided the highest average of 6.48, 7.69, 5.42, 4.28, 11.94and 14.92% increase in production, respectively, higher thanstandard treatment 13 (Temik ® 150 GR 20 g cp/plant) of4.10%, compared to the control without any treatment.

292 – EFFICACY OF DOSES AND APPLICATION METHODS OF OXAMYL ON THE CONTROL OFMeloidogyne exigua ON 25-YEAR-OLD COFFEE PLANTS [EFICÁCIA DE DOSES E MÉTODOS DEAPLICAÇÃO DE OXAMIL NO CONTROLE DE Meloidogyne exigua EM CAFEEIRO COM 25 ANOS] Soares, P.L.M.1;Gonring, A.H.R.2; Ferreira, R.J.2; Santos, J.M.1,3 1UNESP, FCAV, Câmpus de Jaboticabal, Departamento de Fitossanidade,Laboratório de Nematologia; 2Desenvolvimento DuPont do Brasil, Paulínia, SP, Brazil; 3Faculdade de Educação São Luis,Jaboticabal, SP, Brazil. E-mail: [email protected]

Nematodes are responsible for significant losses in theaverage annual coffee crop in all producing regions of theworld. Aiming to mitigate these losses, from December 2007to June 2008 the efficacy of doses and methods ofapplication of Oxamyl (Vydate ® L) was evaluated in thecontrol of Meloidogyne exigua in an area of commercialcultivation of 25-year-old recently pruned coffee plants, inAltinópolis-SP. The treatments were Oxamyl (Vydate L) atdoses of 5 mL of the commercial product (cp)/plant (Trat.1), 7.5 mL cp/plant (Trat. 2) and 10 mL cp/plant (Trat. 3),applied by Spot Gun (application of pure commercialproduct in the form of splash for wetting the trunk).Treatments 4, 5 and 6 corresponded to the same doses

applied via Drench (splash at the base of the plant).Treatments 7, 8 and 9 correspond to those doses appliedvia Furrow (commercial product diluted with water andapplied in bands under the skirt of coffee towards the lineof planting). Treatments 10, 11 and 12 also correspond tothe same dose diluted in water and applied as a Drip(simulation of drips on the projection of the exit of coffee,in the line). Treatment 13, considered standard, was Aldicarb(Temik ® GR 150 at the dose 20 g cp/plant) and treatment14 was the control without any treatment. The experimentalplot was composed of four holes with two plants each,where only two holes (four plants) were treated and usedfor evaluations. The experimental design was a randomized



427

block with 14 treatments and five replications. We evaluatedthe nematode population in the soil and roots, beforeapplication of treatments and at 30, 60, 90 and 120 daysafter application. Preliminary sampling of soil and rootstook place on 17/12/2007 and then there were applicationsof different treatments. About 60 days after the firstapplication the second application was carried out. For thestandard treatment, only the first application wasperformed. Six months after the first application, theproduction was evaluated. In both the soil and roots, allthe doses and methods of application of Oxamyl (Vydate

L) and Aldicarb (Temik 150 GR) provided on average over80% control of M. exigua in at least one of the periods.Treatments 3 (Vydate L 10 mL cp/plant - Spot Gun), 4and 6 (Vydate L 5 and 10 mL cp/plant, respectively -Drench) 7 (Vydate L 5 mL cp/plant - Furrow) 11 and 12(Vydate L 7.5 and 10 mL cp/plant, respectively - Drip),provided the greatest means of production, correspondingto 40, 39, 30, 66, 61 and 37% increase in production, overthe control without any treatment, respectively, and higherthan the standard treatment 13 (Temik 150 GR 20 g cp/plant) with 29% of increase.

293 – EFFICACY OF DOSES AND APPLICATION METHODS OF OXAMYL ON THE CONTROL OFMeloidogyne exigua ON YOUNG COFFEE PLANTS [EFICÁCIA DE DOSES E MÉTODOS DE APLICAÇÃODE OXAMIL NO CONTROLE DE Meloidogyne exigua EM CAFEEIROS JOVENS] Soares, P.L.M.1; Gonring, A.H.R.2;Ferreira, R.J.2; Santos, J.M.1,3 1UNESP/FCAV, Câmpus de Jaboticabal, 2Departamento de Fitossanidade, Laboratório deNematologia; Desenvolvimento DuPont do Brasil, Paulínia, SP, Brazil; 3Faculdade de Educação São Luis, Jaboticabal , SP,Brazil. E-mail: [email protected]

Nematodes are among the major pests of coffee in allproducing regions of the world. Aiming to mitigate thelosses caused by these pests doses and methods ofapplication of oxamyl (Vydate ® L) were evaluated in thecontrol of Meloidogyne exigua in the period of December2007 to April 2008 in an area of commercial cultivation ofcoffee ‘Catuaí Vermelho’, newly transplanted in Altinópolis-SP. The experiment was installed in an area previouslycultivated with coffee and where there is history ofoccurrence of nematodes. The treatments were Oxamyl(Vydate L) at doses of 5 mL of the commercial product(cp)/plant (Trat. 1), 7.5 mL cp/plant (Trat. 2) and 10 mLcp/plant (Trat. 3 ), applied by Spot Gun (application ofpure commercial product in the form of splash for wettingthe trunk). Treatments 4, 5 and 6 corresponded to the samedoses applied by Drench (splash at the base of the plant).Treatments 7, 8 and 9 correspond to those doses appliedby Furrow (commercial product diluted with water andapplied in strips to the side of the plants towards the lineof planting). Treatments 10, 11 and 12 also correspond tothe same dose diluted in water and applied as a Drip(simulation of drips towards the line of planting). Treatment13, considered standard, was Aldicarb (Temik ® GR 150,at a dose of 20 g cp/plant, considered the standard

treatment) and treatment 14 was the control without anytreatment. The experimental plot was composed of fiveplants, where all were treated, but only three plants wereused for evaluations. The experimental design was arandomized block with 14 treatments and five replications.On 17/12/2007 a preliminary sampling of soil took place.Then there was an application of different treatments.About 60 days after the first application the secondapplication was done. For the standard treatment, theapplication was performed just once at the time of the firstapplication. We evaluated the population of the nematodein the soil before the application of treatments, and at 30,90 and 120 days after the first application. Roots wereevaluated only for 120 days. In the last sampling of soil,plants were evaluated in height, stem diameter, the neckand the number of branches. The different doses of VydateL applied by Spot Gun, Drench, Furrow or Drip on twoapplications, as well as the standard treatment 13 (Aldicarb150 GR 20 g cp/plant), showed efficiency of control ofM. exigua in the rhizosphere soil. These treatments favoredthe increase in numbers of branches. Treatments 4 and 6(Vydate L 5 and 10 mL cp/plant, respectively) applied byDrench, provided the highest mean height and stemdiameter of the neck of the plants.

