Novel Bacillus thuringiensis cry genes and their

1

Novel Bacillus thuringiensis cry genes and their insecticidal potency against

Coleoptera

Mikel Domínguez Arrizabalaga

Pamplona, 2019

2

3

Universidad Pública de Navarra Departamento de Agronomía, Biotecnología y Alimentación Institute for Multidisciplinary Research in Applied Biology

Novel Bacillus thuringiensis cry genes and their insecticidal potency against Coleoptera

Tesis Doctoral para optar al grado de Doctor, presentada por:

Mikel Domínguez Arrizabalaga

Directores:

Dr. Primitivo Caballero Murillo

Dra. Maite Villanueva San Martín

Pamplona, 2019

4

5

Dr. PRIMITIVO CABALLERO MURILLO Catedrático de Producción Vegetal del Departamento de Agronomía, Biotecnología y Alimentación de la Universidad Pública de Navarra.

Dra. MAITE VILLANUEVA SAN MARTÍN Investigadora Doctora, Área de Producción Vegetal del Departamento de Agronomía, Biotecnología y Alimentación de la Universidad Pública de Navarra.

INFORMAN,

Que la presente memoria de Tesis Doctoral “Novel Bacillus thuringiensis cry genes and their insecticidal potency against Coleoptera” elaborada por Mikel Domínguez Arrizabalaga bajo su dirección, cumple las condiciones exigidas por la legislación vigente para optar al grado de Doctor.

Y para que así conste, firma la presente en Pamplona/Iruña, a 24 de Mayo de 2019.

Fdo. Primitivo Caballero Murillo Fdo. Maite Villanueva San Martín

Este trabajo se ha desarrollado mediante el disfrute de una beca de Formación de Personal Investigador de la Universidad Pública de Navarra por parte de Mikel Domínguez Arrizabalaga, adscrito a los proyectos AGL 2015-70 584-C2-2-R y RTI 2018-095 204-B-C22

6

7

CONTENTS

CHAPTER I. INTRODUCTION ................................................................................................................ 10

INSECTICIDAL ACTIVITY OF BACILLUS THURINGIENSIS PROTEINS AGAINST COLEOPTERAN PESTS GENERAL INTRODUCTION ................................................................................................................ 10

Ecology, biology, and infection ...................................................................................................................... 11 Characteristics and classification of B. thuringiensis insecticidal proteins .................................................... 12 Bacillus thuringiensis against Coleopteran pests. ......................................................................................... 13

THE CRYSTAL COLEOPTERAN-ACTIVE PROTEINS ............................................................................... 14 Protein structure and function ...................................................................................................................... 14 Insecticidal activity ........................................................................................................................................ 17 Mode of action .............................................................................................................................................. 21

THE SECRETABLE COLEOPTERAN-ACTIVE PROTEINS ......................................................................... 29 Protein structure and function ...................................................................................................................... 29 Insecticidal activity ........................................................................................................................................ 30 Mode of action .............................................................................................................................................. 31

BT-BASED INSECTICIDES .................................................................................................................... 33 BT-CROPS .......................................................................................................................................... 34 RESISTANCE AND CROSS RESISTANCE ............................................................................................... 35

AIMS OF THE THESIS .............................................................................................................................. 54 CHAPTER II ......................................................................................................................................... 56

A STRAIN OF BACILLUS THURINGIENSIS CONTAINING A NOVEL CRY7AA2 GENE THAT IS HIGHLY TOXIC TO LEPTINOTARSA DECEMLINEATA (SAY) (COLEOPTERA; CHRYSOMELIDAE)

ABSTRACT: ........................................................................................................................................ 56 INTRODUCTION ................................................................................................................................ 57 MATERIALS AND METHODS .............................................................................................................. 60

Bacterial strains, plasmids and insect culture conditions ............................................................................. 60 Total DNA extraction and genomic sequencing ............................................................................................ 60 Identification of potential insecticidal genes ................................................................................................ 61 Amplification and cloning of a cry7Aa2 gene ................................................................................................ 61 Production of spores and crystals from wild and recombinant Bt strains. .................................................... 63 Analysis of crystal proteins ............................................................................................................................ 63 Leptinotarsa decemlineata rearing and bioassays ........................................................................................ 64 Nucleotide sequence accession number. ...................................................................................................... 64

RESULTS ............................................................................................................................................ 65 Draft genome sequence of the Bacillus thuringiensis BM311.1 strain ......................................................... 65 Characterization of Cry7Aa2. ........................................................................................................................ 66 Insecticidal activity of Cry7Aa2 for L. decemlineata. .................................................................................... 68

DISCUSSION ...................................................................................................................................... 69 REFERENCES ..................................................................................................................................... 73

8

RESUMEN

Bacillus thuringiensis (Bt) se distingue de otras bacterias del género Bacillus por su

capacidad de sintetizar d-endotoxinas (Cry y Cyt) que característicamente se

agregan formando uno o más cristales paraesporales. Todas estas proteínas han

sido clasificadas en distintas familias las cuales tienen actividad contra insectos

de distintos órdenes, incluido el orden Coleoptera. En esta tesis doctoral se ha

realizado una revisión actualizada de todas las proteínas insecticidas, que

produce Bt, para las cuales se ha descrito actividad contra especies del orden

Coleoptera. El objetivo de la tesis ha sido realizar una búsqueda de nuevos genes

cry con la finalidad de aumentar la batería de toxinas Bt disponibles para el

control de las plagas causadas por coleópteros. Dicha búsqueda se ha centrado

en dos cepas Bt, seleccionadas en un screening previo, para lo cual se abordó la

secuenciación masiva del DNA genómico de cada una de ellas.

El contenido génico de la cepa BM311.1 reveló la presencia un gen nuevo cry7

que codificaba para una proteína que se denominó Cry7Aa2 por compartir una

identidad del 98% con la proteína Cry7Aa1 previamente descrita. A pesar de esta

elevada identidad, estas dos proteínas mostraron diferencias en su actividad

contra larvas de Leptinotarsa decemlineata. Mientras que la proteína Cry7Aa1 solo

es tóxica cuando el cristal ha sido previamente solubilizado in vitro, la proteína

Cry7Aa2 es tóxica directamente tras ser ingerida en forma de cristal. Esto

representa una clara ventaja práctica de Cry7Aa2, con vistas a su utilización como

bioinsecticida, mientras que ambas son igualmente útiles para la obtención de

plantas transgénicas resistentes frente a L. decemlineata.

Los resultados de este trabajo son científicamente relevantes y pueden ser

utilizados para el diseño de nuevas estrategias para el control de plagas de

insectos, ya sea creando nuevos bioinsecticidas o construyendo nuevas plantas

transgénicas.

9

ABSTRACT

Bacillus thuringiensis (Bt) is distinguished from other bacteria of the genus Bacillus

for its ability to synthesize d-endotoxins (Cry and Cyt) that characteristically

aggregate forming one or more parasporal crystals. All these proteins have been

classified into different families which have activity against insects of different

orders, including the order Coleoptera. In this doctoral thesis, an up-to-date

review of all the insecticidal proteins produced by Bt has been carried out, for

which their activity against coleopteran species has been described. The aim of

the thesis was to initiate a search for new cry genes in order to increase the

number of Bt toxins available for the control of pests caused by Coleoptera. This

study has been focused on two Bt strains, selected in a previous screening, for

which sequencing of their genomic DNA was performed.

The gene content of strain BM311.1 revealed the presence of a new cry7 gene that

was named cry7Aa2 since it shared a 98% identity at the amino acid level with

the previously described Cry7Aa1 protein. Despite this high identity, these two

proteins showed differences in their activity against Leptinotarsa decemlineata

larvae. While the Cry7Aa1 protein was only toxic when the crystal had been

previously solubilized in vitro, the Cry7Aa2 protein showed toxicity directly after

being ingested as a crystal. This represents a clear practical advantage of Cry7Aa2

over Cry7Aa1 towards its use as a bioinsecticide, while both are equally useful

for obtaining transgenic plants resistant to L. decemlineata.

The results of this thesis are scientifically relevant and can be used to design new

strategies for the control of insect pests, either by creating new bioinsecticides or

by engineering new transgenic Bt-plants.

10

Chapter I. INTRODUCTION

Insecticidal activity of Bacillus thuringiensis proteins against coleopteran pests

GENERAL INTRODUCTION

The use of entomopathogenic microorganisms as biological control agents has

become one of the most effective alternatives to chemical pest control. Among all,

the Gram-positive bacterium Bacillus thuringiensis (Bt) is the most important

entomopathogenic microorganism used to date in crop protection. This

bacterium is widely distributed in various ecological niches, such as water, soil,

insects, or plants (Raymond et al., 2010). The feature that distinguishes B.

thuringiensis from other members of the Bacillus group is the capacity to produce

parasporal crystalline inclusions. These crystals are composed of proteins (Cry

and Cyt), toxic against an increasing number of insect species from the orders

Lepidoptera, Diptera, Coleoptera, Hymenoptera and Hemiptera, among others,

as well as against other organisms such as mites (Schnepf et al., 1998) and

nematodes (Wei et al., 2003). Bt also synthesizes insecticidal toxins associated to

the vegetative growth phase, named Vip (Vegetative insecticidal protein) and Sip

(Secreted insecticidal protein), which are secreted into the growth medium

(Palma et al., 2014). These toxins are uniquely specific, safe and completely

biodegradable, and have been used for more than 60 years as an alternative to

chemical insecticides (Nester et al., 2002). Products based on Bt isolates are the

most successful microbial insecticides, with current worldwide benefits

estimated in $8 billion annually (Portela-Dussán et al., 2013). The insecticidal

activity of Bt toxins has also been transferred to crop plants through genetic

engineering, providing very-high protection levels against injurious pests and

decreasing the use of chemical insecticides in many instances (Bravo et al., 2011;

James 2017). The success of these insecticidal proteins has fuelled the search for

11

new Bt isolates and proteins that can render novel insecticidal agents with

different specificities.

Ecology, biology and infection

Bacillus thuringiensis is a worldwide distributed Gram-positive sporulating

bacterium. Although Bt is associated to soil environments, the enduring spore

has allowed its adaptation to most habitats, including polar soils (Martin and

Travers 1989). It is also common to find Bt isolates in dust samples from stored

products and in places with high insect densities (Meadows et al., 1992; Kaelin et

al., 1994). In fact, some of the strains used in commercial products have been

isolated from dead insects (Kurstak 1962; Krieg et al., 1983). It is also possible to

find isolates in foliar surfaces (Smith and Couche 1991; Damgaard et al., 1998),

aquatic environments (Goldberg and Margalit 1977) and even in marine

sediments (Maeda et al., 2000).

B. thuringiensis is a facultative pathogenic bacterium that can also grow in the

environment outside its host, although insects are considered the optimal site for

multiplication and exchange of genetic material (Jurat-Fuentes and Jackson

2012). The Bt life cycle can be divided in two phases: the vegetative growth and

the sporulation stages (Schnepf et al., 1998). Cells grow and reproduce as long as

the nutrients are available and form a spore resistant to adverse environmental

conditions. The infective cycle begins once Bt spores along with crystalline

inclusions are ingested by an insect host and reach the midgut, where the

proteins are solubilized and proteolytically activated. The toxins are then able to

bind to specific receptors in the cell membrane and form a pore, that produces

cell lysis (Bravo et al., 2007, 2011) and permits entry of the spores into the

hemocoel where they germinate in the nutrient-rich and neutral-pH hemolymph,

leading to septicaemia (Raymond et al., 2010). Both cell disruption of the insect

12

midgut and septicaemia derived from vegetative growth in the hemocoel, cause

insect death.

Characteristics and classification of B. thuringiensis insecticidal proteins

Since Schnepf and Whiteley (1981) cloned the first cry gene in the early 1980’s,

many others have been described and are now classified according to Crickmore

et al., (2018). This system consists of four ranks based on amino acid sequence

identity, with the maximum values shared by proteins in the primary (Arabic

number), secondary (capital letter) and tertiary (lower case letter) ranks of 45%,

78% and 95% identity, respectively. One last Arabic number is used to indicate

differences in proteins sharing >95% sequence identity (Figure 1). To date, the Bt

Toxin Nomenclature Committee (Crickmore et al., 2019) has reported at least 78

Cry protein groups, from Cry1 to Cry78, divided into at least three

phylogenetically non-related protein subfamilies that may have different modes

of action: the three domain Cry toxins (3D), the mosquitocidal Cry toxins (Mtx),

and the binary-like toxins (Bin) (Reviewed in Bravo and Soberón, 2005;

Crickmore et al.,, 2018).

Figure 1. Schematic overview of current nomenclature (Crickmore et al., 2019)

The largest group, with more than 53 Cry toxin subgroups, is the 3D-Cry. Even

though the sequence identity among these proteins is low, the overall structure

of the three domains is quite similar, providing proteins with different

specificities but with quite similar modes of action (de Maagd et al., 2001). Thus,

13

proteins such as Cry1Aa (Lepidopteran specific) and Cry3Aa (Coleopteran

specific) have a 32.5% identity but a structural similarity as high as 98% (Pardo-

López et al., 2013). Phylogenetic analysis shows that the great variability in the

insecticidal activity of this 3D-group has resulted from the independent

evolution of the three structural domains as well as from the swapping of domain

III between different toxins (de Maagd et al., 2001).

Bacillus thuringiensis against Coleopteran pests.

Coleopteran pests cause serious damage to crops and stored products, leading to

significant economic loses worldwide (Oppert et al., 2010a; Yu et al., 2016). Beetles

are the largest order in the class Insecta, and both, larvae and adults, have strong

jaws, able to feed on a wide variety of plant substrates, such us roots, stems,

leaves, grains or wood. Although most of the proteins described so far show

activity against lepidopteran insects, some Bt proteins have demonstrated

activity against coleopterans (http://www.btnomenclature.info/). To date, 41 Cry

proteins, 2 Cyt proteins, 11 Vip proteins and 2 Sip proteins have been reported

active against Coleopteran pests. In this review we provide an update on the

activity of Bt toxins against coleopteran pests.

14

THE CRYSTAL COLEOPTERAN-ACTIVE PROTEINS

Bt crystal proteins (δ-endotoxins) are produced during the stationary growth

phase and have been isolated from a wide range of insect pests. These crystal

inclusions are usually formed by Cry and Cyt proteins and, as mentioned above,

they are toxic to a wide variety of insect species. Most of the information on the

insecticidal properties has been obtained for the Cry3 family, and only a few data

come from other Cry families. The Cyt proteins constitute a smaller group,

mainly active against dipterans, although some Cyt proteins are toxic to

coleopteran pests and increase the potential damage of certain Cry toxins

(Soberón et al., 2013).

Protein structure and function

As mentioned above, Bt Cry proteins can be basically subdivided into three

different groups according to their homology and molecular structure: the three-

domain group, the ETX/MTX-like and the binary toxins. The 3d-domain proteins

constitute the largest and best studied group, although there is increasing

information on the Non-three-domain and de Cyt proteins.

The three domain group toxins. All 3d-Cry proteins are produced as protoxins

of two main sizes, 130 and 65 kDa. The 130 kDa proteins share a highly conserved

C terminus containing 15-17 cysteine residues, which is dispensable for toxicity

but necessary for the formation of intermolecular disulphide bonds during

crystal formation (Bietlot et al., 1990; de Maagd et al., 2001). This group includes,

among others, Cry1, Cry4 and other coleopteran active toxins such as Cry7A or

Cry8. The structure of the smallest protoxins is quite similar to the N-terminal

half of the largest toxin group. Since these do not contain the C-terminal

extension, they require, in some cases, the presence of accessory proteins for

crystallization (Agaisse and Lereclus 1995; Berry et al., 2002). This second group

15

includes Cry2A, Cry11A and some toxins active against Coleoptera, such as

Cry3A or Cry3B. Proteolytic cleavage of the N-terminal peptide and the C-

terminal extension (in the long Cry protoxins) yields active ≈60 kDa protease-

resistant fragments (de Maagd et al., 2003a). By X-Ray crystallography, the

tertiary structure of seven 3d-Cry domain active proteins, Cry1Aa, Cry2Aa,

Cry3Aa, Cry3Bb, Cry4Aa, Cry4Aa, Cry4Ba and Cry8Ea has been determined (Li

et al., 1991; Grochulski et al., 1995; Galitsky et al., 2001; Morse et al., 2001;

Boonserm et al., 2005, 2006; Guo et al., 2009). Among all, Cry3Aa, Cry3Bb and

Cry8Ea have been defined as coleopteran-specific proteins. Using the FATCAT

server (Ye and Godzik 2004), the structure alignment between these anti-

coleopteran proteins is significantly similar, despite their low sequence identity.

Pardo-López et al., (2013) analysed the structural similarity between Cry1Aa and

the other 3d-Cry proteins aforementioned, indicating the same structural

likeness. The marked similarity in terms of structure of the three domain

proteins, despite the low sequence identity and the differences in specificity, has

rendered different proteins with similar modes of action.

Domain I (pore-forming domain) consists in six α-helix surrounding a

hydrophobic helix-α5. This domain, which shares strong similarities with the

structure of the pore-forming domain of α+PTFs colicin A, might be responsible

for membrane penetration and pore formation. The binding domain II is

constituted by three antiparallel β-sheets packing together and has an important

role in receptor binding affinity. Finally, domain III is a two-twisted anti-parallel

β-sheet and is also involved in receptor binding and pore-formation (de Maagd

et al., 2003a; Xu et al., 2014). Although it has been demonstrated that domains I

and II have co-evolved over the years, swapping by homologous recombination

of domain III has also been reported (de Maagd et al., 2001; Yamaguchi et al.,

2008b). Local alignment of Coleopteran-active Cry3, Cry7 and Cry8 shows that

domain I was strongly conserved while domains II and III diversified

16

(Yamaguchi et al., 2008b). Bt might use this mechanism to get adapted to a new

insect host, which may explain the great variability in the biocidal activity of the

3d-Cry proteins.

Non-Three-Domain Cry toxins. In addition to the 3d-Cry proteins, there are

some unrelated Cry proteins that are also designated by the Cry nomenclature:

The ETX/MTX-like toxins and the Binary (Bin) toxins (Palma et al., 2014). The

structure and function of MTX proteins are still unclear, although the similarities

with the Clostridium perfringens epsilon toxin (close related to aerolysin) seem to

indicate that they may have a β-sheet-based structure and a pore-forming activity

(Bokori-Brown et al., 2011). It is important to notice that, while most of them have

activity by themselves, the MTX-like Cry23 acts as a binary toxin with the Cry37

protein to induce mortality on Tribolium castaeneum (Tenebrionidae) or Popillia

japonica (Scarabaeidae) (Donovan et al., 2000). In addition to Cry23/Cry37, other

binary toxins have been reported. Cry34Ab and Cry35Ab are required to act

together to cause mortality in Diabrotica undecimpunctata (Ellis et al., 2002; Baum

et al., 2004). Crystal structures of Cry35Ab and Cry34Ab have also been

published. Cry35Ab shows an aerolysin-like fold, containing a β-trefoil N-

terminal domain similar to the carbohydrate-binding domain in Mtx1. Cry34Ab

is also a member of the aerolysin family with a β-sandwich fold, common among

other cytolytic proteins (Kelker et al., 2014). These structural similarities, coupled

with the fact that Cry34Ab has some activity against the Western Corn Rootworm

(WCR) on its own (Herman et al., 2002), seem to indicate that Cry35 acts as a

receptor of Cry34, mainly responsible for the toxicity. However, the mechanism

of interaction between proteins is still unknown.