428 Vol. 33(4) - 2009


294 – EFFICACY OF DOSES AND APPLICATION METHODS OF OXAMYL IN THE CONTROL OFTylenchulus semipenetrans ON YOUNG CITRUS PLANTS [EFICÁCIA DE DOSES E MÉTODOS DEAPLICAÇÃO DE OXAMIL NO CONTROLE DE Tylenchulus semipenetrans EM PLANTAS JOVENS DE CITROS]Soares, P.L.M.1; Gonring, A.H.R.2; Ferreira, R.J.2; Santos, J.M.1,3 1UNESP/FCAV, Câmpus de Jaboticabal; 2Departamentode Fitossanidade, Laboratório de Nematologia; Desenvolvimento DuPont do Brasil, Paulínia, SP, Brazil; 3Faculdade deEducação São Luis, Jaboticabal, SP, Brazil. E-mail: [email protected]

Among the various pests and diseases that occur in thecitrus crop, nematodes are responsible for average annuallosses of 14.2% worldwide. In the state of São Paulo thecitrus nematode (Tylenchulus semipenetrans) is present in morethan 75% of the orchards. In the period January to May of2008 an experiment was conducted with the objective ofevaluating the efficacy of doses and methods of applicationof Oxamyl (Vydate ® L) in control of Tylenchulussemipenetrans in a newly established orchard area replacingan old commercial orchard of Valencia sweet orange graftedon Rangpur Lime rootstock, infested by nematodes, inItápolis-SP. On young plants, after a year of transplant inthe infested area the following treatments were established:1, 2 and 3 - Oxamyl, commercial product Vydate L at dosesof 20, 30 and 40 mL of the commercial product (cp)/plant,respectively, applied by “Drench” (splash at the base ofthe plants); treatments 4, 5 and 6 for the same doses of thecommercial product used by Drip (simulation of tricklearound the base of the plants); treatments 7, 8 and 9 alsocorrespond to the same doses of the commercial productapplied by Spot Gun (squirt the pure commercial producton the plant stem); treatment 10, considered standard, wasAldicarb, commercial product Temik ® GR 150, at a dose

of 25 g cp/plant, and 11 was the control treatment, withoutapplication of any product. The experimental plot wascomposed of five adjacent plants in a line, where only thethree central plants were used as a floor area of the plot.The experimental design was a randomized block with 11treatments and five replications. We evaluated the nematodepopulation in the soil and roots before the application oftreatments and at 30, 60, 90 and 120 days after application.A preliminary sampling of soil and roots was done on 17/01/2008. Then there was an application of differenttreatments. About 60 days after the first application thesecond application was done. The standard treatment wasapplied once, at the time of the first application. On 11/02/2009, we evaluated the diameters (mm) of the stem atthe base of the neck of the plant and below the first leg.Both in the soil and roots, all treatments of the twoapplications of Oxamyl (Vydate L) of any of the methodsand doses, as well as the standard treatment of Aldicarb(Temik 150 G) at a dose of 25 g of cp/plant, providedaverages with over 80% control of T. semipenetrans, in atleast one of the periods. All treatments evaluated, comparedto the control (without application of any product), alsoincreased the diameter of the stem of plants.

295 – EFFICACY OF DOSES AND APPLICATION METHODS OF OXAMYL IN THE CONTROL OFTylenchulus semipenetrans ON 18-YEAR-OLD CITRUS ORCHARD [EFICÁCIA DE DOSES E MÉTODOSDE APLICAÇÃO DE OXAMIL NO CONTROLE DE Tylenchulus semipenetrans EM POMAR DE CITROS COM 18ANOS] Soares, P.L.M.1; Gonring, A.H.R.2; Ferreira, R.J.2; Santos, J.M.1,3 1UNESP,FCAV, Câmpus de Jaboticabal;2Departamento de Fitossanidade, Laboratório de Nematologia; Desenvolvimento DuPont do Brasil, Paulínia, SP, Brazil;3Faculdade de Educação São Luis, Jaboticabal, SP, Brazil. E-mail: [email protected]

The citrus nematode (Tylenchulus semipenetrans) has beenfound in 75% of orchards in the state of São Paulo.Worldwide, nematodes are responsible for average annuallosses of 14.2%. Aiming to mitigate the losses caused bycitrus nematode assays, the efficacy of doses and methodsof application of Oxamyl (Vydate ® L) in control ofTylenchulus semipenetrans in a commercial orchard of 18-year-old ‘Valencia’ sweet orange grafted on Rangpur lime lemongrafted on harpsichord in Itápolis - SP. The treatments were:1 and 2 Oxamyl, commercial product Vydate ® L at dosesof 75 and 150 mL of the commercial product (cp)/plant,respectively, applied by “Furrow” (application to track bothsides of the plants, towards the line of planting); treatments

3 and 4 correspond to doses of 75 and 150 mL cp/plant,respectively, applied through Drip (simulation of drip onboth sides of the plants towards the row, under theprojection of the crowns of trees); 5 and 6 correspondingto doses of 75 and 150 mL cp/plant, respectively, appliedby Drench (squirt the product base of the plants). Treatment7 (standard) was formed by Aldicarb, applied at a dose of130 g/plant of the commercial product Temik ® 150 GRand 8 was the control treatment without application of anyproduct. The experimental plot was composed of five plantsand was considered the three central portions of the floorarea. The experimental design was a randomized block witheight treatments and four replications. We evaluated the



429

population of the nematode in the soil and roots beforethe application of treatments and at 30, 60, 90 and 120days after treatment. On 16/01/2008 a preliminarysampling of soil and roots took place, followed by anapplication of different treatments evaluated. About 60 daysafter the first application the second application was made.For the standard treatment, the application was performedonce at the time of the first application. Production wasalso evaluated for eleven months after the first application.Both in the soil and roots, the treatments with Oxamyl

(Vydate L), corresponding to doses of 34 and 68 L ofcommercial product / ha (75 and 150 mL / plant), appliedeither by Furrow, Drip or Drench in two applications, andtreatment with Aldicarb, commercial product Temik 150GR, at a dose of 130 g/plant in a single application,provided averages with more than 70% of control of T.semipenetrans, in at least one of the periods. All treatmentswith Oxamyl (Vydate L) provided increases in productionwhen compared to the control, while the treatment withAldicarb showed an increase of 58%.

296 – EFFICACY OF AGROLMIM ISOLATED OR ASSOCIATED TO CARBOFURAN ON HATCH ANDMOBILITY OF SECOND STAGE JUVENILES OF Meloidogyne javanica IN VITRO [EFICÁCIA DEAGROLMIM® ISOLADO OU ASSOCIADO A CARBOFURAN® SOBRE A ECLOSÃO E MOBILIDADE DEJUVENIS DE SEGUNDO ESTÁDIO DE Meloidogyne javanica IN VITRO] Soares, P.L.M.1; Ferreira, R.J.2; Barbosa, B.F.F.3;Santos, J.M.3 1UNESP,FCAV, Câmpus de Jaboticabal; 2Departamento de Fitossanidade, Laboratório de Nematologia;3Faculdade de Educação São Luis. Jaboticabal, SP, Brazil. Email: [email protected]

The experiment was conducted in the Laboratório deNematologia, Departamento de Fitossanidade UNESP/FCAV, Câmpus de Jaboticabal. We evaluated the contactaction of AGROLMIM ®, a product based on fulvic andhumic acids, alone or combined with standard Carbofuran® on the hatch (ovicidal activity) and mobility (larvicidalaction) of juveniles of the second stage of Meloidogynejavanica in vitro. The treatments were: 1.Control (water);2.AGROLMIM (290000 ppm - pH = 12.0); 3.AGROLMIM(290000 ppm - pH = 9.8), 4. AGROLMIM (290000 ppm -pH = 10.0); 5.AGROLMIM (290000 ppm - pH = 12.0) +Carbofuran (10000 ppm); 6.AGROLMIM (290000 ppm -pH = 9.8) + Carbofuran (10000 ppm ), 7. AGROLMIM

(290000 ppm - pH = 10.0) + Carbofuran (10000 ppm) andstandard 8. Carbofuran (10000 ppm). To determine theeffect of contact of the treatments on the hatch (ovicidalactivity) and mobility of juveniles of second stage of thenematode (larvicidal action) hatching chambers were used,prepared in Petri dishes, with a suspension of 10000 eggsand 2406 second-stage juveniles per plate, respectively. Theexperimental design was completely randomized, with 8treatments and 6 replications. Under the conditions of thisstudy, all treatments evaluating AGROLMIM isolated orassociated with the standard Carbofuran showed ovicidaleffect on the eggs and larvicidal effect on second-stagejuveniles of Meloidogyne javanica in vitro.

297 – TRATAMENTO DE SEMENTES COM ABAMECTINA E TIABENDAZOL NO MANEJOPOPULACIONAL DE Heterodera glycines [SEED TREATMENT WITH ABAMECTIN AND TIABENDAZOLON Heterodera glycines MANAGEMENT] Vitti, A.J.1; Rocha, M.R.2; Rezende Neto, U.R.2; Araújo, F.G.2; 1Syngenta, Avenidadas Nações Unidas, n. 18001, Santo Amaro, SP, Brazil; 2Universidade Federal de Goiás, Escola de Agronomia e Engenhariade Alimentos, Laboratório de Nematologia, C. P. 131, 74001-470 Goiânia, GO, Brazil. E-mail: [email protected]

Em experimentos visando-se o controle do nematóide decisto (H. glycines) em cultivares de soja resistente e suscetível,foi testada a abamectina aplicada via tratamento desementes, em doses correspondentes a 30, 40 e 50 g i.a./ha, com ou sem tiabendazol a 9 g i.a./ha. Apesar de não terdemonstrado efeito sobre a produtividade da cultura nostestes de campo, a dose de 50 g i.a. de abamectina/hareduziu significativamente o número de ovos produzidospor fêmea, aos 30 dias após o plantio (DAP), o número defêmeas nas raízes das plantas, aos 45 dias DAP, comconsequente redução no número de cistos recuperados nosolo, aos 60 DAP, na cultivar suscetível à raça 14 de H.

glycines, BRSGO Luziânia. Diferenças nos parâmetrospopulacionais do nematóide não foram observadas paraa cultivar resistente, BRSGO Ipameri, que apresentounúmero significativamente menor de fêmeas nas raízesou no solo, e produtividade superior á BRSGO Luziâniaem condições naturais de epidemia. Em casa devegetação, não foram observadas diferenças com relaçãoà redução populacional de H. glycines na cultivarsuscetível. Na cultivar resistente, observou-se a reduçãosignificativa do número de cistos recuperados nosubstrato, para as doses de 40 e 50 g i.a. de abamectina/ha.

430 Vol. 33(4) - 2009


298 – DEVELOPMENT OF YOUNG CITRUS PLANTS INOCULATED WITH Pratylenchus jaehni(NEMATODA:PRATYLENCHIDAE) IN MICROPLOTS [DESENVOLVIMENTO DE PLANTAS JOVENS DECITROS INOCULADAS COM Pratylenchus jaehni (NEMATODA:PRATYLENCHIDAE) EM MICROPARCELAS].Calzavara, S.A.1; Santos, J.M.1; Favoreto, L.1; Barbosa, J.C.2; & Borelli, E.R.1. 1Departament of Plant Health (Nematology)UNESP/FCAV, Jaboticabal, São Paulo, Brazil: 2Departament of Exact Science, UNESP/FCAV. E-mail: [email protected]

The root lesion nematode of citrus (Pratylenchus jaehni) wasdescribed in 2001 based on a population collected in anorchard of sweet orange in Itápolis County, São Paulo State,Brazil. In microplots under field conditions, an experimentwas carried out in order to study the influence of thenematode inoculated in a logarithmic scale [0 (zero); 10;100; 1,000; 10,000 and 100,000 specimens per microplot]on the development of young plants of ‘Valencia’ orangetrees, grafted on ‘Rangpur’ lime. The experiment wasestablished in a randomized complete block design with 10replicates. The following variables were evaluated: height

of the plant, stem diameter, diameter of the second branch,canopy volume and the number of fruits per plant. After12 months from the inoculation of P. Jaehni reductions of22% were observed in the height of the plants, 22.5% inthe diameter of the stem, 20.4% in the diameter of thesecond branch and 43.7% and 52.5% of the canopy volumeat 11 and 12 months, respectively, after the inoculation. At17, 21, 28, 34 and 39 months after inoculation the plantsshowed significant reduction in all variables except numberof fruits, which presented significant reduction only after34 months.