Cyt proteins. Similar to the Cry proteins, Cyt proteins are produced as protoxins

with a proteolytic activated size of around 25 kDa (Soberón et al., 2013).

Characterization of a Cyt1Ca protein suggests a C-terminal end of the Cyt

17

domain similar to a carbohydrate binding domain of ricin, indicating a receptor-

binding ability, but no toxicity was observed for Cyt1Ca (Manasherob et al., 2006).

As with some Cry proteins, the tertiary structure of some Cyt proteins has been

already solved. Cyt1Aa (Cohen et al., 2011), Cyt2Aa (Li et al., 1996) and Cyt2Ba

(Cohen et al., 2008) show a similar structure composed by a single a-b-domain,

with two outer layers of a-helix wrapped around a b-sheet. Studies performed

with peptides of Cyt1A show that a-helix peptides are major structural elements

involved in membrane interaction (Gazit et al., 1997) and also in the

oligomerization process (Promdonkoy et al., 2008), while the b-strand forms an

oligomeric pore with a b-barrel structure into the membrane (Li et al., 1996). Cyt

proteins that enhance the insecticidal damage of certain Cry toxins were also

observed. The Cyt1Aa protein from Bt sub. israelensis increases activity of

Cry11Aa by acting as a membrane receptor for the Cry protein (Pérez et al., 2007).

Cyt1A also supresses high levels of Cry3A resistance against Chrysomela. scripta

(Coleoptera: Chrysomelidae) larvae, although the mechanisms of action have not

been elucidated (B. A. Federici and Bauer 1998). Overall, these data indicate that

synergism by Cyt toxins is an excellent strategy to overcome resistance to Cry

proteins.

Insecticidal activity

As far as is known, the vast majority of Cry proteins described to date are toxic

to lepidopteran pests, but there are also a few crystal proteins toxic to either

coleopteran or dipteran insects, and a small number are toxic to nematodes

(Federici et al., 2006). Currently, 41 Bt proteins have been tested against different

coleopteran insects (Table 1). Single crystal proteins account for most of the

insecticidal activity against coleopteran pests, but there are also a few reports on

the toxicity of binary, Cyt, Vip and Sip proteins.

18

Host range. Cry proteins are toxic to a large number of beetle pests. Mainly, the

Cry3 group, the best studied one, is found to be toxic against most of the

coleopteran species assayed. These Cry proteins, encoded by cry3 genes, were

first discovered in the subspecies tenebrionis (Krieg et al., 1983) and san diego

(Herrnstadt et al., 1986) although, years later, both strains turned out to be the

same serovar (De Barjac and Bonnefoi 1990). Since then, more isolates like Bt

subsp. tolworthi, kumamotoensis or kurstaki (BTI109P) have been reported to

encode a cry3 gene (Rupar et al., 1991; B Lambert et al., 1992). Owing to the well-

known activity to some of the most important coleopteran pests, such as L.

decemlineata or Diabrotica spp., some of these isolates have been developed as

bioinsecticides for beetle control (Federici et al., 2006). Cry3Aa, Cry3Ba, Cry3Bb

and Cry3Ca proteins have demonstrated activity against most of the major

coleopteran families, including Chrysomelidae, Curculionidae, Scarabaeidae and

Tenebrionidae, among others (Table 1). Although Cry3 proteins are the most

effective Bt toxins against chrysomelid beetles, the widespread use of Cry3-based

insecticides and Bt crops has led to the appearance of resistant populations of L.

decemlineata, C. scripta or Diabrotica spp. (Whalon et al., 1993; Bauer 1995;

Gassmann et al., 2011).

Cry7 and Cry8 groups are comparatively less active, but they represent a serious

alternative to Cry3 proteins. Cry7Aa, formerly known as CryIIIC, is very toxic

against the Colorado potato beetle after in vitro solubilization. However, it has no

ill effects against Anthonomus grandis (Curculionidae) or Diabrotica

undecimpuntata (Lambert et al., 1992). In this line, Song et al., (2012) reported that

solubilized Cry7Ab was active against Helosepilachna vigintiomaculata

(Coccinellidae), but not against Anomala corpulenta (Scarabaeidae) or Pyrrhalta

aenescens (Chrysomelidae). In contrast, a high Cry7Aa protoxin activity against

Cylas puncticolis and Cylas brunneus (Brentidae), even higher than that of Cry3,

has been reported (Ekobu et al., 2010). Cry8-type proteins are toxic to a large

19

number of coleopteran pests, particularly against species in the Scarabaeidae

family (Shu et al., 2009b, 2009a; Gindin et al., 2014a). Also, Cry8A and Cry8B

proteins have shown activity against the chrysomelids L. decemlineata and

Diabrotica spp., Cry8Ca against the tenebrionid Alphitobius diaperinus

(Tenebrionidae) (Park et al., 2014a) and Cry8Ka against the curculionid A. grandis

(Oliveira et al., 2011). Moreover, some Cry8 proteins (such as Cry8Ea, and

Cry8Ga) are very specific, showing different activities against very closely related

host species (Yu et al., 2006a). Cry22 proteins also have activity to a wide

spectrum of coleopteran insects. In particular, Cry22A and Cry22B proteins are

toxic to coleopterans of the Brentidae, Chrysomelidae and Curculionidae families

(Mettus and Baum, 2000; Isaac et al., 2002; Ekobu et al., 2010).

Generally, Bt protein groups are particularly toxic to a certain insect order.

However, some proteins may be active against different orders (van

Frankenhuyzen 2013). Mainly lepidopteran proteins Cry1Ba and Cry1Ia have

shown activity against key coleopterans. For example, Cry1Ba has been

described as active against A. grandis (Curculionidae), C. scripta (Chrysomelidae)

and L. decemlineata (Bradley et al.,, 1995; Federici and Bauer, 1998; Martins et al.,,

2010; Naimov et al.,, 2001) and Cry1Ia against L. decemlineata and A. grandis (Tailor

et al., 1992; Naimov et al., 2001; Martins et al., 2007). Dual activity Lepidoptera-

Coleoptera has also been demonstrated by Cry9-type proteins. Cry9 toxins

exhibit strong activity against many major leptidopteran pests, but Cry9Da is

also toxic against the scarab Anomala cuprea (Asano 1996). Other examples of

across-order toxicity are depicted by the dipteran toxin Cry10Aa, which can kill

the cotton boll weevil (A. grandis) (de Souza Aguiar et al., 2012). as Additionally,

Cry51Aa is toxic against Lygus spp. (Hemiptera) and L. decemlineata; (Baum et al.,

2012). Finally, a typical nematicidal protein, Cry55Aa, has been reported as toxic

to the chrysomelid Phyllotreta cruciferae (Bradfisch et al., 2004).

20

Binary toxins, structurally different from classical 3d-Cry proteins (Li et al., 1991),

used to be considered as single toxins because both proteins are required to kill

their target. To date, two binary complex toxins have shown activity against

beetles. The coleopteran specific Cry23A requires Cry37A protein to kill P.

japonica and T. castaeneum (Donovan et al., 2000). On the other hand, Cry34A is

only active in association with Cry35A (Oppert et al., 2010a). Furthermore, Cry34

and Cry35 are closely related and are often encoded in the same operon, with

coordinated function and appearance in crystals (Ellis et al., 2002; Schnepf et al.,

2005).

B. thuringiensis Cyt proteins, have an in vitro cytolytic (hemolytic) activity, hence

their name, and show predominant dipteran specificity (de Maagd et al., 2003a).

However, some are also toxic to certain coleopteran pests, such as Cyt1Aa, to C.

scripta (Federici and Bauer, 1998) or Cyt2Aa to L. decemlineata and Diabrotica spp.

(Rupar et al., 2000). In addition, Cyt proteins improve the activity of Cry proteins.

For instance, Cyt1Aa is able to overcome high levels of resistance to Cry3Aa by

C. Scripta, playing an important role in resistance management (Federici and

Bauer, 1998).

Genetically engineered cry genes. Recent advances in next generation

sequencing and genetic engineering technologies allow the construction of new

synthetic cry genes that increase or amplify their toxicity. The domain regions of

some lepidopteran-specific proteins have been modified in an attempt to

improve their specific activity or broaden their host range (De Maagd et al., 1996;

de Maagd et al., 2001). The first coleopteran hybrid protein was made by fusing

the sequences located in domain III of the cry3A and cry1Aa genes, although

unfortunately, it caused the loss of activity against L. decemlineata (Shadenkov et

al., 1993). Nonetheless, substituting domain III of Cry3Aa with the same domain

from Cry1Ab induced activity against WCR larvae (Walters et al., 2010). On a

21

different approach, a cry3Bb1 gene was engineered with five amino acid

substitutions to produce the new Cry3Bb1.11098 protein, which increased the

activity of the natural protein against WCR (English et al., 2000). Similarly, a

Cry3A variant (eCry3.1Ab) was designed to confer novel activity against

rootworms by creating a cathepsin G protease recognition site (Walters et al.,

2008). This technology has been introduced successfully in the development of

transgenic plants, mainly to overcome the appearance of resistance by WCR

populations (Jouzani et al., 2017).

Mode of action

The mode of action of Crystal toxins has mostly been studied in lepidopteran

insects, although it is believed to be similar between different insect orders, with

some peculiarities (Bravo et al., 2011). Briefly, the process begins once the target

insect ingests the protein and reaches the insect midgut, where it is solubilized

and proteolytically activated. Such an activation allows toxins to first bind to

their specific receptors in the host cell membrane, then to their oligomerization

and eventually to the formation of pores in the cell membrane. In this multi-step

mode of action, several factors may contribute to protein specificity (Jurat-

Fuentes and Crickmore, 2017).

Solubilization and Proteolytic processing. Once proteins reach the host midgut,

they are released from their crystal package to initiate the intoxication process. It

is well accepted that solubilization processes are due to the environmental

conditions in the susceptible insect midgut, mainly to pH values. Noteworthy,

unlike the alkaline midgut of lepidopteran and dipteran insects , beetles have an

acidic midgut, suggesting that different solubilization conditions are needed for

each protein (Koller et al., 1992). For instance, the midgut fluids of L. decemlineata

and D. virgifera larvae do not seem to solubilize Cry1B and Cry7Aa1, and only

after these proteins undergo a previous in vitro solubilisation, they become active

22

against them (B Lambert et al., 1992; Bradley et al., 1995). Cyt proteins dissolve

readily under alkaline conditions, especially at pH 8 or higher, and are harder to

solubilized in neutral or slightly acidic pHs as occurs in coleopteran midguts

(Federici and Bauer, 1998). Another example of the importance of crystal

solubilization was published by Galitsky et al. (2001), who related that differences

in toxin solubility, oligomerization and binding for the Cry3-type toxins, in

addition to differences in domain III, might explain the different specificities of

Cry3A and Cry3B (eg. WCR is susceptible to Cry3Bb1 but not to Cry3A).

Solubilized proteins are proteolytically activated by gut proteases, which

generate the toxic three-domain fragment of about 65 kDa, (Bravo et al., 2007).

While the main proteases present in Lepidoptera and Diptera are serine

proteases, the main proteases of Coleoptera are cysteine and aspartic proteases

(Michaud et al., 1995).

Binding to the larval midgut epithelium. The activated toxin is able to bind to

specific receptors located in the midgut epithelial cells to form an oligomeric

prepore structure. To date, several specific coleopteran binding proteins have

been identified. One study has demonstrated that an ADAM metalloprotease acts

as a Cry3Aa receptor in Leptinotarsa decemlineata, proving that this binding

interaction improves Cry3Aa pore-formation (Ochoa-Campuzano et al., 2007).

GPI-anchored alkaline phosphatases (ALP) are important for the Cry3Aa binding

to Tenebrio molitor brush border membrane vesicles (BBMV) and are highly

expressed when larvae are exposed to Cry3Aa (Zúñiga-Navarrete et al., 2013). In

the same way, the Cry1Ba toxin binds to ALPs from A. grandis midgut cells

(Martins et al., 2010). Although some putative cadherines have been previously

described (Siegfried et al., 2005; Sayed et al., 2007), Fabrick et al., (Fabrick et al.,

2009) were the first reporting a cadherin protein (TmCad1), cloned from T. molitor

larval midgut, as a Cry3Aa binding receptor. Furthermore, injection of TmCad1

dsRNA into T. molitor larvae conferred resistance to Cry3Aa (Fabrick et al., 2009).

23

A truncated cadherin protein (DvCad1-CR8–10), isolated from the WCR binds to

activated Cry3Aa, Cry3Bb (Park et al., 2009), and also Cry8Ca (Park et al., 2014a),

enhancing the activity of L. decemlineata, Diabrotica spp. and A. diaperinus. In T.

castaeneum larvae, a cadherine (TcCad1) and a sodium solute symporter (TcSSS)

have been identified as putative Cry3Ba functional receptors, determinant for the

specific Cry protein toxicity against Coleopterans (Contreras et al., 2013b).

Oligomerization and pore formation. Oligomerization of 3d-Cry proteins have

been described for toxins active against different insect orders, such as Cry3 in

coleopteran larvae. In the brush border membranes (BBMV) of L. decemlineata a

Cry3 oligomer is formed before membrane insertion, forming a pre-pore

structure that can be inserted in the membrane (Rausell et al., 2004). The

oligomeric structure eventually leads to the lytic pore formation that disrupts the

midgut insect cell by osmotic shock. Additional to the toxin action, spores may

pass through the channel, to colonize and germinate in the hemolymph and

contribute to insect death by septicemia (Raymond et al., 2010).

24

Table 1. Insecticidal activity against of Cry and Cyt proteins against coleopteran pest previously described in the literature.

Cry-type toxin

Target insect

Activity (a)

LC50 (b)

Reference Scientific name Family (µg/ml)

Cry1Aa Apriona germari Cerambycidae N (Chen et al., 2005)

Anoplophora glabripennis Cerambycidae N (D’Amico et al., 2004)

Epilachna varivestis Coccinellidae N (Peña et al., 2006)

Cry1Ab Hypera postica Curculionidae N (MacIntosh et al., 1990)

Anthonomus grandis Curculionidae N (MacIntosh et al., 1990)

Adalia bipunctata Coccinellidae N (Porcar et al., 2010)

Atheta coriaria Coccinellidae N (Porcar et al., 2010)

Cryptolaemus montrouzieri Coccinellidae N (Porcar et al., 2010)

Popillia japonica Scarabaeidae N (MacIntosh et al., 1990)

Phyllotreta armoraciae Chrysomelidae N (MacIntosh et al., 1990)

Diabrotica undecimpuntata Chrysomelidae N (MacIntosh et al., 1990)

Leptinotarsa decemlineata Chrysomelidae N (MacIntosh et al., 1990)

Cry1Ac Hippodamia convergens Coccinellidae N (Sims et al.,, 1995)

Hypera postica Curculionidae N (MacIntosh et al., 1990) (Sharma et al., 2011)




Diabrotica undecimpuntata Chrysomelidae N (MacIntosh et al., 1990)

Leptinotarsa decemlineata Chrysomelidae N (MacIntosh et al., 1990)

Hypothenemus hampei Curculionidae N (López-Pazos et al., 2010)

Tribolium castaneum Tenebrionidae N (Contreras et al., 2013a)

Cry1Ba Anoplophora glabripennis Cerambycidae N (D’Amico et al., 2004)

Anthonomus grandis Curculionidae A 305.32 (Martins et al., 2010)

Asymmathetes vulcanorum Curculionidae N (Gómez et al., 2012)

Chrysomela scripta F Chrysomelidae A 1.8 - 5.9 (Bradley et al., 1995) (Federici and Bauer 1998)

Hypothenemus hampei Curculionidae N (López-Pazos et al., 2010)

Leptinotarsa decemlineata Chrysomelidae A 142 (Bradley et al., 1995) (Naimov et al., 2001)

Phaedon cochleariae Chrysomelidae N (Zhong et al., 2000)

Cry1F Cryptolestes pusillus Laemophloeidae N (Oppert et al., 2010b)

Tribolium castaneum Tenebrionidae N (Oppert et al., 2010b)

Cry1Ia Asymmathetes vulcanorum Curculionidae N (Gómez et al., 2012)

Diabrotica undecimpuntata Chrysomelidae N (Kostichka et al., 1996)

Leptinotarsa decemlineata Chrysomelidae N (Kostichka et al., 1996)

Phaedom brassicae Chrysomelidae N (Shin et al., 1995)

Anthonomus grandis Curculionidae A 21.5 (Martins et al., 2007)

Anthonomus grandis Curculionidae A 230 (Grossi-de-Sa et al., 2007)

Agelastica coerulea Chrysomelidae N (Shin et al., 1995) (Choi et al., 2000)

Leptinotarsa decemlineata Chrysomelidae A 33.7 (Naimov et al., 2001) (Tailor et al., 1992)

Tenebrio molitor Tenebrionidae N (Gleave et al., 1993)

Leptinotarsa decemlineata Chrysomelidae A 10 (Ruiz de Escudero et al., 2006)

Cry1Ib Phaedom brassicae Chrysomelidae N (Shin et al., 1995)

Agelastica coerulea Chrysomelidae N (Shin et al., 1995)

Cry1Id Agelastica coerulea Chrysomelidae N (Choi et al., 2000)

25

Cry1Ie Pyrrhalta aenescens Chrysomelidae N (Song et al., 2003)

Cry1Jb Diabrotica undecimpuntata Chrysomelidae N (von Tersch and Gonzalez 1994)

Leptinotarsa decemlineata Chrysomelidae N (von Tersch and Gonzalez 1994)

Cry2Aa Anthonomus grandis Curculionidae N (Sims 1997)

Diabrotica undecimpuntata Chrysomelidae N (Sims 1997)

Diabrotica virgifera Chrysomelidae N (Sims 1997)

Hippodamia convergens Coccinellidae N (Sims 1997)

Leptinotarsa decemlineata Chrysomelidae N (Sims 1997)

Cry3Aa Cylas brunneus Brentidae A 1.88 µg/g (Ekobu et al., 2010)

Cylas puncticollis Brentidae A 1.99 µg/g (Ekobu et al., 2010)

Alphitobius diaperinus Tenebrionidae A 8-9.5 µg/cm2 (Park et al., 2014b) (Adang 2011)

Apriona germari Cerambycidae A High level (Chen et al., 2005) (Zhongkamg et al., 2008)

Asymmathetes vulcanorum Curculionidae N (Gómez et al., 2012)

Adalia bipunctata Coccinellidae N (Porcar et al., 2010)

Atheta coriaria Coccinellidae N (Porcar et al., 2010)

Cryptolaemus montrouzieri Coccinellidae N (Porcar et al., 2010)

Chrysomela scripta F Chrysomelidae A <10 (James et al., 1999)

Chrysomela scripta F Chrysomelidae A 2.22 - 1.8 (Bradley et al., 1995) (Federici and Bauer 1998)

Colaphellus bowringi Chrysomelidae A 2.68 - 1.33 (Yan et al., 2009) (Gao et al., 2011)

Crioceris quaturdicerumpunctata Chrysomelidae A 3.82 (Gao et al., 2011)

Phaedom brassicae Chrysomelidae A 1.11 (Gao et al., 2011)

Diabrotica undecimpuntata Chrysomelidae N (MacIntosh et al., 1990) (Park et al., 2009)

Diabrotica virgifera Chrysomelidae N (Park et al., 2009) (Li et al., 2013)

Epilachna varivestis Coccinellidae A (Peña et al., 2006)

Hypera postica Curculionidae N (MacIntosh et al., 1990)

Leptinotarsa decemlineata Chrysomelidae A 3.56 – 0.65 (MacIntosh et al., 1990) (Park et al., 2009)




Solenopsis invicta Formicidae A 0.07 (Frankenhuyzen 2009)

Anomala corpulenta Scarabaeidae N (Yan et al., 2009)

Myllocerus undecimpustulatus Curculionidae A 152 ng/cm2 (Mahadeva Swamy et al., 2013)

Phaedon cochleariae Chrysomelidae A (Carroll et al., 1989)

Plagiodera versicolora Chrysomelidae A 3.09 (Yu et al., 2016)

Pyrrhalta aenescens Chrysomelidae A 0.22 (Wang et al., 2006)

Pyrrhalta luteola Chrysomelidae A 0.12 µg/cm2 (Herrnstadt et al., 1986)

Rhyzopherta dominica Bostrichidae A 1.177 µg/mg (Oppert et al., 2011)

Tribolium castaneum Tenebrionidae N (Oppert et al., 2011) (Contreras et al., 2013a)

Tenebrio molitor Tenebrionidae A 11.4 µg/larva (Wu and Dean 1996)

Tenebrio molitor Tenebrionidae A (Oppert et al., 2011) (Carroll et al., 1989)

Cry3Ba Cylas brunneus Brentidae A 1.304 µg/g (Ekobu et al., 2010)


Chrysomela scripta F Chrysomelidae A 10 (James et al., 1999)

Diabrotica undecimpuntata Chrysomelidae A 107 ng/mm2 (Donovan et al., 1992)

Leptinotarsa decemlineata Chrysomelidae A 1.35 (Donovan et al., 1992)

Epilachna varivestis Coccinellidae N (Peña et al., 2006)

Popillia japonica Scarabaeidae A 1 (Donovan et al., 2000)

26

Tribolium castaneum Tenebrionidae A 13.553 (Contreras et al., 2013a) (Donovan et al., 2000)

Cry3Bb Cylas brunneus Brentidae A 1.826 µg/g (Ekobu et al., 2010)



Diabrotica undecimpuntata Chrysomelidae A 9.49 - 1.18 (Park et al., 2009) (Adang and Abdullah 2013)

Diabrotica virgifera Chrysomelidae A 2.10 - 5.18 (Park et al., 2009) (Adang and Abdullah 2013)

Leptinotarsa decemlineata Chrysomelidae A 6.86 - 6.54 (Park et al., 2009) (Adang and Abdullah 2013)

Alphitobius diaperinus Tenebrionidae A 26-50 µg/cm2 (Park et al., 2014b) (Adang 2011)

Cry3Ca Cylas brunneus Brentidae A 0.696 µg/g (Ekobu et al., 2010)


Leptinotarsa decemlineata Chrysomelidae A 0.7 : 320.13 (Lambert et al., 1992b)(Haffani et al., 2001)


Cry6Aa Diabrotica virgifera Chrysomelidae A (Li et al., 2013) (Thomson et al., 1999)

Cry6B Hypera postica Curculionidae A 280 (Sharma et al., 2011)

Cry7Aa Cylas brunneus Brentidae A 0,435 µg/g (Ekobu et al., 2010)

Cylas puncticollis Brentidae A 0,335 µg/g (Ekobu et al., 2010)

Anthonomus grandis Curculionidae N (Lambert et al., 1992)


Diabrotica undecimpuntata Chrysomelidae N (Bart Lambert et al., 1992a)

Leptinotarsa decemlineata Chrysomelidae A 13.1 (Bart Lambert et al., 1992a)

Cry7Ab Anomala corpulenta Scarabaeidae N (Song et al., 2012b)

Henosepilachna vigintioctomaculata Coccinellidae A 209 (Song et al., 2012b)

Pyrrhalta aenescens Chrysomelidae N (Song et al., 2012b)

Cry8Aa Leptinotarsa decemlineata Chrysomelidae A (Foncerrada et al., 1992)

Cotinis spp Scarabaeidae A (Michaels et al., 1996)

Cry8Ab Holotrichia oblita Scarabaeidae A 5.72 µg/g (Zhang et al.,, 2013)

Holotrichia parallela Scarabaeidae A 2.00 µg/g (Zhang et al.,, 2013)

Tenebrio molitor Tenebrionidae N (Zhang et al.,, 2013)

Cry8Ba Diabrotica virgifera Chrysomelidae A (Li et al.,, 2013)

Cotinis spp Scarabaeidae A (Michaels et al., 1993)

Cyclocephala borealis Scarabaeidae A (Michaels et al., 1996)

Cyclocephala pasadenae Scarabaeidae A (Michaels et al., 1996)

Popillia japonica Scarabaeidae A (Michaels et al., 1996)

Cry8Bb Diabrotica undecimpuntata Chrysomelidae A (Abad et al., 2002)

Diabrotica virgifera Chrysomelidae A (Abad et al., 2002)

Leptinotarsa decemlineata Chrysomelidae A (Abad et al., 2002)

Cry8Ca Epilachna varivestis Coccinellidae A (Peña et al., 2006)


Popillia japonica Scarabaeidae A 12.3 µg/g (Yamaguchi et al., 2008a)

Alphitobius diaperinus Tenebrionidae A 7-10 µg/cm2 (Park et al., 2014b)(Adang 2011)

Leptinotarsa decemlineata Chrysomelidae N (Yan et al., 2009)

Colaphellus bowringi Chrysomelidae N (Yan et al., 2009)

Anomala cuprea Scarabaeidae A (Sato et al., 1994)

Anomala corpulenta Scarabaeidae A 1.08x10e8 CFU/g

(Yan et al., 2009)

Anomala corpulenta Scarabaeidae A 1.6x10e8 CFU/g

(Liu et al., 2010) (Shu et al., 2007) (Jia et al., 2014)

Holotrichia parallela Scarabaeidae A 9.24x10e8 CFU/g

(Jia et al., 2014)

27

Anomala exoleta Scarabaeidae A (Huang et al., 2007)

Cry8Da Popillia japonica Scarabaeidae A 17.0 µg/g (Yamaguchi et al., 2008a) (Asano et al., 2003)

Anomala cuprea Scarabaeidae A (Asano et al., 2003)

Anomala orientalis Scarabaeidae A (Asano et al., 2003)

Cry8Db Popillia japonica Scarabaeidae A 19.6 µg/g (Yamaguchi et al., 2008a)

Cry8Ea Tenebrio molitor Tenebrionidae N (Yu et al., 2006b)

Tribolium castaneum Tenebrionidae N (Yu et al., 2006b)

Anomala corpulenta Scarabaeidae A (Jia et al., 2014)

Holotrichia parallela Scarabaeidae A 1.18x10e7 CFU/g

(Yu et al., 2006b)(Shu et al., 2009b) (Huang et al., 2007)

Cry8Fa Tenebrio molitor Tenebrionidae N (Yu et al., 2006b)


Anomala corpulenta Scarabaeidae N (Shu et al., 2009b)

Holotrichia oblita Scarabaeidae N (Shu et al., 2009b)

Holotrichia parallela Scarabaeidae N (Shu et al., 2009b)

Cry8Ga Tenebrio molitor Tenebrionidae N (Yu et al., 2006b)


Anomala corpulenta Scarabaeidae N (Jia et al., 2014)

Holotrichia oblita Scarabaeidae A 3.17x10e7

CFU/g (Jia et al., 2014)

Holotrichia parallela Scarabaeidae N (Jia et al., 2014)

Cry8Ka Anthonomus grandis Curculionidae A 8.93 µg/mL (Oliveira et al., 2011)

Anthonomus grandis Curculionidae A 2.83 µg/mL (Oliveira et al., 2011)

Cry8Sa Holotrichia serrata (F.) Scarabaeidae A (Singaravelu et al., 2013)

Cry9Bb Diabrotica undecimpuntata Chrysomelidae N (Silva-Werneck and Ellar 2008)

Diabrotica virgifera Chrysomelidae N (Silva-Werneck and Ellar 2008)

Leptinotarsa decemlineata Chrysomelidae N (Silva-Werneck and Ellar 2008)

Anthonomus grandis Curculionidae N (Silva-Werneck and Ellar 2008)

Cry9Da Anomala cuprea Scarabaeidae A (Asano 1996)

Cry10Aa Anthonomus grandis Curculionidae A 7.12 (de Souza Aguiar et al., 2012)

Cry15Aa Leptinotarsa decemlineata Chrysomelidae N (Brown and Whiteley 1992)

Cry18Aa1 Melontha melontha Scarabaeidae A (Zhang et al., 1997)

Cry22Aa Cylas brunneus Brentidae A 1.014 µg/g (Ekobu et al., 2010)


Anthonomus grandis Curculionidae A 0.75 µg/well (Isaac et al., 2002)

Cry22Ab Diabrotica virgifera Chrysomelidae A 39.4 µg/cm2 (Mettus and Baum 2000)

Diabrotica undecimpuntata Chrysomelidae N (Mettus and Baum 2000)

Leptinotarsa decemlineata Chrysomelidae N (Mettus and Baum 2000)

Anthonomus grandis Curculionidae A 3.12 µg/well (Isaac et al., 2002)

Cry22Ba Diabrotica virgifera Chrysomelidae N (Isaac et al., 2002)

Anthonomus grandis Curculionidae A (Isaac et al., 2002)

Cry23Aa Popillia japonica Scarabaeidae N (Donovan et al., 2000)

Tribolium castaneum Tenebrionidae N (Donovan et al., 2000)

Cry23Aa/Cry37Aa Cylas brunneus Brentidae A 0.458 µg/g (Ekobu et al., 2010)


Popillia japonica Scarabaeidae A (Donovan et al., 2000)

Tribolium castaneum Tenebrionidae A (Donovan et al., 2000)

28

Tribolium castaneum Tenebrionidae A 6.30 µg SC/µL (Gindin et al., 2014)

Cry34Aa Diabrotica virgifera Chrysomelidae N (R T Ellis et al., 2002)

Cry34Ab Diabrotica undecimpuntata Chrysomelidae N (Herman et al., 2002)

Diabrotica virgifera Chrysomelidae N (Moellenbeck et al., 2001)(R T Ellis et al., 2002)

Cry34Ac Diabrotica virgifera Chrysomelidae N (R T Ellis et al., 2002)

Cry34Aa/Cry35Aa Diabrotica virgifera Chrysomelidae A 34-37 µg/cm2 (R T Ellis et al., 2002) (Schnepf et al., 2005)

Diabrotica undecimpuntata Chrysomelidae A 34.1 µg/well (Rupar et al., 2009)

Cry34Ab/Cry35Ab Diabrotica undecimpuntata Chrysomelidae A (Baum et al., 2004) (Herman et al., 2002)

Diabrotica virgifera Chrysomelidae A 3-17 µg/cm2 ((Moellenbeck et al., 2001) (R T Ellis et al., 2002)

Rhyzopherta dominica Bostrichidae N (Oppert et al., 2010b)

Oryzaephilus surinamensis Cucujidae A (Oppert et al., 2010b)

Sitophilus oryzae Curculionidae A (Oppert et al., 2010b)

Trogoderma variabile Dermestidae N (Oppert et al., 2010b)

Tenebrio molitor Tenebrionidae A 0.22 (Oppert et al., 2010b)

Tribolium castaneum Tenebrionidae A (Oppert et al., 2010b)


Cry34Ac/Cry35Ac Diabrotica virgifera Chrysomelidae A 7 µg/cm2 (Schnepf et al., 2005) (R T Ellis et al., 2002)

Cry34Ba/Cry35Ba Diabrotica virgifera Chrysomelidae N (Schnepf et al., 2005) (Baum et al., 2004)

Cry35Aa Diabrotica virgifera Chrysomelidae N (R T Ellis et al., 2002)

Cry35Ab Diabrotica virgifera Chrysomelidae N (Moellenbeck et al., 2001) (R T Ellis et al., 2002)

Cry35Ac Diabrotica virgifera Chrysomelidae N (R T Ellis et al., 2002)

Cry35Ba Sitophilus oryzae Curculionidae A (da Silva et al., 2010)

Cry36A Diabrotica virgifera Chrysomelidae A 147.3 µg/well (Rupar et al., 2009)

Cry37Aa Popillia japonica Scarabaeidae N (Donovan et al., 2000)

Tribolium castaneum Tenebrionidae N (Donovan et al., 2000)

Cry38Aa Diabrotica virgifera Chrysomelidae N (Baum et al., 2004)

Cry43Aa Anomala cuprea Scarabaeidae A (Yokoyama et al., 2004)

Cry43Ba Anomala cuprea Scarabaeidae N (Yokoyama et al., 2004)

Cry51Aa Leptinotarsa decemlineata Chrysomelidae A 26 µg/cm2 (Baum et al., 2012)

Diabrotica undecimpuntata Chrysomelidae N (Baum et al., 2012)

Diabrotica virgifera Chrysomelidae N (Baum et al., 2012)

Cry55Aa Phyllotreta cruciferae Chrysomelidae A (Bradfisch et al., 2004)

Cyt1Aa Chrysomela scripta F Chrysomelidae A 2.5 (B. a. Federici and Bauer 1998)

Cyt2Ca Diabrotica undecimpuntata Chrysomelidae A 25 µg/well (Rupar et al., 2000)

Diabrotica virgifera Chrysomelidae A 10.8 µg/well (Rupar et al., 2000)

Leptinotarsa decemlineata Chrysomelidae A 8.75 µg/well (Rupar et al., 2000)

Popillia japonica Scarabaeidae A (Rupar et al., 2000)

Tribolium castaneum Tenebrionidae A (Rupar et al., 2000)

(a) A= Active; N= Not active

(b) LC50=lethal concentration that causes 50% mortality of the insects. Data expressed in µg/ml of crystal-spore mixture, unless otherwise stated

1

29

THE SECRETABLE COLEOPTERAN-ACTIVE PROTEINS 2

In addition to the �-endotoxins produced during the stationary phase, other 3

protein compounds have been found in the culture supernatant from certain 4

entomopathogenic Bacillus isolates. These proteins, produced during the 5

vegetative growth stage of the bacterium, were designated as vegetative 6

insecticidal proteins (Vip) (Warren et al., 1996) and secreted insecticidal proteins 7

(Sip) (Donovan et al., 2006). Vip1 and Vip2 act as binary toxins for some members 8

of the Coleoptera (Warren et al., 1996) and Hemiptera (Sattar and Maiti, 2011) 9

orders. In contrast, Vip3 proteins are single-chain toxins with insecticidal activity 10

against a wide range of lepidopteran species (Estruch et al., 1996). While B. 11

thuringiensis is a good source of Vip proteins, these proteins have also been found 12

in other closely related bacteria, such as Bacillus cereus, Lysinibacillus sphaericus or 13

Brevibacillus leterosporus. Currently, two Sip proteins have been described, both 14

active against several coleopteran pests. The fact that strains harbouring sip1Aa 15

and sip1Ab genes also synthetize cry3 and cry8 genes respectively, suggest that 16

Sip1 proteins may have a role in the insecticidal mechanism against coleopteran 17

insects (Sha et al., 2018). 18

Protein structure and function 19

Vip1, Vip2 and Sip1 proteins are found in the culture supernatant before cell lysis 20

due to specific secretion (Warren, 1997; Donovan et al., 2006). Both proteins have 21

an N-terminal signal peptide for secretion, commonly cleaved after the secretion 22

process is completed (de Maagd et al., 2003b; Donovan et al., 2006). The Vip1/Vip2 23

homology with other bacterial binary toxins and the fact that these proteins are 24

codified by two genes encoded in a single operon, suggest the presence of a 25

typical “A+B” binary toxin (Warren 1997; de Maagd et al., 2003a). It has been 26

proposed that Vip1, with moderate sequence identity (30%) and structural 27

similarity with the binding C2-II Clostridium botulinum toxin and the toxin “B” of 28

30

Clostridium difficile, is the binding domain that translocates Vip2, similar to the 29

Rho-ADP-ribosylatin exotoxin C3 of Clostridium spp., to the host cell (Han et al., 30

1999; Shi et al., 2007). As occurs with other related “B” compounds, Vip1 is 31

formed by four domains involved in docking to enzymatic components, binding 32

to specific cell surface receptors, oligomerization and channel formation in lipid 33

membranes (Barth et al., 2004). 34

Insecticidal activity 35

The activity of the Bt secretable toxins against coleopterans is depicted in Table 36

2. Currently, four Vip protein families have been identified, but only Vip1/Vip2 37

show with activity against coleopteran pests (reviewed by Chakroun et al., 2016). 38

Vip1/Vip2 proteins have been tested against different coleopteran families but 39

they have shown activity against only the Chrysomelidae and Scarabeidae families. 40

Moreover, these proteins were particularly toxic to corn rootworms. Single Vip1 41

or Vip2 showed no mortality, confirming that these proteins must act together to 42

be toxic (Warren, 1997). Vip1Aa is highly toxic against Diabrotica spp. when 43

combined with Vip2Aa or Vip2Ab, but Vip1Ab/Vip2Ab (co-expressed in the 44

same operon) and Vip1Ab/Vip2Aa were not active (Warren, 1997). These data 45

show the specificity of these proteins and suggest that absence of toxicity is due 46

to Vip1Ab. Moreover, Vip1Ba/Vip2Ba and Vip1Bb/Vip1Ba are toxic against 47

Diabrotica virgifera virgifera (Feitelson et al., 2001), and binary Vip1Da/Vip1Ad 48

against the curculionid A. grandis and the chrysomelids Diabrotica spp. and L. 49

decemlineata (Boets et al., 2011), being the only Vip proteins active against the 50

Colorado potato beetle. Sip1Aa and Sip1Ab proteins have specific activity against 51

coleopteran pests. Sip1Aa caused lethal toxicity for L. decemlineata larvae and 52

stunting in D. virgifera and D. undecimpunctata larvae (Donovan et al., 2006). 53

Sip1Ab is also toxic to Colaphellus bowringi Baly (Chrysomelidae) but it does not 54

harm Hloltrichia diomphalia (Scarabaeidae) larvae (Sha et al., 2018) suggesting 55

31

specific chrysomelid activity, although further studies are needed to determine 56

its host range. 57

Mode of action 58

The mode of action of coleopteran-specific Bt secretable proteins is poorly 59

understood, but some information is available for this binary mechanism of 60

action. The proposed multistep process begins with the ingestion of the two 61

toxins by the susceptible larvae. Though the two encoded proteins are 62

synthetized together, they are thought not to get associated in solution and reach 63

the insect midgut as single proteins (Barth et al., 2004). Then, the proteolytic 64

processing of Vip1 allows the cell-bound “B” to bind to a specific membrane 65

receptor, followed by formation of oligomers containing seven Vip1 molecules. 66

It is at this stage when the docking between Vip1 and Vip2 translocates the toxic 67

component (Vip2) into the cytoplasm though the “B” (Vip1) channel (Barth et al., 68

2004). Once inside the cytosol, Vip2 destroys filamentous actin by blocking its 69

polymerization and leading to cell death (Shi et al., 2004). 70

Sip1 proteins have no homology with Vip proteins, but Sip1A exhibits limited 71

sequence similarity with the 36-kDa mosquitocidal Mtx3 protein of B. sphaericus, 72

suggesting that toxicity is related with pore formation (Donovan et al., 2006). 73

32

74

Table 2. Insecticidal activity against of Vip and Sip proteins against coleopteran pest previously described in the literature.