299 – GAMA DE PLANTAS HOSPEDEIRAS E CONTROLE ALTERNATIVO DO NEMATÓIDE DOINHAME, Scutellonema bradys. [HOST RANGE AND ALTERNATIVE CONTROL OF THE YAM NEMATODE,Scutellonema bradys] CARMO, D. O.1; ALMEIDA, N. S.1; SANTANA, M. G.1; SOUZA, J. T.1. 1Universidade Federal doRecôncavo da Bahia, Laboratório de Fitopatologia, UFRB, Cruz das Almas, CEP 44380-000 E-mail:[email protected]

O nematóide do inhame, Scutellonema bradys, é o causadorda doença conhecida como casca preta do inhame. Estadoença é um dos principais problemas fitossanitários doinhame no Recôncavo da Bahia. Existem poucos estudoscientíficos a respeito deste nematóide de modo geral eparticularmente no Brasil. Os objetivos deste trabalho foramestudar aspectos relacionados a gama de plantas hospedeirasde S. bradys e avaliar o uso de extratos vegetais comoalternativa de controle do patógeno. Apenas o inhame foiconsiderado como bom hospedeiro de S. bradys, enquantoque Luffa algyptiaca (bucha), Momordica charantia (melão deSão Caetano), Heliotropium indicum (crista de galo), Vignaunguiculata (caupi), Cucurbita pepo (abóbora), Abelmoschusesculentus (quiabo), Sicana odorifera (melão caroá), Lycopersiconesculentum (tomate) e Ipomea batatas (batata doce) foramconsideradas como más hospedeiras porque o nematóideapresentou fatores de reprodução menores que 1 nestasespécies. Crotalaria juncea (crotalária) e Cajanus cajan(guandú) foram classificadas como plantas armadilha,uma vez que as populações do nematóide decresceramno interior das raízes dessas plantas. Estudos de

infectividade relativa dos diferentes estádios donematóide mostraram que os juvenis são mais infectivosque fêmeas e estas mais infectivas que os machos. Alémdisso, foi detectado que os diferentes estádios donematóide apresentam preferência por plantashospedeiras. Dentre os 13 extratos vegetais testados, amanipueira, que é o resíduo líquido resultante daprensagem da mandioca ralada para a fabricação defarinha, foi o único a induzir 100% de mortalidade aosnematóides. Experimentos conduzidos em laboratório,casa-de-vegetação e sementeira demonstraram que osperíodos de imersão para o tratamento de rizóforos-semente infectados por S. bradys não devem ser inferioresa 6h e nem superiores a 15h. Estas recomendações levamem consideração a mortalidade máxima dos nematóidese um mínimo de danos às brotações. Este trabalho seráde grande importância para o planejamento de esquemasde rotação de culturas em áreas de cultivo de inhame.Além disso, fornecerá subsídios para a utilização damanipueira no controle de S. bradys, com a vantagem deser eficiente e não ter custo adicional para o produtor.



431

300 – EVALUATION OF NEMATOPHAGOUS FUNGI AND ORGANIC AMENDMENTS IN THECONTROL OF Meloidogyne exigua ON COFFEE* [AVALIAÇÃO DE FUNGOS NEMATÓFAGOS EPRODUTOS DE ORIGEM ORGÂNICA NO CONTROLE DE Meloidogyne exigua EM CAFEEIRO] Soares, P.L.M.1;Ferreira, R.J.2; Barbosa, B.F.F.3; Santos, J.M.3 1e3Professores de Nematologia – UNESP/FCAV, Câmpus de Jaboticabal,Departamento de Fitossanidade, Laboratório de Nematologia; 2Graduando em Ciências Biológicas da Faculdade deEducação São Luis. Jaboticabal - SP; *Apoio FAPESP: Auxílio à Pesquisa 06/52291-5 e 1Bolsista 06/[email protected]

Nematodes are responsible for large annual losses in thecoffee crop in all producing regions of the world. Aimingto mitigate these losses, the effectiveness was evaluated ofthe mixture of equal parts of the substrate formed by themixture of sugar cane bagasse enriched with rice brancolonized and, separately, by nematophagous fungiArthrobotrys musiformis, A. oligospora, Paecilomyces lilacinus andPochonia clamydosporia. This material, in different doses, wasused separately or in combination with other products oforganic origin in the control of Meloidogyne exigua in five-year-old commercial coffee “Obatã” in Altinópolis-SP. Thetreatments were: 1.Control without application of anyproduct; 2.Fungi (0.5 L of mixture/plant); 3.Fungi (1.0 Lof mixture/plant); 4.Fungi + Organomineral fertilizerprepared with the plant filter cake (0.5 L of the mixture offungi + 0.6 kg of fertilizer); 5.Fungi + Organomineralfertilizer (1.0 L + 0.6 kg); 6.Fungi + Condisolo ® (0 , 5 L +0.5 kg); 7.Fungi + Condisolo (1.0 L + 0.5 kg); 8.Fungi +Agrolmim ®, a product containing fulvic and humic acids(0.5 L + 63 mL); 9.Fungi + Agrolmim (1.0 L + 63 mL), 10.Organomineral fertilizer (0.6 kg); 11.Condisolo (0.5 kg);12.Agrolmim (63 mL); 13.Agrolmim (126 mL);14.Agrolmim (63 mL in the deployment + 63 mL at 60days after implantation) and 15.Aldicarb standard (Temik® 150g, at a dose of 20 g/plant). The experimental plotwas composed of five adjacent plants, where all were treatedand only three plants were used for evaluations. The

experimental design was a randomized block design with15 treatments and 4 replicates. We evaluated the populationof the nematode in the soil and roots before the applicationof treatments and at 30, 60, 90 and 120 days afterapplication. Both in the soil and roots of the plants, all thetreatments evaluated, besides the standard (Temik 150 GR)showed average of above 70% of control of M. exigua, inat least one of the periods. The treatments that stood outwere 4.Fungi + Organomineral fertilizer (0.5 L + 0.6 kg/plant); 5.Fungi + Organomineral fertilizer (1.0 L + 0.6 kg);7.Fungi + Condisolo (1 0, L + 0.5 kg); 8.Fungi + Agrolmim(0.5 L + 63 mL); 9.Fungi + Agrolmim (1.0 L + 63 mL);13.Agrolmim (126 mL) and 14.Agrolmim (63 mL in thedeployment + 63 mL at 60 days after implantation). Thesetreatments provided averages of more than 77% of controlof M. exigua in roots in all evaluations, including overcomingthe standard treatment consisting of Aldicarb. Thetreatments 2 (Fungi 0.5 L), 3 (Fungi 1.0 L), 4 (Fungi +Organomineral fertilizer 0.5 L + 0.6 kg), 5 (Fungi +Organomineral fertilizer 1.0 L + 0.6 kg), 6 (Fungi +Condisolo 0.5 L + 0.5 kg), 8 (Fungi + Agrolmim 0.5 +0.063 L), 9 (Fungi + Agrolmim 1.0 + 0.063 L), 12(Agrolmim 0.063 L), 13 (Agrolmim 0.126 L) and standardtreatment 15 Aldicarb (20 g Temik 150G), provided thehighest average of 111.10; 22.94; 4.58; 14.04; 10.20; 6.01;25.95; 65.53; 35.74 and 48.92% of increase in production,respectively.