(a) A= Active; N= Not active

(b) LC50=lethal concentration that causes 50% mortality of the insects. Data expressed in µg/ml of crystal-spore mixture, unless otherwise stated

Vip-Sip-type toxin

Target insect

Activity (a)

LC50 (b)

Reference Scientific name Family (µg/ml)

Sip1Aa Diabrotica undecimpuntata Chrysomelidae A (Donovan et al., 2006) Diabrotica virgifera Chrysomelidae A (Donovan et al., 2006) Leptinotarsa decemlineata Chrysomelidae A 24 (Donovan et al., 2006) Colaphellus bowringi Chrysomelidae A 1.067 (Sha et al., 2018) Sip1Ab Colaphellus bowringi Chrysomelidae A 1.051 (Sha et al., 2018) Hloltrichia diomphalia Scarabaeidae N (Sha et al., 2018)

Vip1Aa Diabrotica undecimpuntata Chrysomelidae A (Warren et al., 1996) Diabrotica longicornis B. Chrysomelidae A (Warren et al., 1996) Diabrotica virgifera Chrysomelidae N (Warren, 1997) Vip1Ac Holotrichia oblita Scarabaeidae N (Yu et al., 2011) Tenebrio molitor Tenebrionidae N (Shi et al., 2004) Vip1Ad Anomala corpulenta Scarabaeidae N (Bi et al., 2015) Holotrichia oblita Scarabaeidae N (Bi et al., 2015) Holotrichia parallela Scarabaeidae N (Bi et al., 2015) Vip1Da Diabrotica virgifera Chrysomelidae N (Boets et al., 2011) Vip2Aa Diabrotica virgifera Chrysomelidae N (Warren 1997) Vip2Ac Tenebrio molitor Tenebrionidae N (Shi et al., 2004) Vip2Ad Diabrotica virgifera Chrysomelidae N (Boets et al., 2011) Vip2Ae Holotrichia oblita Scarabaeidae N (Yu et al., 2011) Tenebrio molitor Tenebrionidae N (Yu et al., 2011) Vip2Ag Anomala corpulenta Scarabaeidae N (Bi et al., 2015) Holotrichia oblita Scarabaeidae N (Bi et al., 2015) Holotrichia parallela Scarabaeidae N (Bi et al., 2015)

Vip1Aa+Vip2Aa Diabrotica longicornis B. Chrysomelidae A (Warren, 1997) Diabrotica undecimpuntata Chrysomelidae A (Warren, 1997) Diabrotica virgifera Chrysomelidae A (Warren, 1997) Leptinotarsa decemlineata Chrysomelidae N (Warren, 1997) Tenebrio molitor Tenebrionidae N (Warren, 1997) Vip1Aa+Vip2Ab Diabrotica virgifera Chrysomelidae A (Warren, 1997) Vip1Ab+Vip2Aa Diabrotica virgifera Chrysomelidae N (Warren, 1997) Vip1Ab+Vip2Ab Diabrotica virgifera Chrysomelidae N (Warren, 1997) Vip1Ac+Vip2Ac Tenebrio molitor Tenebrionidae N (Shi et al., 2004) Vip1Ac+Vip2Ae Holotrichia oblita Scarabaeidae N (Yu et al., 2011) Tenebrio molitor Tenebrionidae N (Yu et al., 2011) Vip1Ad+Vip2Ag Anomala corpulenta Scarabaeidae A 220 ng/g suelo (Bi et al., 2015) Holotrichia oblita Scarabaeidae A 120 ng/g suelo (Bi et al., 2015) Holotrichia parallela Scarabaeidae A 80 ng/g suelo (Bi et al., 2015) Vip1Ca+Vip2Aa Tenebrio molitor Tenebrionidae N (Shi et al., 2007) Vip1Da+Vip2Ad Anthonomus grandis Curculionidae A 207 (Boets et al., 2011) Diabrotica longicornis B. Chrysomelidae A 213 (Boets et al., 2011) Diabrotica undecimpuntata Chrysomelidae A 4.91 (Boets et al., 2011) Diabrotica virgifera Chrysomelidae A 437 (Boets et al., 2011) Leptinotarsa decemlineata Chrysomelidae A 37 (Boets et al., 2011) Vip1Ba+Vip2Ba Diabrotica virgifera Chrysomelidae A (Feitelson et al., 2001) Vip1Bb+Vip2Bb Diabrotica virgifera Chrysomelidae A (Feitelson et al., 2001)

Vip3Aa Tenebrio molitor Tenebrionidae N (Baranek et al., 2015) Tenebrio molitor Tenebrionidae N (Baranek et al., 2015)

33

BT-BASED INSECTICIDES

In 1938, the first insecticide based on B. thuringiensis was produced and marketed

under the name Sporéine for the control of lepidopteran insect pests (Federici et

al., 2006). Since then, sporulated cultures of B. thuringiensis have been used

widely as foliar sprays to protect crops from insect damage. Since B. thuringiensis

var. tenerbrionis was discovered (Krieg et al., 1983), it was rapidly formulated as a

bioinsecticide and commercialized against the Colorado potato beetle. Bt-based

insecticides to control coleopteran pests are mainly developed against

chrysomelid beetles (Wraight et al., 2009). Novodor® (Kenogard) uses the NB-176

strain of Bt subsp tenebrionis as the active ingredient and is widely used for the

control of L. decemlineata. However, this commercial product is useful for the

control of other beetles, such as the Chrysomelids Chrysophtharta bimaculata, C.

agricola and C. scripta (Coyle et al., 2000; Beveridge and Elek, 2001) or Lissorhoptrus

oryzophilus (Curculionidae) (Way et al., 1999) under laboratory conditions.

To date, most of the Bt-based bioinsecticide products effectively use natural Bt

strains for the control of foliar-feeding pests. However, several factors have

limited their use. Usually, Bt strains have a narrow insecticidal spectrum

compared with other insecticides, even when insects are closely related (Baum

and Johnson 1999). Advances in genetic manipulation technologies offer

improvements in the efficiency of Bt-based formulates and reductions in their

production costs. Development of new strains by conjugation or transduction

have been used to confer natural strains new insecticidal properties (Sanchis,

2011). The natural Bt serovar kurstaki, for example, has been modified to express

several cry3 genes and extend its host range to both lepidopteran and coleopteran

pests (Baum and Johnson 1999). The active ingredient in Foil® is the Bt strain

EG2424, expressing both Cry1Ac and Cry3A proteins, the latter of which was

transferred from a Cry3Aa-encoding plasmid belonging to the Bt serovar

34

morrisoni (Gawron-burke and Baum 1991). Similarly, the Cry3-overproducing

strain, EG7673, was obtained by transforming a natural strain with a recombinant

plasmid containing a cry3Bb1 gene. A formulation with this strain as the active

ingredient was commercialized as Raven® and was four-fold more active than the

parental strain (Baum et al., 1996).

BT-CROPS

By expressing one or more Bt toxic genes in a target plant tissue transgenic insect-

resistant crops, Bt crops, can be produced. Such cultivars need no further pest

control measures. To date, the area occupied by Bt crops has increased

worldwide, particularly that of Bt cotton, Bt rice and Bt corn (James, 2017). Bt

plants have been created for the control of several insect pests, among others,

Colorado potato beetle (L. decemlineata) and Corn Rootworm (Diabrotica spp.).

The first human-modified pesticide-producing crop was potato, that expressed

the cry3A gene from B. thuringiensis var. tenebrionis in their leaves (Perlak et al.,

1993). The transgenic gene expression confers potato plants protection against

the Colorado potato beetle, and allows reducing insecticide applications (Duncan

et al., 2002). A few years later, this Bt crop was complemented with another gene

expression cassette that provided protection also against the Potato leafroll virus

(Thomas et al., 1997). However, genetically modified potatoes were

commercialized from 1995 through 2001, and eventually removed from

marketplace due to social concern for Genetic Modified Crops (Thornton, 2004).

A coleopteran-active Bt maize was designed for the control of Corn rootworms,

expressing a variant of the wild-type cry3Bb1 gene from Bt var. kumamotoensis in

the root tissue (Vaughn et al., 2005). Currently, Bt maize hybrids are expressing

four different crystal proteins (Cry3Bb, mCry3A, Cry34Ab/35Ab and eCry3.1Ab),

individually or co-expressing two toxins (Gassmann et al., 2016; Zukoff et al.,

2016). The opportunity of expressing the toxin in a specific tissue allows

35

minimizing the exposure of non-target fauna while increasing the control of

tunnelling and root pests, which are otherwise difficult to manage. However,

Western corn rootworm has developed field resistance to all four currently

available Bt toxins (Wangila et al., 2015; Jakka et al., 2016; Zukoff et al., 2016) as

did D. virgifera in 2009 against Bt corn (Gassmann et al., 2011). These facts show

that although Bt crops have the potential to increase productivity while

conserving biodiversity, resistance management programs and a better use of

integrated pest management are necessary to delay resistance development as

much as possible (Shrestha et al., 2018).

RESISTANCE AND CROSS RESISTANCE

The widespread use of B. thuringiensis biopesticides, as well as the planting of

millions of hectares of Bt plants to protect crops from pests, carry the risk of

selecting insect biotypes that are tolerant or resistant to Bt toxins. Molecularly,

the mechanism that renders resistant insects is a modification or loss in the

specific midgut cell membrane receptors or of some mediator, which eliminates

or reduces the capacity of the toxin to initiate infection (Ferré et al., 2008). Cross-

resistance between Cry toxins is often associated with sequence similarities in

domains II and III, related with specific protein binding (Carrière et al., 2015).

Under laboratory conditions, populations of L. decemlineata and C. scripta

resistant to Cry3Aa have been described (Whalon et al., 1993; Bauer 1995). To

date, the appearance of field resistance is still relatively low in spite of the

extensive use of products based on the same protein, which increases the

probability of resistance development.

Conversely, Diabrotica populations have developed resistance to all proteins used

in transgenic corn. The intense selection pressure posed by the continuous

exposure of insects to Bt toxins has increased the emergence of pest resistance.

Since the first case of resistance to Cry3Bb1 Bt-maize in 2009, Diabrotica has

36

developed resistance to Cry3Aa and Cry34/35Ab binary protein (Gassmann et al.,

2016). New strategies are being carried out to try to delay resistance, including a

combined use of several proteins in the same Bt plant (Onstad and Meinke 2010).

Pyramiding of two Bt proteins can delay resistance to target proteins, because

when insects become tolerant to one toxin, most will still be susceptible to the

other toxin (Gassmann et al., 2016). However, there is already evidence of cross-

resistance to Cry3 proteins and even to Cry34/35, which may invalidate, in the

long run, the use of all these proteins (Zukoff et al., 2016).

37

REFERENCES

Abad A, Duck NB, Feng X, Flannagan RD, Kahn TW, Sims LE, 2002. Genes encoding novel proteins with pesticidal activity against coleopterans. Int. Pat. Appl. WO 02/34774 A2.

Adang MJ, 2011. Enhancement of Bacillus thuringiensis Cry toxicities to Lesser mealworm Alphitobius diaperinus. United States Pat. US 2011/0201549 A1.

Adang MJ, Abdullah MAF, 2013. Enhancement of Bacilus thuringiensis cry protein toxicities to coleopterans, and novel insect cadhetin fragments.pdf. United States Pat. US 8,486,887 B2.

Agaisse H, Lereclus D, 1995. How does Bacillus thuringiensis produce so much insecticidal crystal protein? J. Bacteriol. 177, 6027–6032.

Asano S, 1996. Identification of cry gene from Bacillus thuringiensis by PCR and isolation of unique insecticidal bacteria. Mem. Fac. Agric. 19, 529–563.

Asano S, Yamashita C, Iizuka T, Takeuchi K, Yamanaka S, Cerf D, Yamamoto T, 2003. A strain of Bacillus thuringiensis subsp. galleriae containing a novel cry8 gene highly toxic to Anomala cuprea (Coleoptera: Scarabaeidae). Biol. Control 28, 191–196.

Baranek J, Kaznowski A, Konecka E, Naimov S, 2015. Activity of vegetative insecticidal proteins Vip3Aa58 and Vip3Aa59 of Bacillus thuringiensis against lepidopteran pests. J. Invertebr. Pathol. 130, 72–81.

Barth H, Aktories K, Popoff MR, Stiles BG, 2004. Binary Bacterial Toxins: Biochemistry, Biology, and Applications of Common Clostridium and Bacillus Proteins. Microbiol. Mol. Biol. Rev. 68, 373–402.

Bauer LS, 1995. Resistance: a threat to the insecticidal crystal proteins of Bacillus thuringiensis. Florida Entomol. 78, 414–443.

Baum J a., Chu CR, Rupar M, Brown GR, Donovan WP, Huesing JE, Ilagan O, Malvar TM, Pleau M, Walters M, Vaughn T, 2004. Binary toxins from Bacillus thuringiensis active against the western corn rootworm, Diabrotica virgifera virgifera LeConte. Appl. Environ. Microbiol. 70, 4889–4898.

Baum JA, Johnson TB, 1999. Bacillus thuringiensis: Natural and recombinant bioinsecticide products, in: Methods in Biotechnology. 189–209.

Baum JA, Kakefuda M, Gawron-burke C, 1996. Engineering Bacillus thuringiensis bioinsecticides with an Indigenous Site-Specific Recombination System. Appl. Environ. Microbiol. 62, 4367–4373.

38

Baum JA, Sukuru UR, Penn SR, Meyer SE, Subbarao S, Shi X, Flasinski S, Heck GR, Brown RS, Clark TL, 2012. Cotton plants expressing a hemipteran-active Bacillus thuringiensis Crystal protein impact the development and survival of Lygus hesperus (Hemiptera: Miridae) Nymphs. J. Econ. Entomol. 105, 616–624.

Berry C, Ben-dov E, Jones AF, Murphy L, Quail MA, Holden MTG, Harris D, Zaritsky A, Parkhill J, 2002. Complete sequence and organization of pBtoxis, the Toxin-Coding Plasmid of. Appl. Environ. Microbiol. 68, 5082–5095.

Beveridge N, Elek JA, 2001. Insect and host-tree species influence the effectiveness of a Bacillus thuringiensis ssp. tenebrionis-based insecticide for controlling chrysomelid leaf beetles. Aust. J. Entomol. 40, 386–390.

Bi Y, Zhang Y, Shu C, Crickmore N, Wang Q, Du L, Song F, Zhang J, 2015. Genomic sequencing identifies novel Bacillus thuringiensis Vip1/Vip2 binary and Cry8 toxins that have high toxicity to Scarabaeoidea larvae. Biotechnol. Relev. Enzym. proteins 99, 753–760.

Bietlot HP, Vishnubhatla I, Carey PR, Pozsgay M, Kaplan H, 1990. Characterization of the cysteine residues and disulphide linkages in the protein crystal of Bacillus thuringiensis. Biochem. J. 267, 309–315.

Boets A, Arnaut G, Van Rie J, Damme N, 2011. Toxins. United States Pat. US 7,919,609 B2.

Bokori-Brown M, Savva CG, Fernandes Da Costa SP, Naylor CE, Basak AK, Titball RW, 2011. Molecular basis of toxicity of Clostridium perfringens epsilon toxin. FEBS J. 278, 4589–4601.

Boonserm P, Davis P, Ellar DJ, Li J, 2005. Crystal structure of the mosquito-larvicidal toxin Cry4Ba and its biological implications. J. Mol. Biol. 348, 363–382.

Boonserm P, Mo M, Angsuthanasombat C, Lescar J, 2006. Structure of the functional form of the mosquito larvicidal cry4Aa toxin from Bacillus thuringiensis at 2.8-Angstrom resolution. J. Bacteriol. 188, 3391–3401.

Bradfisch GA, Muller-Cohn J, Narva KE, Fu J, Thomson M, 2004. Bacillus thuringiensis toxins and genes for controlling coleopteran pests. United States Pat. US 6,710,027 B2.

Bradley D, Harkey MA, Kim MK, Biever KD, Bauer L., 1995. The insecticidal CryIB crystal protein of Bacillus thuringiensis ssp thuringiensis has dual specificity. J. Invertebr. Pathol. 65, 162–173.

Bravo A, Gill SS, Soberón M, 2007. Mode of action of Bacillus thuringiensis Cry and Cyt toxins and their potential for insect control. Toxicon 49, 423–435.

39

Bravo A, Likitvivatanavong S, Gill SS, Soberón M, 2011. Bacillus thuringiensis: A story of a successful bioinsecticide. Insect Biochem. Mol. Biol. 41, 423–431.

Bravo A, Soberón M, 2005. Bacillus thuringiensis: Mechanisms and Use, in: Gilbert, L.I., Gill, S.S. (Eds.), Insect Control: Biological and Synthetic Agents. Elsevier B.V., 175–206.

Brown KL, Whiteley HR, 1992. Molecular characterization of two novel crystal protein genes from Bacillus thuringiensis subsp. thompsoni. J. Bacteriol. 174, 549–557.

Carrière Y, Crickmore N, Tabashnik BE, 2015. Optimizing pyramided transgenic Bt crops for sustainable pest management. Nat. Biotechnol. 33, 161–168.

Carroll JS, Li J, Ellar DJ, 1989. Proteolytic processing of a coleopteran-specific delta-endotoxin produced by Bacillus thuringiensis var. tenebrionis. Biochem. J. 261, 99–105.

Chakroun M, Banyuls N, Bel Y, Escriche B, Ferré J, 2016. Bacterial Vegetative Insecticidal Proteins ( Vip ) from Entomopathogenic Bacteria. Microbiol. Mol. Biol. Rev. 80, 329–350.

Chen J, Dai LY, Wang XP, Tian YC, Lu MZ, 2005. The cry3Aa gene of Bacillus thuringiensis Bt886 encodes a toxin against long-horned beetles. Appl. Microbiol. Biotechnol. 67, 351–356.

Choi SK, Shin BS, Kong EM, Rho HM, Park SH, 2000. Cloning of a new Bacillus thuringiensis cry1I-type crystal protein gene. Curr. Microbiol. 41, 65–69.

Cohen S, Albeck S, Ben-Dov E, Cahan R, Firer M, Zaritsky A, Dym O, 2011. Cyt1Aa toxin: Crystal structure reveals implications for its membrane-perforating function. J. Mol. Biol. 413, 804–814.

Cohen S, Dym O, Albeck S, Ben-Dov E, Cahan R, Firer M, Zaritsky A, 2008. High-Resolution Crystal Structure of Activated Cyt2Ba Monomer from Bacillus thuringiensis subsp. israelensis. J. Mol. Biol. 380, 820–827.

Contreras E, Rausell C, Real MD, 2013a. Proteome response of Tribolium castaneum larvae to Bacillus thuringiensis toxin producing strains. PLoS One 8, e55330.

Contreras E, Schoppmeier M, Real MD, Rausell C, 2013b. Sodium solute symporter and cadherin proteins act as Bacillus thuringiensis Cry3Ba toxin functional receptors in Tribolium castaneum. J. Biol. Chem. 288, 18013–18021.

Coyle DR, McMillin JD, Krause SC, Hart ER, 2000. Laboratory and field evaluations of two Bacillus thuringiensis formulations, Novodor and Raven, for control of Cottonwood leaf beetle (Coleoptera: Chrysomelidae). J Econ Entomol 93, 713–720.

40

Crickmore N, Baum JA, Bravo A, Lereclus D, Narva KE, Sampson K, Schnepf HE, Sun M, Zeigler DR, 2019. Bacillus thuringiensis toxin nomenclature http://www.btnomenclature.info/

D’Amico V, Podgwaite JD, Duke S, 2004. Biological activity of Bacillus thuringiensis and associated toxins against the Asian longhorned beetle (Coleoptera: Cerambycidae). J. Entomol. Sci. 39.

da Silva N, Thuler AMG, de Abreu IL, Davolos CC, Polanczyk RA, Lemos MVF, 2010. Characterization and selection of Bt isolates effective against Sitophilus oryzae. Sci. Agric. 67, 472–478.

Damgaard PH, Abdel-Hameed A, Eilenberg J, Smits PH, 1998. Natural occurrence of Bacillus thuringiensis on grass foliage. World J. Microbiol. Biotechnol. 14, 239–242.

De Barjac H, Bonnefoi A, 1990. Classification of strains of Bacillus thuringiensis. Comptes rendus Hebd. des seances lAcademie des Sci. Ser. D Sci. Nat. 35, 233–240.

de Maagd RA, Bravo A, Berry C, Crickmore N, Schnepf HE, 2003a. Structure, Diversity, and Evolution of Protein Toxins from Spore-Forming Entomopathogenic Bacteria. Annu. Rev. Genet. 37, 409–433.

de Maagd RA, Bravo A, Berry C, Crickmore N, Schnepf HE, 2003b. Structure, Diversity, and Evolution of Protein Toxins from Spore-Forming Entomopathogenic Bacteria. Annu. Rev. Genet. 37, 409–433.

de Maagd RA, Bravo A, Crickmore N, 2001. How Bacillus thuringiensis has evolved specific toxins to colonize the insect world. Trends Genet. 17, 193–199.

De Maagd RA, Kwa MSG, Van Klei H Der, Yamamoto T, Schipper B, Vlak JM, Stiekema WJ, Bosch D, 1996. Domain III substitution in Bacillus thuringiensis delta-endotoxin CryIA(b) results in superior toxicity for Spodoptera exigua and altered membrane protein recognition. Appl. Environ. Microbiol. 62, 1537–1543.

de Souza Aguiar RW, Martins ÉS, Ribeiro BM, Monnerat RG, 2012. Cry10Aa protein is highly toxic to Anthonomus grandis Boheman (Coleoptera: Curculionidae), an important insect pest in brazilian cotton crop fields. Bt Res. Vol. 3, 20–28.

Donovan WP, Donovan JC, Slaney AC, 2000. Bacillus thuringiensis CryET33 and CryET34 compositions and uses therefor. United States Pat. 6,063,756.

Donovan WP, Engleman JT, Donovan JC, Baum JA, Bunkers GJ, Chi DJ, Clinton WP, English L, Heck GR, Ilagan OM, Krasomil-Osterfeld KC, Pitkin JW, Roberts JK, Walters MR, 2006. Discovery and characterization of Sip1A: A novel secreted protein from Bacillus thuringiensis with activity against coleopteran larvae. Appl. Microbiol. Biotechnol. 72, 713–719.

41

Donovan WP, Rupar MJ, Slaney a C, Malvar T, Gawron-Burke MC, Johnson TB, 1992. Characterization of two genes encoding Bacillus thuringiensis insecticidal crystal proteins toxic to Coleoptera species. Appl. Environ. Microbiol. 58, 3921–7.

Duncan DR, Hammond D, Zalewski J, Cudnohufsky J, Kaniewski W, Thornton M, Bookout JT, Lavrik P, Rogan GJ, Feldman-Riebe J, 2002. Field Performance of Transgenic Potato, with Resistance to Colorado Potato Beetle and Viruses. HortScience 37, 275–276.

Ekobu M, Solera M, Kyamanywa S, Ghislain M, Odongo B, Mwanga ROM, Moar WJ, 2010. Toxicity of seven Bacillus thuringiensis Cry proteins against Cylas puncticollis and Cylas brunneus (Coleoptera: Brentidae) using a novel artificial diet. J. Econ. Entomol. 103, 1493–1502.

Ellis R. Tracy, Stockhoff B a., Stamp L, Schnepf HE, Schwab GE, Knuth M, Russell J, Cardineau G a., Narva KE, 2002. Novel Bacillus thuringiensis binary insecticidal crystal proteins active on western corn rootworm, Diabrotica virgifera LeConte. Appl. Environ. Microbiol. 68, 1137–1145.

Ellis R T, Stockhoff BA, Stamp L, Schnepf HE, Schwab GE, Knuth M, Russell J, Cardineau GA, Narva KE, 2002. Novel proteins active on Western corn rootworm, Diabrotica virgifera virgifera LeConte. Appl. Environ. Microbiol 68, 1137–1145.

English L, Brussock M, Malvar TM, Bryson J, Kulesza C, Walters FS, Slatin S, von Tersch MA, Romano C, 2000. Nucleic acid segments encoding modified Bacillus thuringiensis coleopteran-toxc crystal proteins. United States Pat. US006060594A.

Estruch JJ, Warren GW, Mullins MA, Nye GJ, Craig JA, Koziel MG, 1996. Vip3A, a novel Bacillus thuringiensis Vegetative Insecticidal Protein with a wide spectrm of activities against lepidopteran insects. Proc. Natl. Acad. Sci. 93, 5389–5394.

Fabrick J, Oppert C, Lorenzen MD, Morris K, Oppert B, Jurat-Fuentes JL, 2009. A novel Tenebrio molitor cadherin is a functional receptor for Bacillus thuringiensis Cry3Aa toxin. J. Biol. Chem. 284, 18401–18410.

Federici B a., Bauer LS, 1998. Cyt1Aa protein of Bacillus thuringiensis is toxic to the cottonwood leaf beetle, Chrysomela scripta, and suppresses high levels of resistance to Cry3Aa. Appl. Environ. Microbiol. 64, 4368–4371.

Federici BA, Park HW, Sakano Y, 2006. Insecticidal Protein Crystals of Bacillus thuringiensis, in: Inclusion in Procaryotes. 195–236.

Feitelson JS, Schnepf HE, Narva KE, Stockhoff BA, Schmeits J, Loewer D, Dullum CJ, Muller-Cohn J, Stamp L, 2001. Pesticidal toxins and nucleotide sequences which encode these toxins. United States Pat. US 6,204,435 B1.

42

Ferré J, Van Rie J, Macintosh SC, 2008. Insecticidal genetically modified crops and Insect Resistance Management (IRM), in: Integration of Insect-Resistant genetically modified crops within IPM Programs. Springer Science + Business Media.

Foncerrada L, Sick AJ, Payne JM, 1992. Novel coleopteran-active Bacillus thuringiensis isolate and a novel gene encoding a coleopteran-active toxin. Eur. Pat. Appl. 0 498 537 A2.

Frankenhuyzen K van, 2009. Insecticidal activity of Bacillus thuringiensis crystal proteins. J. Invertebr. Pathol. 101, 1–16.

Galitsky N, Cody V, Wojtczak A, Ghosh D, Luft JR, Pangborn W, English L, 2001. Structure of the insecticidal bacterial δ-endotoxin Cry3Bb1 of Bacillus thuringiensis. Acta Crystallogr. Sect. D Biol. Crystallogr. 57, 1101–1109.

Gao Y, Jurat-Fuentes JL, Oppert B, Fabrick JA, Liu C, Gao J, Lei Z, 2011. Increased toxicity of Bacillus thuringiensis Cry3Aa against Crioceris quatuordecimpunctata, Phaedon brassicae and Colaphellus bowringi by a Tenebrio molitor cadherin fragment. Soc. Chem. Industy 67, 1076–1081.

Gassmann AJ, Petzold-Maxwell JL, Keweshan RS, Dunbar MW, 2011. Field-evolved resistance to Bt maize by Western corn rootworm. PLoS One 6.

Gassmann AJ, Shrestha RB, Jakka SRK, Dunbar MW, Clifton EH, Paolino AR, Ingber DA, French BW, Masloski KE, Dounda JW, St Clair CR, 2016. Evidence of resistance to Cry34/35Ab1 corn by Western corn rootworm (Coleoptera: Chrysomelidae): Root injury in the field and larval survival in Plant-Based bioassays. J. Econ. Entomol. 109, 1872–1880.

Gawron-burke C, Baum JA, 1991. Genetic manipulation of Bacillus thurlngiensis insecticidal crystal protein genes in bacteria. Genet. Eng. (N. Y). 13, 237–263.

Gazit E, Burshtein N, Ellar DJ, Sawyer T, Shai Y, 1997. Bacillus thuringiensis cytolytic toxin associates specifically with its synthetic helices A and C in the membrane bound state. Implications for the assembly of oligomeric transmembrane pores. Biochemistry 36, 15546–15554.

Gindin G, Mendel Z, Levitin B, Kumar P, Levi T, Shahi P, Khasdan V, Weinthal D, Kuznetsova T, Einav M, Kushmaro A, Protasov A, Zaritsky A, Ben-Dov E, 2014a. The basis for rootstock resilient to capnodis species: Screening for genes encoding δ-endotoxins from Bacillus thuringiensis. Pest Manag. Sci. 70, 1283–1290.

Gleave AP, Williams R, Hedges RJ, 1993. Screening by Polymerase Chain Reaction of Bacillus thuringiensis serotypes for the presence of cryV-Like Insecticidal Protein Genes and Characterization of a cryV Gene Cloned from B. thuringiensis subsp. kurstaki. Appl. Environ. Microbiol 59, 1683–1687.

43

Goldberg LJ, Margalit J, 1977. A bacterial spore demonstrating rapid larvicidal activity against Anopheles sergentii, Uranotaenia unguiculata, Culex univittatus, Aedes aegypti and Culex pipien. Mosq. News 37, 355–358.

Gómez JEC, López-Pazos SA, Cerón J, 2012. Determination of Cry toxin activity and identification of an aminopeptidase N receptor-like gene in Asymmathetes vulcanorum (Coleoptera: Curculionidae). J. Invertebr. Pathol. 111, 94–8.

Grochulski P, Masson L, Borisova S, Pusztai-Carey M, Schwartz JL, Brousseau R, Cygler M, 1995. Bacillus thuringiensis CryIA(a) insecticidal toxin: Crystal structure and channel formation. J. Mol. Biol. 254, 447–464.

Grossi-de-Sa MF, Quezado de Magalhanes M, Santos Silva M, Buffon Silva SM, Campos Dias S, Tempel Nakasu EY, Felipe Brunetta PS, Ramos Oliveira G, Brilhante de Oliveira Neto O, Sampaio de Oliveira R, Barros Soares LH, Zacha Ayub MA, Abreu Siqueira HA, Figueira ELZ, 2007. (Grossi-de-Sa et al.,, 2007) Susceptibility of Anthonomus grandis and Spodoptera frugiperda to a Crt1Ia-type toxin from a brazilian bt strain. J. Biochem. Mol. Biol. 40, 773–782.

Guo S, Ye S, Liu Y, Wei L, Xue J, Wu H, Song F, Zhang J, Wu X, Huang D, Rao Z, 2009. Crystal structure of Bacillus thuringiensis Cry8Ea1: An insecticidal toxin toxic to underground pests, the larvae of Holotrichia parallela. J. Struct. Biol. 168, 259–266.

Haffani YZ, Cloutier C, Belzile FJ, 2001. Bacillus thuringiensis Cry3Ca1 protein is toxic to the Colorado potato beetle, Leptinotarsa decemlineata (Say). Biotechnol. Prog. 17, 211–216.

Han S, Craig JA, Putnam CD, Carozzi NB, Tainer JA, 1999. Evolution and mechanism from structures of an ADP-ribosylating toxin and NAD complex. Nat. Struct. Biol. 6, 932–936.

Herman RA, Scherer PN, Young DL, Mihaliak CA, Woodsworth AT, Stockhoff B a., Narva KE, 2002. Binary insecticidal crystal protein from Bacillus thuringiensis, Strain PS149B1: Effects of individual protein components and mixtures in laboratory bioassays. J. Econ. Entomol. 95, 635–639.

Herrnstadt C, Soares GG, Wilcox ER, Edwards DL, 1986. A new strain of Bacillus thuringiensis with activity against coleopteran insects. Nat. Biotechnol. 4, 305–308.

Huang D-F, Zhang J, Song F-P, Lang Z-H, 2007. Microbial control and biotechnology research on Bacillus thuringiensis in China. J. Invertebr. Pathol. 95, 175–180.

Isaac B, Krieger EK, Mettus A-ML, Moshiri F, Sivasupramanian S, 2002. Polypeptide compositions toxic to anthonomus insects and methods of use. Pat. Appl. Publ. US 2002/0103362 A1.

44

Jakka SRK, Shrestha RB, Gassmann AJ, 2016. Broad-spectrum resistance to Bacillus thuringiensis toxins by Western corn rootworm (Diabrotica virgifera virgifera). Sci. Rep. 6, 1–9.

James C, 2017. Global status of Commercialized Biotech/GM Crops in 2017: Biotech Crop Adoption Surges as Economic Benefits Accumulate in 22 Years. ISAAA Br. No. 53. ISAAA Ithaca, NY.

James RR, Croft BA, Strauss SH, 1999. Susceptibility of the Cottonwood Leaf Beetle (Coleoptera: Chrysomelidae) to different strains and transgenic toxins of Bacillus thuringiensis. Environ. Entomol. 28, 108–115.

Jia Y, Zhao C, Wang Q, Shu C, Feng X, Song F, Zhang J, 2014. A genetically modified broad-spectrum strain of Bacillus thuringiensis toxic against Holotrichia parallela, Anomala corpulenta and Holotrichia oblita. World J. Microbiol. Biotechnol. 30, 595–603.

Jouzani GS, Valijanian E, Sharafi R, 2017. Bacillus thuringiensis: a successful insecticide with new environmental features and tidings. Appl. Microbiol. Biotechnol. 101, 2691–2711.

Jurat-Fuentes JL, Crickmore N, 2017. Specificity determinants for Cry insecticidal proteins: Insights from their mode of action. J. Invertebr. Pathol. 142, 5–10.

Jurat-Fuentes JL, Jackson TA, 2012. Bacterial Entomopathogens, Insect Pathology.

Kaelin P, Morel P, Gadani F, 1994. Isolation of Bacillus thuringiensis from stored tobacco and Lasioderma serricorne (F.). Appl. Environ. Microbiol. 60, 19–25.

Kelker MS, Berry C, Evans SL, Pai R, McCaskill DG, Wang NX, Russell JC, Baker MD, Yang C, Pflugrath JW, Wade M, Wess TJ, Narva KE, 2014. Structural and biophysical characterization of Bacillus thuringiensis insecticidal proteins Cry34Ab1 and Cry35Ab1. PLoS One 9, e112555.

Koller CN, Bauer LS, Hollingworth RM, 1992. Characterization of the pH-mediated solubility of Bacillus thuringiensis var. san diego native δ-endotoxin crystals. Biochem. Biophys. Res. Commun. 184, 692–699.

Kostichka K, Warren GW, Mullins M, Mullins a D, Palekar N V, Craig J a, Koziel MG, Estruch JJ, 1996. Cloning of a cryV-type insecticidal protein gene from Bacillus thuringiensis: the cryV-encoded protein is expressed early in stationary phase. J. Bacteriol. 178, 2141–2144.

Krieg VA, Huger AM, Langenbruch GA, Schnetter W, 1983. Bacillus thuringiensis var. tenebrionis: ein neuer, gegenüber Larven von Coleopteren wirksamer Pathotyp. Z. ang. Ent 96, 500–508.

45

Kurstak E, 1962. Donnees sur l’epizootie bacterienne naturelle provoguee par un Bacillus du type Bacillus thuringiensis sur Ephestia kuhniella Zeller. Entomophaga Mem. Hors 2, 245–247.

Lambert Bart, Hofte H, Annys K, Jansens S, Soetaert P, 1992a. Novel Bacillus thuringiensis insecticidal crystal with a silent activity against coleopteran larvae. Appl. Environ. Microbiol. 58, 2536–2542.

Lambert B, Höfte H, Annys K, Jansens S, Soetaert P, Peferoen M, 1992. Novel Bacillus thuringiensis insecticidal crystal protein with a silent activity against coleopteran larvae. Appl. Environ. Microbiol. 58, 2536–42.

Lambert Bart, Theunis W, Aguda R, Van Audenhove K, Decock C, Jansens S, Seurinck J, Peferoen M, 1992b. Nucleotide sequence of gene crylllD encoding a novel coleopteran-active crystal protein from strain BTII09P of Bacillus thuringiensis subsp , kurstaki. Gene 110, 131–132.

Li H, Olson M, Lin G, Hey T, Tan SY, Narva KE, 2013. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 interactions with Western corn rootworm midgut membrane binding sites. PLoS One 8, e53079.

Li J, Koni PA, Ellar DJ, 1996. Structure of the mosquitocidal δ-endotoxin CytB from Bacillus thuringiensis sp. kyushuensis and implications for membrane pore formation. J. Mol. Biol. 257, 129–152.

Li JD, Carroll J, Ellar DJ, 1991. Crystal structure of insecticidal d-endotoxin from Bacillus thuringiensis at 2.5 A resolution. Nature 353, 815–821.

Liu J, Yan G, Shu C, Zhao C, Liu C, Song F, Zhou L, Ma J, Zhang J, Huang D, 2010. Construction of a Bacillus thuringiensis engineered strain with high toxicity and broad pesticidal spectrum against coleopteran insects. Appl. Microbiol. Biotechnol. 87, 243–249.

López-Pazos SA, Rojas Arias AC, Ospina S a, Cerón J, 2010. Activity of Bacillus thuringiensis hybrid protein against a lepidopteran and a coleopteran pest. FEMS Microbiol. Lett. 302, 93–98.

MacIntosh SC, Stone TB, Sims SR, Hunst PL, Greenplate JT, Marrone PG, Perlak FJ, Fischhoff DA, Fuchs RL, 1990. Specificity and efficacy of purified Bacillus thuringiensis proteins against agronomically important insects. J. Invertebr. Pathol. 56, 258–266.

Maeda M, Mizuki E, Nakamura Y, Hatano T, Ohba M, 2000. Recovery of Bacillus thuringiensis from marine sediments of Japan. Curr. Microbiol. 40, 418–422.

Mahadeva Swamy HM, Asokan R, Thimmegowda GG, Mahmood R, 2013. Expression of cry3A gene and its toxicity against Asian Gray Weevil Myllocerus

46

undecimpustulatus undatus Marshall (Coleoptera: Curculionidae). J. Basic Microbiol. 53, 664–676.

Manasherob R, Itsko M, Sela-Baranes N, Ben-Dov E, Berry C, Cohen S, Zaritsky A, 2006. Cyt1Ca from Bacillus thuringiensis subsp. israelensis: Production in Escherichia coli and comparison of its biological activities with those of other Cyt-like proteins. Microbiology 152, 2651–2659.