301 – SCANNING ELECTRON MICROSCOPY OF NEMATOPHAGOUS FUNGI ASSOCIATED WITHTylenchulus semipenetrans and Pratylenchus jaehni [MICROSCOPIA ELETRÔNICA DE VARREDURA DEFUNGOS NEMATÓFAGOS ASSOCIADOS A Tylenchulus semipenetrans E Pratylenchus jaehni]. Martinelli, P.R.P.1; Andrade,F.C.A. 2; Medeiros, M.R.M. 3; Santos, J.M. 4 1;2;3;4 – Faculdade de Ciências Agrárias e Veterinárias UNESP, CEP: 14884-900 Jaboticabal, SP, Brasil. Email: [email protected]

Nematophagous fungi have been studied as a promisingalternative for the management of nematodes of citrus.Isolated ones found in citrus orchards, mainly in São PauloState, were studied in the Laboratory of ElectronMicroscopy of FCAV/UNESP - Campus de Jaboticabal-SP. This study had the objective of documenting byscanning electron microscopy the mode of action,outstanding morphological structures for the identificationof the main species of nematophagous fungi involved inthe study and proving the pathogenicity of the isolates

associated with T. semipenetrans and P. jaehni, namely:Arthrobotrys oligospora, A. conoides, A. robusta, A. musiformis,Dactylella leptospora, Monacrosporium eudermatum and M. elegans.The data obtained in this study have confirmed thatscanning electron microscopy is an effective tool to assistin the understanding of of the way nematophagous fungiact and to reveal details of their reproductive structures. Itconfirms the pathogenicity of isolates of T. semipenetransand P. jaehni as well as confirming the identification of someisolates.

432 Vol. 33(4) - 2009


302 – EVALUATION OF THE EFFICACY OF FIVE NEMATOPHAGOUS FUNGI FORMULATION INTHE MANAGEMENT OF Tylenchulus semipenetrans IN CITRUS [AVALIAÇÃO DA EFICÁCIA DE UMAFORMULAÇÃO DE CINCO FUNGOS NEMATÓFAGOS PARA O MANEJO DE Tylenchulus semipenetrans EMCITROS]. Martinelli, P.R.P.1; Andrade, F.C.A. 2; Medeiros, M.R.M. 3; Santos, J.M. 4 1;2;3;4 – Faculdade de Ciências Agráriase Veterinárias UNESP, CEP: 14884-900 Jaboticabal, SP, Brasil. Email: [email protected]

The citrus nematode (Tylenchulus semipenetrans) is a keynematode of citrus crops in Brazil and worldwide. Thisspecies of nematode has three physiological races: the“citrus” race, the “Mediterranean” race, and the “Poncirus”race; however, the predominant race in the Americas is thecitrus. In the State of São Paulo, T. semipenetrans is found inmore than 70% of the orchards. In Brazil, the onlynematicide registered for citrus is aldicarb and even then,its use is permitted only in the State of São Paulo. Theincreasingly severe restrictions on the use of this productare often discussed. The integrated management ofnematodes in citrus culture with the use of biologicalcontrol stands out worldwide. This study had the objectiveto evaluate the effectiveness of the management of T.semipenetrans in commercial citrus orchards, by using aformulation containing five species of nematophagousfungi, Monacrosporium eudermatum, Dactylella leptospora,Arthrobotrys musiformis, A. conoides and Paecilomyces lilacinus,

formulated in a mixture of sugar cane bagasse and ricebran. The treatments were 0; 1; 2; 4 and 6 liters of equalparts from the substrate individually colonized by the fungi/plant, 1 L of the substrate colonized by the fungi/plant +200g of AO-15 (Nutrisafra’s organic fertilizer), composedof 8% organic carbon, 8% calcium and 15% naturalphosphate), 1 L of the substrate colonized by the fungi/plant + 4 L Agrolmin ® AH (Agrolatino’s fulvic andhumic acids), 4 L Agrolmin AH and 130 g/plant ofaldicarb (Temik ® 150g). The best dose to control thepopulation of the nematode was the 2 L of fungiformulation per plant with reduction of the populationof T. semipenetrans roots on average 97% and 99% of thenumber of eggs. The chemical treatment with aldicarb,organic fertilizer AO-15 and Agrolmin AH also providedlinear reductions in the nematode population in roots,although lower than those obtained with the fungusformulation.



433

Índice por Autor dos Resumos doXXVIII Congresso Brasileiro de Nematologia


Autor principal Página

Aballay, E. ..................................................................................... 399Aguiar, N.D.C. ............................................................................. 410Alcalá, S. ........................................................................................ 382Almeida, A.M. ..................................................................... 377, 407Almeida, E.J. ....................................................................... 292, 372Almeida, N.S. ............................................................................... 357Alves, G.C.S. ................................................................................. 303Amora, D.X. ................................................................................. 413Amorim, L.D. ............................................................................... 421Andaló, V. ..................................................................................... 377Andrade, E.P. ............................................................................... 292Andrade, V. .......................................................................... 345, 346Antes, V.A. .................................................................................... 294Araújo, F.G. ......................................................................... 299, 301Araújo filho, J.V. .......................................................................... 321Armenteros, M. ........................................................................... 367Arcos, S.C. .................................................................................... 390Ardakani, A.S. .............................................................................. 401Ataíde, M.B. ................................................................................. 365Baida, F.C. ............................................................................ 329, 330Barbosa, K.A.G. .......................................................................... 304Barbosa, B.F.F. ................................................... 304, 322, 369, 380Barbosa, D.H.S.G. ...................................................... 369, 370, 372Barizão, D.A.O. ............................................................................ 358Barros. A.F. .......................................................................... 325, 341Belan, L.L. ...................................................................340, 370, 371Becaro, C.K. ................................................................347, 373, 398Bessi, R. ......................................................................................... 297Biela, F. .......................................................................................... 363Bonfim Junior, M.F. .................................................................... 359Burla, R.S. ..................................................................................... 299Cadioli, M.C. ....................................................................... 353, 392Calzavara, S.A. ............................................................................. 430Caixeta, L.B. ................................................................................. 339Campos, A.S ................................................................................. 343Campos, V.P ................................................................................. 423Campos, V.A.C. ........................................................................... 296Carmo, D.O. ................................................................................. 430Carneiro, R.M.D.G. ............................................................ 311, 409Carrizo, C. .................................................................................... 334Castillo, P. ..................................................................................... 291Castro, J.M.C. ...................................................................... 344, 355Castro Lizazo, I. ................................................................. 408, 409Catalina, T. .................................................................................... 366Chaves, E. ..................................................................................... 342Castillo, P. ..................................................................................... 291Castro, J.M.C. ...................................................................... 344, 355Castro Lizazo, I. ................................................................. 408, 409Catalina, T. .................................................................................... 366Chaves, E. ..................................................................................... 342Chiamolera, F.M. ......................................................................... 325Cosmo, D.A. ................................................................................. 416Coronel, N ................................................................................... 308Cunha, M.J.M. .............................................................................. 336Cunha, T.P.L. ................................................................................ 314Damasceno, J.C.A. ............................................................. 407, 411