Martin PAW, Travers RS, 1989. Worldwide abundance and distribution of Bacillus thuringiensis isolates. Appl. Environ. Microbiol. 55, 2437–2442.

Martins ÉS, Monnerat RG, Queiroz PR, Dumas VF, Braz SV, de Souza Aguiar RW, Gomes ACMM, Sánchez J, Bravo A, Ribeiro BM, 2010. Midgut GPI-anchored proteins with alkaline phosphatase activity from the cotton boll weevil (Anthonomus grandis) are putative receptors for the Cry1B protein of Bacillus thuringiensis. Insect Biochem. Mol. Biol. 40, 138–145.

Martins ÉS, Praça LB, Dumas VF, Silva-Werneck JO, Sone EH, Waga IC, Berry C, Monnerat RG, 2007. Characterization of Bacillus thuringiensis isolates toxic to cotton boll weevil (Anthonomus grandis). Biol. Control 40, 65–68.

Meadows MP, Ellis DJ, Butt J, Jarrett P, Burges HD, 1992. Distribution, frequency, and diversity of Bacillus thuringiensis in an animal feed mill. Appl. Environ. Microbiol. 58, 1344–1350.

Mettus A-ML, Baum JA, 2000. Polypeptide compositions toxic to Diabrotica Insects, obteined from Bt; CryET70, and methods of use. Eur. Pat. Appl.

Michaels TE, Foncerrada L, Narva KE, 1993. Process for controlling scarab pests with Bacillus thuringiensis isolates. Int. Pat. Appl. WO 93/15206.

Michaels TE, Narva KE, Foncerrada L, 1996. Bacillus thuringiensis toxins active against scarab pests. United States Pat. 5,554,534.

Michaud D, Bernier-Vadnais N, Overney S, Yelle S, 1995. Constitutive expression of digestive cysteine proteinase forms during development of the Colorado potato beetle, Leptinotarsa decemlineata Say (Coleoptera: Chrysomelidae). Insect Biochem. Mol. Biol. 25, 1041–1048.

Moellenbeck DJ, Peters ML, Bing JW, Rouse JR, Higgins LS, Sims L, Nevshemal T, Marshall L, Ellis RT, Bystrak PG, Lang B a, Stewart JL, Kouba K, Sondag V, Gustafson V, Nour K, Xu D, Swenson J, Zhang J, Czapla T, Schwab G, Jayne S, Stockhoff B a, Narva K, Schnepf HE, Stelman SJ, Poutre C, Koziel M, Duck N, 2001. Insecticidal proteins from Bacillus thuringiensis protect corn from corn rootworms. Nat. Biotechnol. 19, 668–672.

47

Morse RJ, Yamamoto T, Stroud RM, 2001. Structure of Cry2Aa suggests an unexpected receptor binding epitope. Structure 9, 409–417.

Naimov S, Weemen-Hendriks M, Dukiandjiev S, De Maagd RA, 2001. Bacillus thuringienis Delta-Endotoxin Cry1 Hybrid Proteins with Increased Activity against the Colorado Potato Beetle. Appl. Environ. Microbiol. 67, 5328–5330.

Nester EW, Thomashow LS, Metz M, Gordon M, 2002. 100 Years of Bacillus thuringiensis: a critical scientific assessment. Am. Soc. Microbiol.

Ochoa-Campuzano C, Real MD, Martínez-Ramírez AC, Bravo A, Rausell C, 2007. An ADAM metalloprotease is a Cry3Aa Bacillus thuringiensis toxin receptor. Biochem. Biophys. Res. Commun. 362, 437–442.

Oliveira GR, Silva MC, Lucena WA, Nakasu EY, Firmino AA, Beneventi MA, Souza DS, Gomes JE, de Souza J DA, Rigden DJ, Ramos HB, Soccol CR, Grossi-de-Sa MF, 2011. Improving Cry8Ka toxin activity towards the cotton boll weevil (Anthonomus grandis). BMC Biotechnol. 11, 85.

Onstad DW, Meinke LJ, 2010. Modeling evolution of Diabrotica virgifera virgifera (Coleoptera: Chrysomelidae) to transgenic corn with two insecticidal traits. J. Econ. Entomol. 103, 849–60.

Oppert B, Ellis RT, Babcock J, 2010. Effects of Cry1F and Cry34Ab1/35Ab1 on storage pests. J. Stored Prod. Res. 46, 143–148.

Oppert B, Morgan TD, Kramer KJ, 2011. Efficacy of Bacillus thuringiensis Cry3Aa protoxin and protease inhibitors against coleopteran storage pests. Pest Manag. Sci. 67, 568–573.

Palma L, Muñoz D, Berry C, Murillo J, Caballero P, Caballero P, 2014. Bacillus thuringiensis toxins: An overview of their biocidal activity. Toxins (Basel). 6, 3296–3325.

Pardo-López L, Soberón M, Bravo A, 2013. Bacillus thuringiensis insecticidal three-domain Cry toxins: Mode of action, insect resistance and consequences for crop protection. FEMS Microbiol. Rev. 37, 3–22.

Park Y, Abdullah MAF, Taylor MD, Rahman K, Adang MJ, 2009. Enhancement of Bacillus thuringiensis Cry3Aa and Cry3Bb toxicities to coleopteran larvae by a toxin-binding fragment of an insect cadherin. Appl. Environ. Microbiol. 75, 3086–3092.

Park Y, Hua G, Taylor MD, Adang MJ, 2014. A coleopteran cadherin fragment synergizes toxicity of Bacillus thuringiensis toxins Cry3Aa, Cry3Bb, and Cry8Ca against lesser mealworm, Alphitobius diaperinus (Coleoptera: Tenebrionidae). J. Invertebr. Pathol. 123, 1–5.

48

Peña G, Miranda-Rios J, de la Riva G, Pardo-López L, Soberón M, Bravo A, 2006. A Bacillus thuringiensis S-Layer protein involved in toxicity against Epilachna varivestis (Coleoptera: Coccinellidae). Appl. Environ. Microbiol. 127, 353–360.

Pérez C, Muñoz-Garay C, Portugal LC, Sánchez J, Gill SS, Soberón M, Bravo A, 2007. Bacillus thuringiensis ssp. israelensis Cyt1Aa enhances activity of Cry11Aa toxin by facilitating the formation of a pre-pore oligomeric structure. Cell. Microbiol. 9, 2931–2937.

Perlak F, Stone T, Muskopf Y, Petersen L, Parker G, McPherson S, Wyman J, Love S, Reed G, Biever D, 1993. Genetically improved potatoes: protection from damage by Colorado potato beetles. Plant Mol Biol. 22, 313–321.

Porcar M, García-Robles I, Domínguez-Escribà L, Latorre a, 2010. Effects of Bacillus thuringiensis Cry1Ab and Cry3Aa endotoxins on predatory Coleoptera tested through artificial diet-incorporation bioassays. Bull. Entomol. Res. 100, 297–302.

Portela-Dussán DD, Chaparro-Giralddo A, López-Pazos SA, 2013. La biotecnología de Bacillus thuringiensis en la agricultura. Nova 11, 87–96.

Promdonkoy B, Rungrod A, Promdonkoy P, Pathaichindachote W, Krittanai C, Panyim S, 2008. Amino acid substitutions in αA and αC of Cyt2Aa2 alter hemolytic activity and mosquito-larvicidal specificity. J. Biotechnol. 133, 287–293.

Rausell C, Garcı́a-Robles I, Sánchez J, Muñoz-Garay C, Martı́nez-Ramı́rez AC, Real MD, Bravo A, 2004. Role of toxin activation on binding and pore formation activity of the Bacillus thuringiensis Cry3 toxins in membranes of Leptinotarsa decemlineata (Say). Biochim. Biophys. Acta - Biomembr. 1660, 99–105.

Raymond B, Johnston PR, Nielsen-LeRoux C, Lereclus D, Crickmore N, 2010. Bacillus thuringiensis: an impotent pathogen? Trends Microbiol. 18, 189–194.

Ruiz de Escudero I, Estela A, Porcar M, Martínez C, Oguiza JA, Escriche B, Ferré J, Caballero P, 2006. Molecular and insecticidal characterization of a Cry1I protein toxic to insects of the families Noctuidae, Tortricidae, Plutellidae, and Chrysomelidae. Appl. Environ. Microbiol. 72, 4796–4804.

Rupar MJ, Donovan WP, Chu CR, Pease E, Tan Y, Slaney AC, Malvar TM, Baum J, 2009. Coleopteran toxin polypeptide compositions and insect-resistant transgenic plants. United States Pat. US 2009/0094714 A1.

Rupar MJ, Donovan WP, Groat RG, Slaney a. C, Mattison JW, Johnson TB, Charles JF, Dumanoir VC, De Barjac H, 1991. Two novel strains of Bacillus thuringiensis toxic to coleopterans. Appl. Environ. Microbiol. 57, 3337–3344.

49

Rupar MJ, Donovan WP, Tan Y, Slaney AC, 2000. Bacillus thuringiensis CryET29 compositions toxic to coleopteran insects and Ctenocephalides spp. United States Pat. US Patent 6,093,695.

Sanchis V, 2011. From microbial sprays to insect-resistant transgenic plants: history of the biospesticide Bacillus thuringiensis . A review. Agron. Sustain. Dev. 31, 217–231.

Sato R, Takeuchi K, Ogiwara K, Minami M, Kaji Y, Suzuki N, Hori H, Asano S, Ohba M, Iwahana H, 1994. Cloning, heterologous expression, and localization of a novel crystal protein gene from Bacillus thuringiensis serovar japonensis strain Buibui toxic to scarabaeid insects. Curr. Microbiol. 28, 15–19.

Sattar S, Maiti MK, 2011. Molecular characterization of a novel vegetative insecticidal protein from Bacillus thuringiensis effective against sap-sucking insect pest. J. Microbiol. Biotechnol. 21, 937–946.

Sayed A, Nekl ER, Siqueira HAA, Wang HC, Ffrench-Constant RH, Bagley M, Siegfried BD, 2007. A novel cadherin-like gene from western corn rootworm, Diabrotica virgifera virgifera (Coleoptera: Chrysomelidae), larval midgut tissue. Insect Mol. Biol. 16, 591–600.

Schnepf E, Crickmore N, Van Rie J, Lereclus D, Baum J, Feitelson J, Zeigler DR, Dean DH, 1998. Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 62, 775–806.

Schnepf HE, Lee S, Dojillo J, Fencil K, Morera L, Nygaard L, Narva KE, Wolt JD, Burmeister P, 2005. Characterization of Cry34/Cry35 Binary insecticidal proteins from diverse Bacillus thuringiensis strain collections. Appl. Environ. Microbiol. 71, 1765–1774.

Schnepf HE, Whiteley HR, 1981. Cloning and expression of the Bacillus thuringiensis crystal protein gene in Escherichia coli. Proc. Natl. Acad. Sci. 78, 2893–2897.

Sha J, Chi B, Zhang J, Li H, Gao J, Liu R, 2018. sip1Ab gene from a native Bacillus thuringiensis strain QZL38 and its insecticidal activity against Colaphellus bowringi Baly. Biocontrol Sci. Technol. 28, 1–9.

Shadenkov AA, Kadyrov RM, Uzbekova S V, Kuz’min E V, Osterman AL, Chestukhina GG, Shemiakin MF, 1993. Creation of a hybrid protein gene based on Bacillus thuringiensis delta endotoxins CryIIIA and CrIA(a) and expression of its derivatives in Escherichia coli. Mol Biol 27, 952–959.

Sharma A, Kumar S, Bhatnagar RK, 2011. Bacillus thuringiensis protein Cry6B (BGSC ID 4D8) is toxic to Larvae of Hypera postica. Curr. Microbiol. 62, 597–605.

50

Shi Y, Ma W, Yuan M, Sun F, Pang Y, 2007. Cloning of vip1/vip2 genes and expression of Vip1Ca/Vip2Ac proteins in Bacillus thuringiensis. World J. Microbiol. Biotechnol. 23, 501–507.

Shi Y, Xu W, Yuan M, Tang M, Chen J, Pang Y, 2004. Expression of vip1/vip2 genes in Escherichia coli and Bacillus thuringiensis and the analysis of their signal peptides. J. Appl. Microbiol. 97, 757–765.

Shin BS, Park SH, Choi SK, Koo BT, Lee ST, Kim JI, 1995. Distribution of cryV-type insecticidal protein genes in Bacillus thuringiensis and cloning of cryV-type genes from Bacillus thuringiensis subsp. kurstaki and Bacillus thuringiensis subsp. entomocidus. Appl. Environ. Microbiol. 61, 2402–2407.

Shrestha RB, Dunbar MW, French BW, Gassmann AJ, 2018. Effects of field history on resistance to bt maize by western corn rootworm, Diabrotica virgifera virgifera leconte (Coleoptera: Chrysomelidae). PLoS One 13, 1–18.

Shu C, Liu R, Wang R, Zhang J, Feng S, Huang D, Song F, 2007. Improving toxicity of Bacillus thuringiensis strain contains the cry8Ca gene specific to Anomala corpulenta larvae. Curr. Microbiol. 55, 492–496.

Shu C, Yan G, Wang R, Zhang J, Feng S, Huang D, Song F, 2009a. Characterization of a novel cry8 gene specific to Melolonthidae pests: Holotrichia oblita and Holotrichia parallela. Appl. Microbiol. Biotechnol. 84, 701–707.

Shu C, Yu H, Wang R, Fen S, Su X, Huang D, Zhang J, Song F, 2009b. Characterization of two novel cry8 genes from Bacillus thuringiensis strain BT185. Curr. Microbiol. 58, 389–392.

Siegfried BD, Waterfield N, Ffrench-Constant RH, 2005. Expressed sequence tags from Diabrotica virgifera virgifera midgut identify a coleopteran cadherin and a diversity of cathepsins. Insect Mol. Biol. 14, 137–143.

Silva-Werneck JO, Ellar DJ, 2008. Characterization of a novel Cry9Bb δ-endotoxin from Bacillus thuringiensis. J. Invertebr. Pathol. 98, 320–328.

Sims SR, 1997. Host activity spectrum of the CryIIA Bacillus thuringiensis subsp. kurstaki protein. Effects on Lepidoptera, Diptera, and non-target arthropods. Southwest. Entomol.

Singaravelu B, Crickmore N, Srikanth J, Hari K, Sankaranarayanan C, 2013. Prospecting for scarabid specific Bacillus thuringiensis crystal toxin cry8 gene in sugarcane ecosystem of Tamil Nadu , India. J. Sugarcane Res. 3, 141–144.

Smith RA, Couche GA, 1991. The phylloplane as asource of Bacillus thuringiensis variants. Appl. Environ. Microbiol. 57, 311–5.

51

Soberón M, López-Díaz JA, Bravo A, 2013. Cyt toxins produced by Bacillus thuringiensis: A protein fold conserved in several pathogenic microorganisms. Peptides 41, 87–93.

Song F, Zhang J, Gu Y, Han L, He K, Chen Z, Yao J, Hu Y, Li G, Huang D, 2003. Identification of cry1I-type genes from Bacillus thuringiensis strains and characterization of a novel cry1I-type Gene. Appl. Environ. Microbiol. 69, 5207–5211.

Song P, Wang Q, Nangong Z, Su J, Ge D, 2012. Identification of Henosepilachna vigintioctomaculata (Coleoptera: Coccinellidae) midgut putative receptor for Bacillus thuringiensis insecticidal Cry7Ab3 toxin. J. Invertebr. Pathol. 109, 318–22.

Tailor R, Ely S, Pells S, Gibb G, Tippett J, Jordan L, 1992. Identification and characterization of a novel Bacillus thuringiensis d-endotoxin entomocidal to coleopteran and lepidopteran larvae. Mol. Microbiol. 6, 1211–1217.

Thomas PE, Kaniewski WK, Lawson EC, 1997. Reduced field spread of potato leafroll virus in potatoes transformed with the potato leafroll virus coat protein gene. Plant Dis. 81, 1447–1453.

Thomson M, Knuth M, Cardineau G, 1997. Bacillus thuringiensis toxins with improved toxicity. United States Pat. 5,874,288.

Thornton M, 2004. The rise and fall of NewLeaf potatoes. NABC Rep. 15, 235–243.

van Frankenhuyzen K, 2013. Cross-order and cross-phylum activity of Bacillus thuringiensis pesticidal proteins. J. Invertebr. Pathol. 114, 76–85.

Vaughn T, Cavato T, Brar G, Coombe T, DeGooyer T, Ford S, Groth M, Howe A, Johnson S, Kolacz K, Pilcher C, Purcell J, Romano C, English L, Pershing J, 2005. A method of controlling corn rootworm feeding using a Bacillus thuringiensis protein expressed in transgenic maize. Crop Sci. 45, 931–938.

von Tersch MA, Gonzalez JM, 1994. Bacillus thuringiensis cryET1 toxin gene and protein toxic to lepidopteran insects. United States Pat. 5,356,623.

Walters FS, Defontes CM, Hart H, Warren GW, Chen JS, 2010. Lepidopteran-active variable-region sequence imparts coleopteran activity in eCry3.1Ab, an engineered Bacillus thuringiensis hybrid insecticidal protein. Appl. Environ. Microbiol. 76, 3082–3088.

Walters FS, Stacy CM, Mi KL, Palekar N, Chen JS, 2008. An engineered chymotrypsin/cathepsin G site in domain I renders Bacillus thuringiensis Cry3A active against Western corn rootworm larvae. Appl. Environ. Microbiol. 74, 367–374.

52

Wang G, Zhang J, Song F, Wu J, Feng S, Huang D, 2006. Engineered Bacillus thuringiensis GO33A with broad insecticidal activity against lepidopteran and coleopteran pests. Appl. Microbiol. Biotechnol. 72, 924–930.

Wangila DS, Gassmann AJ, Petzold-Maxwell JL, French BW, Meinke LJ, 2015. Susceptibility of Nebraska Western corn rootworm (Coleoptera: Chrysomelidae) populations to Bt corn events. J. Econ. Entomol. 108, 742–751.

Warren GW, 1997. Vegetative Insecticidal Proteins: Novel proteins for control of corn pests, in: Advances in Insect Control. The Role of Transgenic Plants. 109–121.

Warren GW, Koziel MG, Mullins MA, Kostichka K, Estruch JJ, 1996. Novel pesticidal proteins and strains. Pat. Coop. Treaty. WO1996/010083 A1.

Way MO, Wallace RG, Harper HB, Landry CL, 1999. control of rice water weevil with novodor 3, Agricultural Research & Extension Center.

Wei J-Z, Hale K, Carta L, Platzer E, Wong C, Fang S-C, Aroian R V., 2003. Bacillus thuringiensis crystal proteins that target nematodes. PNAS 100, 2760–2765.

Whalon ME, Miller IDL, Hollingworth IRM, Milleri JR, 1993. Selection of a Colorado Potato Beetle (Coleoptera : Chrysomelidae) Strain Resistant to Bacillus thuringiensis. Entomol. Soc. Am. 86, 226–233.

Wraight SP, Lacey LA, Kabaluk JT, Gottel MS, 2009. Potential for Microbial Biological Control of Coleopteran and Hemipteran Pests of Potato. - Agriculture and Agri-Food Canada (AAFC). Fruit Veg. Cereal Sci. Biotechnol. 3, 25–38.

Wu SJ, Dean DH, 1996. Functional significance of loops in the receptor binding domain of Bacillus thuringiensis CryIIIA delta-endotoxin. J. Mol. Biol. 255, 628–640.

Xu C, Wang BC, Yu Z, Sun M, 2014. Structural insights into Bacillus thuringiensis Cry, Cyt and parasporin toxins, Toxins.

Yamaguchi T, Sahara K, Bando H, Asano S, 2008a. Discovery of a novel Bacillus thuringiensis Cry8D protein and the unique toxicity of the Cry8D-class proteins against scarab beetles. J. Invertebr. Pathol. 99, 257–262.

Yamaguchi T, Sahara K, Bando H, Asano S ichiro, 2008b. Discovery of a novel Bacillus thuringiensis Cry8D protein and the unique toxicity of the Cry8D-class proteins against scarab beetles. J. Invertebr. Pathol. 99, 257–262.

Yan G, Song F, Shu C, Liu J, Liu C, Huang D, Feng S, Zhang J, 2009. An engineered Bacillus thuringiensis strain with insecticidal activity against Scarabaeidae (Anomala corpulenta) and Chrysomelidae (Leptinotarsa decemlineata and Colaphellus bowringi). Biotechnol. Lett. 31, 697–703.

53

Ye Y, Godzik A, 2004. FATCAT: A web server for flexible structure comparison and structure similarity searching. Nucleic Acids Res. 32, 582–585.

Yokoyama T, Tanaka M, Hasegawa M, 2004. Novel cry gene from Paenibacillus lentimorbus strain Semadara inhibits ingestion and promotes insecticidal activity in Anomala cuprea larvae. J. Invertebr. Pathol. 85, 25–32.

Yu H, Zhang J, Huang D, Gao J, Song F, 2006a. Characterization of Bacillus thuringiensis strain Bt185 toxic to the Asian cockchafer: Holotrichia parallela. Curr. Microbiol. 53, 13–7.

Yu H, Zhang J, Huang D, Gao J, Song F, 2006b. Characterization of Bacillus thuringiensis strain Bt185 toxic to the Asian cockchafer: Holotrichia parallela. Curr. Microbiol. 53, 13–17.

Yu X, Liu T, Liang X, Tang C, Zhu J, Wang S, Deng Q, Wang L, Zheng A, Li P, 2011. Rapid detection of vip1- type genes from Bacillus cereus and characterization of a novel Vip binary toxin gene. FEMS Microbiol. Lett. 325, 30–36.

Yu Y, Yuan Y, Gao M, 2016. Construction of an environmental safe Bacillus thuringiensis engineered strain against Coleoptera. Appl. Microbiol. Biotechnol. 100, 4027–4034.

Zhang J, Hodgman TC, Krieger L, Schnetter W, Schairer HU, 1997. Cloning and analysis of the first cry gene from Bacillus popilliae. J. Bacteriol. 179, 4336–4341.

Zhong C, Ellar DJ, Bishop A, Johnson C, Lin S, Hart ER, 2000. Characterization of a Bacillus thuringiensis delta-endotoxin which is toxic to insects in three orders. J. Invertebr. Pathol. 76, 131–139.

Zhongkamg W, He W, Peng G, Xia Y, 2008. Transformation and expression of specific insecticide gene Bt cry3A in resident endogenetic bacteria isolated from Apriona germari (Hope) larvae intestines |. Acta Microbiol. Sin.

Zukoff SN, Ostlie KR, Potter B, Meihls LN, Zukoff AL, French L, Ellersieck MR, French BW, Hibbard BE, 2016. Multiple assays indicate varying levels of cross resistance in Cry3Bb1-selected field populations of the Western corn rootworm to mCry3A, eCry3.1Ab, and Cry34/35Ab1. J. Econ. Entomol. 109, 1387–1398.

Zúñiga-Navarrete F, Gómez I, Peña G, Bravo A, Soberón M, 2013. A Tenebrio molitor GPI-Anchored alkaline phosphatase is involved in binding of Bacillus thuringiensis Cry3Aa to brush border membrane vesicles. Peptides 41, 81–86.

54

AIMS OF THE THESIS

In this doctoral thesis the following general objectives have been proposed:

1. To make an updated review of all the insecticidal proteins that Bacillus

thuringiensis produces with activity against insect species of the order

Coleoptera.

2. To identify new cry genes with insecticidal activity against Coleoptera in

order to expand the resources available for the control of pests caused by

species of this order of insects.

55

56

Chapter II

A strain of Bacillus thuringiensis containing a novel cry7Aa2 gene that is highly toxic to Leptinotarsa decemlineata (Say) (Coleoptera; Chrysomelidae)

ABSTRACT

The genome of the Bacillus thuringiensis BM311.1 strain was sequenced and

assembled in 359 contigs containing a total of 6,390,221 bp. The plasmidic ORF

of a putative cry gene from this strain was identified as a potential novel Cry

protein of 1138 amino acid residues with a 98% identity respect to Cry7Aa1

protein and a predicted molecular mass of 129.4 kDa. The primary structure of

this Cry7Aa2 protein, which revealed the presence of eight conserved blocks and

the classical structure of three domains, differed in 28 amino acid residues from

that of Cry7Aa1. The cry7Aa2 gene was amplified by PCR and then expressed in

the acrystalliferous strain BMB171. SDS-PAGE analysis confirmed the predicted

molecular mass for the Cry7Aa2 protein and revealed that, after in vitro trypsin

incubation, it was degraded to a toxin of 62 kDa. However, when treated with

digestive fluids from Leptinotarsa decemlineata larvae two proteinase-resistant

fragments of 60 and 65 kDa were produced. Spore and crystal mixture produced

by the wild-type BM311.1 strain against L. decemlineata neonate larvae resulted in

a LC50 (18.8 µg/ml), which was statistically equal to the estimated LC50 (20.8

µg/ml) for the recombinant BMB17-Cry7Aa2 strain. In addition, when this novel

toxin was activated in vitro with commercial trypsin, the LC50 value was reduced

4 times approximately (LC50 = 4.9 µg/ml). The advantages of Cry7Aa2 protoxin

compared to Cry7Aa1 protoxin when used in the control of insect pests are

discussed.

57

INTRODUCTION

Bacillus thuringiensis (Berliner) (Bt) is an ubiquitous spore-forming bacterium

which has been isolated from very diverse habitats including plant substrates,

aquatic environments, animal excrements, poultry farms, dust from storage and

mills, dead and living insects among other sources (Martin and Travers 1989;

Iriarte et al., 1998). The entomopathogenic capacity of this organism lies in its

ability to synthesize crystalline protein inclusions that have insecticidal activity

when ingested by a susceptible host (Höfte and Whiteley 1989). The toxicity

spectrum of individual crystal proteins is usually limited to a number of species

of the same order, although B. thuringiensis as a species is toxic for an increasing

number of insects belonging to different orders (Lepidoptera, Diptera,

Coleoptera, Hymenoptera, Orthoptera, Hemiptera, etc. as well as other

invertebrates such as nematodes and mites (Wei et al., 2003, Frankenhuyzen

2009). Bt crystals are composed of Cry proteins, which are characteristically

present in all Bt strains and show specific insecticidal activity, and Cyt proteins

with cytolytic activity that are only found in the crystals of a small number of Bt

strains. Cry proteins are the most diverse and numerous group of insecticidal Bt

proteins. The Cry proteins described to date have been classified, according to

the similarity of their respective amino acid sequences, into 78 families (from

Cry1 to Cry78) and a larger number of subfamilies

http://www.lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/ that comprise more

than 800 toxins. An extensive number of these toxins have been described in

recent years thanks to the availability of new molecular tools as well as the

growing interest in the discovery of Bt toxins, with novel insecticidal

characteristics (Dong et al., 2016).

The Cry proteins in the crystal are inactive protoxins, the toxicity of which

depends on adequate solubilization and subsequent proteolytic digestion, like it

58

occurs in the midgut of a susceptible insect (Thomas and Ellar 1983; Hofmann

and Lüthy 1986). The peptides that are resistant to proteolytic digestion are active

toxins that bind to specific receptors on the brush border membrane of the gut

epithelium, generating pores that cause epithelial cell lysis, paralysis of the

digestive system and finally insect death (Schnepf et al., 1998).

Cry proteins with demonstrated activity against coleopterans either belong to

one of the 13 single-acting toxin families described so far (Cry1, Cry3, Cry6, Cry7,

Cry8, Cry9, Cry10, Cry18, Cry22, Cry36, Cry43, Cry51, Cry55) or are part of the

Cry23/Cry37 and Cry34/Cry35 binary protein families. The first Bt strain with

specific toxicity to coleopterans was isolated in 1983 from Tenebrio molitor

(Tenebrionidae) larvae (Krieg et al., 1983). The main component of the crystal of

this strain and other related strains, are proteins of the Cry3 (Cry3A, Cry3B, and

Cry3C) family with activity against several economically-important species, such

as Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae) (Haffani et al.,

2001; Park et al., 2009) and Diabrotica virgifera (Coleoptera: Chrysomelidae) (Park

et al., 2009; Adang and Abdullah 2013).

The Cry7 family, while being an alternative to Cry3 proteins against certain

coleopteran species of the genus Cylas (Ekobu et al., 2010), also represents a source

of active toxins for other insect species from different orders for which few or no

Bt toxins have been reported to date eg. the locust Locusta migratoria manilensis

(Wu et al., 2011). Cry7Aa1 was originally described by Lambert et al (Lambert et

al., 1992) as the first Cry7 protein with silent activity towards L. decemlineata

larvae. Currently, the Cry7 family comprises a total of 37 toxins, which are

grouped into several subfamilies (Cry7A-Cry7L), but insecticidal activity has

only been reported for a few of them. For example, Cry7Ab3 was reported to be

active against the spotted potato ladybeetle, Henosepilachna vigintioctomaculata

(Coccinellidae) (Song et al., 2008) whereas Cry7Aa1 showed high insecticidal

59

activity in larvae of Cylas brunneus and C. puncticollis (Brentidae). (Ekobu et al.,

2010) This diversity of species susceptible to Cry7 suggests that this family may

represent an interesting source of toxins with novel insecticidal properties.

The objective of this study was to determine the content of insecticidal genes

present in the wild-type BM311.1 strain. The BM311.1 strain of Bt was isolated

from an agricultural soil sample originating from a field of the Spanish province

of Navarra as part of a country-wide screening program involving the isolation

and characterization of Bt strains toxic to insects of agricultural importance

(Iriarte et al., 1998). This strain was selected because it was found to be toxic to

coleopterans and contained at least one cry7 gene in its genome (unpublished

data). In the present study, the cry7 gene present in this strain was identified and

cloned, and its contribution to the insecticidal potency of BM311.1 was

determined.

60

MATERIALS AND METHODS

Bacterial strains, plasmids and insect culture conditions

The acrystalliferous Bt strain BMB171- was used as host strain for Bt protein

expression (Li et al., 2000). For the routine gene cloning Escherichia coli XL1 blue

was used, which was transformed with a slightly modified recombinant vector

pSTAB (Park et al., 1999) (pSTABr), engineered with the gene of interest. Both

BM311.1 and BMB171-Cry7Aa2 strains were grown in CCY culture medium

(Stewart et al., 1981) under constant conditions of temperature (28 ºC) and

shaking (200 rpm). E. coli strains were cultured at 37 ºC with shaking at 200 rpm

in LB broth (1% tryptone, 0.5% yeast extract, and 1% NaCl, pH 7.0). When

required for selective growth, medium was supplemented with appropriated

antibiotics at the following concentrations: erythromycin (Em), 20 mg/l,

ampicillin (Amp), 100 mg/l.

A laboratory colony of L. decemlineata was established from adults collected from

organic potato fields near Pamplona (Spain). This insect colony was maintained

on potato plants in the insectary of the Universidad Pública de Navarra under

controlled conditions of temperature, humidity and photoperiod (25±1 ºC, 70±5%

RH, and L16:D8 h) and was refreshed whenever it was possible to collect adults

from the field.

Total DNA extraction and genomic sequencing

Total genomic DNA (chromosomal+plasmid) was extracted following the

protocol for DNA isolation from Gram-positive bacteria supplied in the Wizard®

Genomic DNA Purification Kit (Promega, Madison, WI, USA) and DNA library

was prepared from total DNA and subsequently was sequenced by llumina

NextSeq500 Sequencer (Genomics Research Hub Laboratory, School of

Biosciences, Cardiff University, UK).

61

Identification of potential insecticidal genes

Genomic raw sequence data were processed and assembled using CLC Genomics

Workbench 10.1.1. Reads were trimmed, filtered by low quality and reads shorter

than 50 bp were removed. Processed reads were de novo assembled using a

stringent criterion of overlap of at least 95 bp of the read and 95% identity and

reads were then mapped back to the contigs for assembly correction. Genes were

predicted using GeneMark (Borodovsky and McIninch, 1993).

To assist the identification process of potential insecticidal toxin proteins, local

BLASTP (Altschul et al., 1990) was deployed against a database built in our

laboratory including the amino acid sequences of known Bt toxins with

insecticidal activity, available at

http://www.lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt (Crickmore et al., 1998,

2019), as well as other proteins of interest such as the enhancins,

metalloproteinases and mosquitocidal toxins available in GenBank.

The software PlasFlow was used for prediction of plasmid sequences from the

assembled contigs (Krawczyk et al., 2017). Alignments of crystal protein

sequences were performed using MUSCLE v3.8.31 (Edgar, 2004). Prediction of

structural conserved domains was carried out using CD-search (Marchler-Bauer

et al., 2017).

Amplification and cloning of a cry7Aa2 gene

A cry7Aa2 gene was amplified by PCR from Bt genomic DNA using primers Fw-

NcoI (5´TCCCATGGGTAATTTAAATAATTTAGGTGGATATGAAGATAGTAATAG3´)

and Rv-His-PstI (5´TCCTGCAGTTAATGATGATGATGATGATGACATAGCTCTTC

CATCAAAAATAACTCTATAC3´) and Phusion High-fidelity DNA polymerase

(NEB). A 6xHis tag was placed in the N-terminal end of the gene. PCR products

were purified by NucleoSpin® Gel and PCR Clean Up kit (Macherey-Nagel Inc.,

62

Bethlehem, PA) and ligated into the pJET plasmid (CloneJET PCR Cloning Kit,

Fermentas, Canada). Ligation products were then electroporated into E. coli XL1

blue cells by using standard protocols (Sambrook and Russell 2001). Colony-PCR

was applied in order to check positive clones from which plasmid DNA was

purified, using the NucleoSpinR plasmid kit (Macherey-Nagel Inc., Bethlehem,

PA), following manufacturer's instructions. Subsequently, pJET plasmids were

verified by sequencing (StabVida, Caparica, Portugal) and digested with the

appropriate combination of restriction enzymes to allow cloning into the pSTABr

vector. Fragments from NcoI and PstI were purified from agarose gels and ligated

into de pre-digested pSTABr vector using the Rapid DNA ligation kit (Thermo

Scientific) to obtain the recombinant plasmid pSTABr-cry7Aa2. Ligation products

were then electroporated into E. coli XL1 blue cells by using standard protocols

(Sambrook and Russell 2001). Positive clones were verified by colony-PCR and

plasmids were purified and verified by digestion. Once pSTABr-cry7Aa2 was

generated, it was introduced into the acrystalliferous Bt strain BMB171.

Bacillus electrocompetent cells were generated by modifying a previously

described protocol (Peng et al., 2009). Briefly, bacteria were grown in 300 ml of

BHI broth at 28°C under shaking conditions (200 rpm) until the culture reached

an OD600 nm value of 0.4. Glycine was added to the culture at 2% and bacterial

cells were incubated for another hour, at 28 ºC, under shaking conditions (200

rpm). Bacterial cells were then kept on ice for 5 minutes, centrifuged for 10

minutes (9000 rpm, 4ºC) and the pellet was washed three times with F buffer

(272mM sucrose, 0.5mM MgCl2, 0.5mM K2HPO4, 0.5mM KH2PO4 pH 7.2). The

bacterial cells pellet was resuspended into 600 µl of ice-cold F buffer. Aliquots of

50 µl were stored at -80 ºC. Plasmids were transformed into Bacillus by

electroporation, as described previously (Lee, 1995). Positive clones were selected

by colony-PCR.

63

Production of spores and crystals from wild and recombinant Bt strains

For both, the wild-type BM311.1 and the recombinant BMB171-Cry7Aa2, single

colonies from LB plates were inoculated in 500 ml of CCY sporulation medium

(Stewart et al., 1981) supplemented with erythromycin for the recombinant strain

and grown, at 28 ºC, under shaking conditions (200 rpm). Crystal formation was

observed daily under an optical microscope at the magnification of x1000. After

two or three days, when about 95% of the cells had lysed, the mixture of spores

and crystals were collected by centrifugation at 9000 g, at 4 ºC, for 10 min. After

being washed with a saline solution (1M NaCl, 10mM EDTA), the mixture was

resuspended in 10mM KCl and kept at 4ºC until required. Protein quantification

was performed by Bradford assay (Bradford, 1976) using bovine serum albumin

(BSA) as standard.

Analysis of crystal proteins

The composition of the crystals produced by the wild (BM311.1) and recombinant

(BMB171-Cry7Aa2) strains were analyzed both in their natural form and once

digested with midgut fluids from L. decemlineata or commercial trypsin. A group

of 10 larvae of L. decemlineata fifth instar larvae were forced to vomit to extract

intestinal secretions and the pH of collected fluids was measured by

MColorpHastTM (VWR International, LLC). Aliquots of 25 µl of spore-crystal

suspension were mixed with 5 µl of insect gut juice and incubated for 2 hours at

37ºC and 200 rpm agitation. Another aliquot was solubilized in vitro in an alkaline

solution (50mM Na2CO3/10 mM DTT, pH 11.3) for 15 min at 37 ºC and then

digested with trypsin (Promega), using a 1/10 ratio (w/w) for 2 hours at 37 ºC.

Samples of spores and crystals, both in their natural state and those previously

digested by digestive fluids or trypsin, were mixed with 2x sample buffer (Bio-

Rad), boiled at 100 ºC for 5 min, and then subjected to electrophoresis as

previously described (Laemmli, 1970), using Criterion TGX™ 4-20% Precast Gel

64

(BIO-RAD). Gels were stained with Coomassie brilliant blue R-250 (Bio-Rad) and

then distained in 30% ethanol and 10% acetic acid.

Leptinotarsa decemlineata rearing and bioassays

The insecticidal activity of the spore and crystal mixtures of both Bt strains,

BM311.1 and BMB171-Cry7Aa2, as well as the BMB171-Cry7Aa2 crystal proteins

previously solubilized and trypsinized in vitro, were tested against L.

decemlineata. The concentration-mortality responses were subsequently

determined using five different protein concentrations, ranging from to 0.24 to

150 µg/ml, in order to estimate the 50% lethal concentration (LC50). In all cases,

small disks of potato leaves were dipped in the spore/crystal mixture, allowed to

air dry and individually placed in wells of a tissue culture plate containing a layer

of 1.5% (w/v) agar to prevent desiccation. Control leaf disks were treated

identically but were not inoculated with crystal proteins. A 6-12 h old larva of L.

decemlineata was placed in each well and incubated at 25±1 ºC. Insect mortality

was recorded 4 days later. For each protein concentration and the control 24

larvae were treated and the complete bioassay was performed on three occasions

using different batches of insects from the colony. The results were subjected to

Probit analysis (Finney 1971) using the POLO-PC program (LeOra Software,

1987).