Autor principal Página

Davila- Negrón, M. .................................................................... 337Del Sarto, R.P. .............................................................................. 418Del Toro, M.S. ............................................................................. 376Del Valle, E.E. .................................................................... 389, 390Dias, W.P. ...................................................................................... 322Dias- Ariera, C.R. ............................................................... 332, 335Dias, F.L. ....................................................................................... 415Díez-Rojo, M.A. .......................................................................... 406Dinardo-Miranda, L.L. ............................................................... 415Duarte, A.G. ................................................................................ 354Estevez, R.L. ................................................................................ 403Farias, A.C.A. ............................................................................... 361Favoreto, L. .................................................................................. 358Ferreira, A.D. ..............................................................311, 312, 313Ferreira, C.S. ................................................................................. 418Ferreira, P.A. ................................................................................ 388Ferreira, R.J. ......................................................................... 351, 353Ferreira, T.F. ................................................................397, 398, 417Fiorentin, F. ......................................................................... 338, 355Fonseca, S.O. ................................................................................ 324Formentini, H.M. ........................................................................ 328Fourie, H. ...................................................................................... 303Freire, E.S. ........................................................................... 386, 423Galhano, C.I.C. ............................................................................ 408Gauna, P. .............................................................................. 411, 412Gomes, A.C.M.M. ....................................................................... 318Gomes, C.B. ................................................................................. 350Gomes, V.M. ...............................................................363, 406, 422Goulart, A.M.C. .........................................................326, 327, 328Guerrero, M.M. ........................................................................... 410Gutierrez, P.D.N. ......................................................................... 385Hafez, S.L. ................................................. 349, 417, 420, 422, 424Herrera Parra, E. ......................................................................... 413Hernández, M.A. ......................................................................... 385Inomoto, M.M. ............................................................................ 334Ito, D.S. ......................................................................................... 309Kaur, R. ......................................................................................... 289Khallouk, S. .................................................................................. 310Kkhosa, M.C. ............................................................................... 402Kubo, R.K. ................................................................................... 321Lax, P. ...........................................................................290, 339, 384Lacasa, C.M. ................................................................................. 405Labarca, J. ............................................................................ 348, 349Leguízamo, M.C. ......................................................................... 344Lima, I.M. ....................................................................373, 374, 375Lira, V. ........................................................................................... 366López-Pérez, J.A. ......................................................................... 404Lourenço, I.T. .............................................................................. 295Lourenço, O. ................................................................................ 405Lovato, B.V. ......................................................................... 420, 421Luquine, L.S. ................................................................................ 357Maceda, A. .................................................................................... 347Machado, A.C.Z. ......................................................................... 323Machado, A.R.T. ................................................................. 297, 425Machado, I.R. ..............................................................378, 392, 393Magunacelaya, J.C. ....................................................................... 416

434 Vol. 33(4) - 2009


Manzanilla-López, R.H. ............................................................. 386Maleita, C.M. ................................................................................ 307Martinelli, P.R.P. ....................................... 379, 380, 383, 431, 432Martinotti, M.D. .......................................................................... 412Martins, I. ..................................................................................... 397Martins, D.M.S. ............................................................................ 295Matos, D.S.S. ................................................................................ 336Matsuo, E. .................................................................................... 301Mattos, R.M. ....................................................................... 404, 419Mattos, V.S. ................................................................................... 294Medeiros, J.E. ............................................................................... 339Medeiros, M.R.M. .............................................................. 378, 383Miranda, T.L. ................................................................................ 344Mondino E.A. ..................................................................... 290, 342Mota, F.C. ..................................................................................... 319Moura, R.M. ................................................................................. 329Muniz, M.F.S. ...................................................................... 355, 356Nasu, E.G.C. ................................................................................ 402Neves, S.S. ............................................................................ 354, 361Novaretti, W.R.T. ......................................................................... 419Oliveira, A.S. ................................................................................ 372Oliveira, R.M ................................................................................ 337Orajay, J.I. ..................................................................................... 387Ornat, C. .............................................................................. 388, 400Palhares-Melo, L.A.M. ................................................................ 341Parada, S.J.C. ................................................................................. 384Paula, L.A. .................................................................................... 321Peraza, W. ...................................................................................... 387Pereira, F.O.M. ............................................................................. 338Pérez-Pacheco, R. ........................................................................ 391Picca, C. ............................................................................... 331, 368Pinheiro, J.B. ........................................................................ 319, 320Pinho, R.S.C. ................................................................................ 396Pinto, C.C.S. ................................................................................. 379Podestá, G.S. ................................................................................ 396Ponce, J.F. ..................................................................................... 348Pontes, M.F.C. ..................................................................... 302, 306Puerari, H.H. ................................................................................ 314Ramirez- Suares, A. ...................................................288, 291, 349Ramos, Y.S. ................................................................................... 364Randig O. ...................................................................................... 293Rehberger, L. ............................................................................... 381Ribeiro, N.R. ....................................................................... 308, 309Ribeiro, R.C.F.1. .......................................................................... 382Ritzinger, C.H.S.P. .............................................................. 335, 345

Robertson, L. ............................................................................... 306Rodríguez, A. ...................................................................... 381, 389Ros, C. ........................................................................................... 298Rosa, J.M.O. ......................................................................... 356, 414Ruas, A.R. ..................................................................................... 326Salgado, S.M.L. ................................................................... 403, 404Santin, A.M. ................................................................................. 310Santos, D.A ................................................................................... 300Santos, J.M. ..................................................................342, 350, 362Santos, J.F. ..................................................................................... 360Santos Júnior, H.M. .................................................................... 398Santos, L.C. .................................................................................. 340Santos, M.C.V. .............................................................................. 400Santos, M.F.A. .............................................................................. 294Shahbazi, H. ................................................................. 333, 334,362Silva, J.F.V. .................................................................................... 302Silva, J.G.P. .................................................................................... 319Silva, N.R.R. ................................................................................. 288Silva, R.V. ............................................................................. 323, 324Silva, T.S. ....................................................................................... 414Silva, W.J.R. ................................................................................... 415Shahbazi, H. ................................................................. 333, 334,362Singh, K.S. .................................................................................... 330Siqueira, K.M.S. ........................................................................... 293Soares, P.L.M. .................................................... 318, 351, 393, 394,................................................... 395, 425, 426, 427, 428, 429, 431Sobral, L.D.T. ............................................................................... 368Soto, A.T. ...................................................................................... 352Sousa, M.G. .................................................................................. 320Souza, S.E. .................................................................................... 333Somavilla, L. ................................................................................. 314Teixeira, R.A. ...................................................................... 312, 313Thomas, M.C. .............................................................................. 367Tixier, P. ........................................................................................ 364Tolocka, P.A. ................................................................................ 315Tordable, M. ................................................................................. 300Van Der Sommen ....................................................................... 326Vela, M.D. ..................................................................................... 401Venekey, V. .................................................................................... 365Vicente, T.F.S. .............................................................................. 362Vieira, J.G.P. ................................................................................. 332Vieira, R.S. ........................................................................... 359, 360Vitti, A.J. ....................................................................................... 429Westerich, J.N. ..................................................................... 316, 317Wilcken, S.R.S. ............................................................................. 315

Autor principal Página Autor principal Página



435

Índice por Assunto dos Resumos doXXVIII Congresso Brasileiro de Nematologia


Aphelenchoides besseyi – 151Aphelenchoides bicaudatus – 151Aphelenchoides centralis – 99Aphelenchoides fragariae – 136/151Aphelenchoides sexlineatus – 151Aphelenchoides subtenuis – 02Arthrobotrys musiformis – 193/202/223/ 224/225/300Arthrobotrys oligospora – 193/195/202/ 223/224/225/300Arthrobotrys robusta – 193/202Arthrobotrys sp. – 197Bionem WP – 200Belonolaimus sp. – 95Boleodorus thylactus – 99Bursaphelenchus cocophilus – 142/143Café/ Coffee – 20/36/46/49/72/77/78/81/97102/113/115/156/174/175/179/183/184/ 185/208/223/242/243/256/290/291/292/ 293/300Cana de açúcar/ Sugarcane – 25/26/35/52/ 53/88/90/105/121/160/173/269/270/278Caracterização molecular/ Molecular characterization – 07/09/10Cephalobus persegnis – 239Coloração de raízes/ Root staining – 23Comunidades de nematoides/ Nematode communities – 06/86/89/90/103/105/109/ 110/119/124/139/155/164Dactylella leptospora – 193/195/197/202Dinâmica populacional/ Population dynamics – 87/120/148/163Distribuição no solo/ Soil distribution – 84/ 85/120/121Ditera – 199Ditylenchus dipsaci – 16/151Ditylenchus gallaeformans – 47Ditylenchus kheirii – 99Ditylenchus montanus – 151Ditylenchus myceliophagus – 151Fungos nematófagos/Nematophagous fungi – 193/195/196/197/202/203/204/210/225/ 226/227/231/234/237Geocenamus brevidens – 99

Globodera pallida – 132/133/209Globodera rostochiensis – 104/133Globodera spp. – 129/237Goiaba/ Guava – 10/24/82/108/128/162/ 180/186/187/188/197/225/231/284Hebernem – 219Helicotylenchus digonicus – 99Helicotylenchus dihystera – 101Helicotylenchus multicinctus – 101Helicotylenchus vulgaris – 99Hemicriconemoides mangiferae – 99Heterodera glycines – 23/28/29/276/286/297Heterorhabditis amazonensis – 190Heterodera baujardi – 192/194/215/216/ 221/222/230/232/273Heterorhabditis indica – 192/221/222Heterorhabditis sonorensis – 207Hoplolaimus sp. – 117Leidynema sp. – 112Marcador molecular/ Molecular markers – 04/12/13/14Meloidogyne – 92/249/254Meloidogyne arenaria – 122/244Meloidogyne chitwoodi – 116/274/279/288Meloidogyne ethiopica – 14/27/74/272Meloidogyne exigua – 19/77/78/144/174/ 175/179/208/227/233/242/290/291/292/ 293/300Meloidogyne floridensis – 41/42Meloidogyne hapla – 41Meloidogyne hispanica – 40Meloidogyne incognita – 15/17/18/19/20/ 21/22/23/25/33/35/48/52/53/56/59/65/67/ 70/71/73/79/80/87/93/102/122/161/183/ 184/185/189/195/206/228/240/241/245/ 246/247/248/255/257/261/262/263/267/ 271/275/277/282/285/289Meloidogyne javanica – 25/30/33/35/41/42 43/55/57/60/61/70/93/104/107/122/161/ 176/177/178/201/212/229/252/259/265/ 266/269/270/280/296

Os 302 resumos apresentados durante o evento estão aqui organizados na forma de índice remissivo por assunto. Eles foramagrupados dentro de oito seções, pela comissão organizadora, como indicado a seguir:

Seção 1 - Biologia Molecular : resumos numerados de 01 a 17;Seção 2- Resistência de Plantas a Nematoides : de 18 a 80;

Seção 3 – Ocorrência e Ecologia de Nematoides : de 81 a 164;Seção 4 – Nematoides Marinhos : de 165 a 172;

Seção 5 – Efeitos do parasitismo no crescimento e produção : de 173 a 188;Seção 6 – Controle Biológico : de 189 a 237;Seção 7 – Manejo Integrado : de 238 a 271;Seção 8 – Controle Químico : de 272 a 302.

436 Vol. 33(4) - 2009


Meloidogyne mayaguensis – 10/11/12/13/ 24/31/32/39/41/42/58/60/62/63/66/68/69/ 70/75/108/122/162/180/186/187/188/191/ 225/230/231/232/234/250/251/264/284Meloidogyne megadora – 253Meloidogyne minor – 83Meloidogyne paranaensis – 25/46/81/220/ 223/243/256Meloidogyne spp. – 03/04/38/49/91/98/ 101/106/115/134/145/150/160/238/258/ 260/268Mesocriconema ornata – 211Monacrosporium elegans – 193/197/202Monacrosporium eudermateum – 193/195/ 202Monagraphella cucumerina – 209Nacobbus aberrans – 05/07/37/59/138/205Nematicidas biológicos/ Biological nematicides – 198/199/200/213/214/219/236Nematicidas químicos/ Chemical nematicides – 272/278Nematoides de água doce/ Freshwater nematodes – 171Nematoides diversos/ General nematodes – 34/36/84/85/97/111/113/114/118/120/121/123/128/130/131/147/148/149/153/154/ 156/158/159/182/217Nematoides marinhos/ Marine nematodes – 01/165/166/167/168/169/170/172Paecilomyces lilacinus – 193/195/197/198/ 202/209/214/220/223/224/225/231/300Pochonia chlamydosporia – 193/195/197/ 202/206/209/212/223/224/225/229/231/ 237/300

Pratylenchus – 135/269/270Pratylenchus brachyurus – 23/26/35/44/ 45/50/51/54/76/82/94/100/101/125/126/ 140/158/173/197/269/270Pratylenchus coffeae – 152Pratylenchus jaehni – 120/141/196/298/ 301Pratylenchus neglectus – 262Pratylenchus penetrans – 287Pratylenchus spp. – 08/09/54Pratylenchus thornei – 99/283Pratylenchus zeae – 26/72/94/101/173/269 270Radopholus similis – 163Rotylenchulus reniformis – 71/157/281Scutellonema brachyurus – 64/95/127Scutellonema bradys – 146/299Soja/ Soybean – 23/28/30/33/43/44/50/64/ 76/125/126/127/158/182/280/285/286Strelkovimermis spiculatus – 218Tomate/ Tomato – 18/40/60/63/70/176/177178/200/204/205/206/212/229/232/240/ 255/263/265Tylenchulus semipenetrans – 137/224/294/ 295/301/302Xiphinema americanum – 99Xiphinema index – 99/235/244Zigotylenchus - 08


437

Lista de Revisores do Volume 33 (2009)List of Referees for the Volume 33 (2009)

Alceu Richetti Embrapa Agropecuária Oeste, Dourados (MS) BrasilAlcides Moino Júnior Universidade Federal de Lavras (MG) BrasilAlexandre Moura Cintra Goulart Embrapa Cerrados, Planaltina (DF) BrasilAndressa Cristina Zamboni Machado Piracicaba (SP) BrasilCésar Bauer Gomes Embrapa Clima Temperado, Pelotas (RS) BrasilCláudia Dolinski Universidade Estadual do Norte Fluminense, Campos dos Goytacazes (RJ) BrasilCláudia Regina Dias-Arieira Universidade Estadual de Maringá, Umuarama (PR) BrasilClaudio Marcelo Gonçalves de Oliveira Instituto Biológico, Campinas (SP) BrasilDébora Crisitna Santiago Universidade Estadual de Londrina, Londrina (PR) BrasilEveraldo Antonio Lopes Centro Universitário de Patos de Minas, Patos de Minas (MG) BrasilDílson da Cunha Costa Embrapa Recursos Genéticos e Biotecnologia, Brasília (DF) BrasilEduardo José de Almeida Universidade Estadual Paulista, Jaboticabal (SP) BrasilFlavia Patrício Rodrigues Alves Instituto Biológico, Campinas (SP) BrasilGregor W. Yeates Landcare Research, Palmerston North 4442, Nova ZelândiaGuilherme Lafourcade Asmus Embrapa Agropecuária Oeste, Dourados (MS) BrasilGustavo Rubens de Castro Torres Fundação de Ensino Superior de Olinda, Olinda (PE) BrasilHarllen Sandro Alves Silva Embrapa Mandioca e Fruticultura Tropical, Cruz das Almas (BA) BrasilHoward Ferris University of Califórnia, Davis (CA) EUAJanete Andrade de Brito Federal Department of Agriculture & Consumer Services, Gainesville (FL) EUAJean Kleber de A. Mattos Universidade de Brasília, Brasília (DF) BrasilLeandro Grassi de Freitas Universidade Federal de Viçosa, Viçosa (MG) BrasilLeila Luci Dinardo-Miranda Instituto Agronômico de Campinas, Ribeirão Preto (SP) BrasilLuiz Carlos Camargo Barbosa Ferraz Universidade de São Paulo, Piracicaba (SP) BrasilMara Rúbia Rocha Universidade Federal de Goáis, Goiânia (GO) BrasilMarcelo E. Doucet Universidad Nacional de Córdoba, ArgentinaMaria Cristina Rocha Cordeiro Embrapa Cerrados, Planaltina (DF) BrasilMarineide Mendonça Aguillera Universidade Federal de São Carlo, Araras (SP) BrasilMiguel Talavera Instituto de Investigación y Formación Agraria y Pesquera, Granada, EspanhaMyrian Tigano Embrapa Recursos Genéticos e Biotecnologia, Brasília (DF) BrasilOscar Fontão Embrapa Agropecuária Oeste, Dourados (MS) BrasilPatricia Stock University of Arizona, Tucson (AZ) EUARegina Cássia Ferreira Ribeiro Universidade Estadual de Montes Claros, Campus de Janaúba (MG) BrasilRegina Maria Dechechi Gomes Carneiro Embrapa Recursos Genéticos e Biotecnologia, Brasília (DF) BrasilRicardo Moreira de Souza Universidade Estadual do Norte Fluminense, Campos dos Goytacazes (RJ) BrasilRoberto Kazuhiro Kubo Instituto Biológico, Campinas (SP) BrasilRomero Marinho de Moura Universidade Federal de Pernambuco, Vitória de Santo Antão (PE) BrasilRosana Bessi Universidade de São Paulo, Piracicaba (SP) BrasilRosangela Aparecida da Silva Univag, Várzea Grande (MT) BrasilRosângela D’Arc de Lima Oliveira Universidade Federal de Viçosa (MG) BrasilRosemeire de Lellis Naves Embrapa Uva e Vinho, Jales (SP) BrasilRoy Neilson Scottish Crop Research Institute, Dundee, EscóciaRui Gomes Carneiro Instituto Agronômico do Paraná, Londrina (PR) BrasilSilvia Renata Siciliano Wilcken Universidade Estadual Paulista, Botucatu (SP) BrasilSilvio Sandoval Zocchi Universidade de São Paulo, Piracicaba (SP) BrasilSimone da Costa Mello Universidade de São Paulo, Piracicaba (SP) BrasilVicente Paulo Campos Universidade Federal de Lavras, Lavras (MG) BrasilWaldir Pereira Dias Embrapa Soja, Londrina (PR) Brasil

Documents

Volume 33 Número 4 Dezembro 2009nematologia.com.br/files/revnb/33_4.pdf · 2019. 1. 4. · Volume 33 Number 4 December 2009 CONTENTS Articles (in English) Active substances against