Nucleotide sequence accession number

The nucleotide sequence data reported in this paper have been deposited in the

GenBank database under accession number SSWY00000000 for the BM311.1

genome and MK840959 for cry7Aa2 gene.

65

RESULTS

Draft genome sequence of the Bacillus thuringiensis BM311.1 strain

The reads obtained from the genomic DNA of the BM311.1 strain were assembled

and produced 359 contigs containing a total of 6,390,221 bp, with a maximum

scaffold size of 276,646 bp, a N50 length of 55,361 bp, and 33.6 % GC content. The

genome of strain BM311.1 contains three cry-like ORFs, two of them located in

different chromosomal contigs while the third one was present on a plasmid. The

two chromosomal ORFs shared less than 30% identity between them and, for

each of them, the closest Cry protein, with less than 20% identity was the product

of the cry60Aa gene, previously described by Sun et al., (Sun et al., 2013) (Table 1).

Neither of these two proteins could be classified in any of the Cry families

currently described in the Bacillus thuringiensis full toxin list (Crickmore et al.,

1998). The third ORF identified shared 98% identity with the cry7Aa1 gene

(Lambert et al., 1992). Therefore, this new cry gene was classified within the cry7

family and, according to the current nomenclature, has been named as Cry7Aa2.

In addition, other potential virulence factors: one mosquitocidal toxin like, two

bacillolysins and four peptidase M4 genes were detected in the genome of

BM311.1 (Table1).

Table 1. Insecticidal protein content of Bacillus thuringiensis BM311.1. Target database Identity (%) MW (kDa) Length (Nº residues) Predicted location

Cry7Aa1 98 129 1138 Plasmid Cry60Aa1 18 35 322 Chromosome Cry60Aa3 19 33 303 Chromosome Mtx-like 94 57 515 Plasmid

Bacillolysin 99 61 556 Chromosome Bacillolysin 96 98 893 Plasmid

Peptidase M4 99 65 583 Chromosome Peptidase M4 99 62 567 Unclassified Peptidase M4 99 62 552 Plasmid Peptidase M4 99 61 566 Chromosome

66

Characterization of Cry7Aa2

The recombinant BMB171-Cry7Aa2 strain harboring cry7Aa2 gene was able to

form large inclusion bodies that could be observed under the optical microscope.

The predicted molecular mass of the Cry7Aa2 protein was 129.4 kDa, which

corresponds to the bands of approximately 130-kDa generated by SDS-PAGE for

the spore/crystal proteins produced by both BM311.1 and BMB171-Cry7Aa2

(Figure 1). When the Cry7Aa2 crystal protoxin was solubilized and activated in

vitro with commercial trypsin, a fragment of approximately 62 kDa was

produced. However, when treated with acidic digestive fluids (pH 5-6) of L.

decemlineata larvae, two main bands of approximately 60 and 65 kDa were

detected.

Figure 1. SDS-PAGE analysis of spore and crystal proteins from Bt strains. (M) molecular weight marker in kDa; (1) Bt strain BM311.1; (2) recombinant Bt strain BMB171-Cry7Aa2; (3); BMB171-Cry7Aa2 crystal protein solubilized and digested with trypsin; (4) BMB171-Cry7Aa2 crystal protein digested with digestive fluids from L. decemlineata.

67

The alignment of the deduced amino acid sequence of Cry7Aa2 with the known

Cry7Aa1 protein revealed that the new protein had 28 different amino acids,

which appear randomly distributed throughout the amino acid sequence of the

protoxin (Figure 2). The analysis of the primary structure of Cry7Aa2 revealed

the presence of eight conserved blocks and the classical structure of three

domains (Figure 2). Two of eleven changes within domain I were located in the

second block of conserved amino acids and three changes were located in non-

conserved blocks within domain II. From six changes detected within domain III,

one of them was located in the fourth conserved block. Finally, only two different

residues were located in C-terminal amino acid sequence, out of the three

domains of the Cry7Aa2 protein.

Figure 2. Alignment of the deduced amino acid sequence of Cry7Aa1 and Cry7Aa2. Non-conserved amino acid residues are shaded. In dark and light grey horizontal bars are shown conserved blocks and structural domains, respectively.

68

Insecticidal activity of Cry7Aa2 for L. decemlineata

To determine the insecticidal activity of Cry7Aa2, mixtures of spores/crystals

from the wild type and recombinant strains and solubilized and trypsinized

proteins from the trypsin activated (TA) strain were used. The protein

concentrations produced by all the strains were normalized and an equal amount

of each of them was used to run toxicity tests on newly hatched L. decemlineata

larvae. A recombinant acrystalliferous strain carrying an “empty” plasmid and

hence, unable to produce crystal, was introduced as a negative control. Following

ingestions of crystal and spore mixtures from both the wild-type BM311.1 and

the recombinant BMB171-Cry7Aa2 strains, L. decemlineata larvae showed high

levels of mortality, whereas none of the control insects died. The estimated LC50

values for BM311.1 and BMB171-Cry7Aa2 strains were 18.8 and 20.8 µg/ml,

respectively (Table 2). However, the LC50 value for Cry7Aa2 protoxins activated

with commercial trypsin was approximately 4-fold lower than when ingested as

a component of the crystal produced by the recombinant BMB171-Cry7Aa2

(Table 2).

Table 2. Insecticidal activity of Bt strains. LC50 values and relative potency of Cry7Aa2 protoxin when ingested, by newly hatched larva of L. decemlineata, as a component of crystals produced by BM311.1 or BMB171-Cry7Aa2 or after toxin activation with trypsin.

Bt strains / protein

Regression lines LC50

(µg/ml) Goodness of fit Relative

potency (a)

Fiducial Limits (95%)

Slope ± SE Intercept ± SE c2 df Lower Upper BM311.1 0.63 ± 0.10 4.19 ± 0.13 18.89 0.99 3 1

BMB171-Cry7Aa2

1.16 ± 0.19 3.46 ± 0.29 20.80 1.18 3 0.91 0.39 2.13

BMB171-Cry7Aa2-TAb

1.99 ± 0.54 3.61 ± 0.53 4.93 1.02 2 3.83 1.57 9.33

(a) The relative potency was expressed as the ratio of the LC50 value for each treatment and the LC50 value of wild-type BM311.1.

69

(b) TA: Trypsin Activated

DISCUSSION

The complete genome of B. thuringiensis wild strain BM311.1 was sequenced and

annotated. This Bt strain contains three putative insecticidal Cry proteins. One of

them showed a 98% amino acid identity with the Cry7Aa1 (Lambert et al., 1992)

and was classified accordingly as Cry7Aa2 (Crickmore et al., 1998). This new gene

was cloned and sequenced and the natural protoxin for which its codes was

found to have insecticidal properties against larvae of L. decemlineata. The other

two ORFs shared less than 30% identity and less than 20% identity with Cry60Aa,

the protein with which they showed the highest identity. These genes need to be

cloned and the corresponding proteins characterized in detail to determine their

insecticidal potential.

The SDS-PAGE analysis showed that the main crystal composition was

represented by a predominant protein band of a molecular mass of

approximately 130 kDa. According to the cry gene content of BM311.1 this band

could only correspond to the expression of the cry7Aa2 gene with a predicted

molecular mass of 130 kDa. However, this analysis did not detect the putative

proteins encoded (predicted molecular weight of 33-35 kDa; Table 1) by the other

two ORFs. Often the proteins encoded by certain cry genes are not part of the

proteins that make up the crystal of a given Bt strain. This may be because these

genes are not expressed, or the level of expression is below the detection capacity

of the SDS-PAGE technique. Another possible explanation is that the proteins are

expressed and secreted into the medium in which the bacteria grows, as is the

case with Cry1I proteins (Tailor et al., 1992). It should be noted that SDS-PAGE

shows a slightly smaller band in size for the Cry7Aa2 recombinant protein when

compared to its wild type counterpart (Figure 1, Line 3). Although the only

difference between them is the presence of a His tag (6xHis) at the C-Terminal of

70

the former, this could be enough to alter its ability to bind SDS and, hence, affect

its migration on the gel.

The complete ORF of the new cry7Aa2 gene was cloned and expressed in the

acrystalliferous strain BMB171-. SDS-PAGE analysis of the spore/crystal mixture

of this recombinant strain generated a predominant 130 kDa protein band similar

to that generated by other proteins of the Cry7 family (Lambert et al., 1992; Song

et al., 2008). When cry7Aa2 was expressed in BMB171, the resulting protein

formed a parasporal crystal of a larger size than the one produced by the wild-

type BM311.1 strain. This result suggests that BMB171 strain may contain

chaperones that improve the expression of the Cry7Aa2 protein, as has already

been reported for other Cry proteins (Shao et al., 2001; Tang et al., 2003). It could

also be attributed to the presence of transcriptional or posttranscriptional

regulation in the wild type BM311.1 strain (Jurat-Fuentes and Jackson 2012).

Despite the differences in the crystal size, the natural Cry7Aa2 and recombinant

Cry7Aa2 showed comparable toxicity levels towards L. decemlineata larvae in

addition to a similar proteolytic processing with the insect’s digestive fluids or

commercial trypsin (data not shown).

Amino acid sequence analysis of Cry7Aa2 showed similar characteristics to those

of other proteins in the Cry7 family and differed in only 28 amino acid residues

from its reference protein, Cry7Aa1 (Lambert et al., 1992). The difference in a few

amino acids can produce very important changes in the insecticidal properties of

Cry toxins. For example, a single amino acid variation between the Cry1Ia1 and

Cry1Ia2 toxins has been associated with the different host spectra of these two

proteins (Gleave et al., 1993).

The bioassays revealed that the Cry7Aa2 protoxin was active against newly

hatched larvae of L. decemlineata when inoculated as a crystal component

produced by both the wild-type BM311.1 and the recombinant BMB171-

71

Cry7Aa2. In contrast, Lambert et al., (Lambert et al., 1992) reported that the

Cry7Aa1 protein showed silent activity towards larvae of L. decemlineata, i.e., the

natural Cry7Aa1 protein was not toxic when ingested as part of the crystal, but

was toxic once solubilized and activated in vitro. These results suggest that the

lack of toxicity can be likely attributed to the lack of solubilization in the acidic

digestive fluids of the coleopteran gut. In contrast, others have reported toxicity

of Cry7Aa1 protoxin (Ekobu et al., 2010) and Cry7Ab3 protoxin (Song et al., 2012)

in other species of Coleoptera that also had acidic digestive fluids, it seems

reasonable to believe that the solubilization of Cry7 proteins must have involved

factors other than pH. Although the solubilization of Cry proteins and their

subsequent proteolytic digestion are determinants of toxicity, the interaction

between the toxin and the appropriate midgut receptors is also necessary for the

formation of the lytic pore (Bravo et al., 2007). Following incubation with insect

digestive juices the Cry7Aa2 protoxin produced two fragments of approximately

60 and 65 kDa. In contrast, when this protoxin was digested with trypsin it

produced a single toxic fragment of approximately 62 kDa. Interestingly, such

fragment showed a toxicity 4-fold greater than when the toxin was activated in

the midgut of L. decemlineata larvae. This indicated that the fragment was derived

from Cry7Aa2 and that the different activation method may be the reason behind

the augmented potency.

The fact that the natural protein Cry7Aa2 was toxic when it is part of the crystal

of the BM311.1 strain represents a clear advantage over the Cry7Aa1 protoxin for

its use in bioinsecticide applications. However, both the Cry7Aa1 and Cry7Aa2

proteins can be efficiently exploited in the construction of transgenic plants since

this technology allows the peptide fragment encoding the toxin to be expressed

directly instead of using the sequence coding for the protoxin. The Cry3 family

or proteins have been frequently used as the active ingredient of a bioinsecticides

as well as for the construction of transgenic plants for the control of coleopteran

72

pests (Perlak et al., 1993; Nowatzki et al., 2009; Park et al., 2009). Although

resistance to Bt has not yet reached the prevalence reported in insects exposed to

chemical pesticides, there is evidence that the extended use of Bt toxins may

accelerate the appearance of insect resistance (Whalon et al., 1993; Bauer, 1995),

so that the characterization of novel Bt toxins is an issue that will likely continue

to attract the attention of insect pathologists and pest control researchers for the

foreseeable future.

73

REFERENCES

Adang MJ, Abdullah MAF, 2013. Enhancement of Bacilus thuringiensis cry protein toxicities to coleopterans, and novel insect cadhetin fragments.pdf. United States Pat. US 8,486,887 B2.

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ, 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410.

Bauer LS, 1995. Resistance: a threat to the insecticidal crystal proteins of Bacillus thuringiensis. Florida Entomol. 78, 414–443.

Borodovsky M, McIninch J, 1993. GENMARK: Parallel gene recognition for both DNA strands. Comput. Chem. 17, 123–133.

Bradford MM, 1976. A Rapid and Sensitive Method for the Quantitation Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 72, 248–254.

Bravo A, Gill SS, Soberón M, 2007. Mode of action of Bacillus thuringiensis Cry and Cyt toxins and their potential for insect control. Toxicon 49, 423–435.

Crickmore N, Baum JA, Bravo A, Lereclus D, Narva KE, Sampson K, Schnepf HE, Sun M, Zeigler DR, 2019. Bacillus thuringiensis toxin nomenclature http://www.btnomenclature.info/

Crickmore N, Zeigler DR, Feitelson J, Schnepf E, Van Rie J, Lereclus D, Baum J, Dean DH, 1998. Revision of the nomenclature for the Bacillus thuringiensis pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 62, 807–13.

Dong Z, Li J, Zheng J, Geng C, Peng D, Sun M, 2016. Complete genome sequence of Bacillus thuringiensis CTC—A typical strain with high production of S-layer proteins. J. Biotechnol. 220, 100–101.

Edgar RC, 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792–7.

Ekobu M, Solera M, Kyamanywa S, Ghislain M, Odongo B, Mwanga ROM, Moar WJ, 2010. Toxicity of seven Bacillus thuringiensis Cry Proteins against Cylas puncticollis and Cylas brunneus (Coleoptera: Brentidae) using a novel artificial diet. J. Econ. Entomol. 103, 1493–1502.

Finney DJ, 1971. Probit analysis. Cambridge Univ. Press. Cambridge, United Kingdom.

Frankenhuyzen K van, 2009. Insecticidal activity of Bacillus thuringiensis crystal proteins. J. Invertebr. Pathol. 101, 1–16.

74

Gleave AP, Williams R, Hedges RJ, 1993. Screening by Polymerase Chain Reaction of Bacillus thuringiensis serotypes for the presence of cryV-Like Insecticidal Protein genes and characterization of a cryV gene cloned from B. thuringiensis subsp. kurstaki. Appl. Environ. Microbiol 59, 1683–1687.

Haffani YZ, Cloutier C, Belzile FJ, 2001. Bacillus thuringiensis Cry3Ca1 protein is toxic to the Colorado Potato Beetle, Leptinotarsa decemlineata (Say). Biotechnol. Prog. 17, 211–216.

Hofmann C, Lüthy P, 1986. Binding and activity of Bacillus thuringiensis delta-endotoxin to invertebrate cells Christina. Arch. Microbiol. 146, 7–11.

Höfte H, Whiteley HR, 1989. Insecticidal crystal proteins of Bacillus thuringiensis. Microbiol. Rev. 53, 242–255.

Iriarte J, Bel Y, Ferrandis MD, Andrew R, Murillo J, Ferré J, Caballero P, 1998. Environmental distribution and diversity of Bacillus thuringiensis in Spain. Syst. Appl. Microbiol. 21, 97–106.

Jurat-Fuentes JL, Jackson TA, 2012. Bacterial Entomopathogens, Insect Pathology.

Krawczyk PS, Lipinski L, Dziembowski A, 2017. PlasFlow: predicting plasmid sequences in metagenomic data using genome signatures. Nucleic Acids Res. 46, e35–e35.

Krieg VA, Huger AM, Langenbruch GA, Schnetter W, 1983. Bacillus thuringiensis var. tenebrionis: ein neuer, gegenüber Larven von Coleopteren wirksamer Pathotyp. Z. ang. Ent 96, 500–508.

Laemmli U, 1970. Most commonly used discontinuous buffer system for SDS electrophoresis. Nature 227, 680–686.

Lambert B, Höfte H, Annys K, Jansens S, Soetaert P, Peferoen M, 1992. Novel Bacillus thuringiensis insecticidal crystal protein with a silent activity against coleopteran larvae. Appl. Environ. Microbiol. 58, 2536–42.

Lee JC, 1995. Electrotransformation of Staphylococci, in: Methods in Molecular Biology. 209–216.

LeOra Software, 1987. POLO-PC: a user’s guide to probit or logit analysis.

Li L, Yang C, Liu Z, Li F, Yu Z, 2000. Screening of acrystalliferous mutants from Bacillus thuringiensis and their transformation properties. Wei Sheng Wu Xue Bao 40, 85–90.

Marchler-Bauer A, Bo Y, Han L, He J, Lanczycki CJ, Lu S, Chitsaz F, Derbyshire MK, Geer RC, Gonzales NR, Gwadz M, Hurwitz DI, Lu F, Marchler GH, Song JS, Thanki N, Wang Z, Yamashita RA, Zhang D, Zheng C, Geer LY, Bryant SH, 2017.

75

CDD/SPARCLE: Functional classification of proteins via subfamily domain architectures. Nucleic Acids Res. 45, D200–D203.

Martin PAW, Travers RS, 1989. Worldwide abundance and distribution of Bacillus thuringiensis isolates. Appl. Environ. Microbiol. 55, 2437–2442.

Nowatzki TM, Zhou X, Meinke LJ, Vaughn T, Siegfried BD, 2009. Effect of <I>Bacillus thuringiensis</I> Cry3Bb1 Protein on the Feeding Behavior and Longevity of Adult Western Corn Rootworms (Coleoptera: Chrysomelidae). J. Econ. Entomol. 99, 927–930.

Park HW, Bideshi DK, Johnson JJ, Federici B a., 1999. Differential enhancement of Cry2A versus Cry11A yields in Bacillus thuringiensis by use of the cry3A STAB mRNA sequence. FEMS Microbiol. Lett. 181, 319–327.

Park Y, Abdullah MAF, Taylor MD, Rahman K, Adang MJ, 2009. Enhancement of Bacillus thuringiensis Cry3Aa and Cry3Bb toxicities to coleopteran larvae by a toxin-binding fragment of an insect cadherin. Appl. Environ. Microbiol. 75, 3086–3092.

Peng D, Luo Y, Guo S, Zeng H, Ju S, Yu Z, Sun M, 2009. Elaboration of an electroporation protocol for large plasmids and wild-type strains of Bacillus thuringiensis. J. Appl. Microbiol. 106, 1849–1858.

Perlak F, Stone T, Muskopf Y, Petersen L, Parker G, McPherson S, Wyman J, Love S, Reed G, Biever D, 1993. Genetically improved potatoes: protection from damage by Colorado potato beetles. Plant Mol Biol. 22, 313–321.

Sambrook J, Russell D, 2001. Molecular Cloning: A Laboratory Manual, Cold Sprin. ed. NY, USA.

Schnepf E, Crickmore N, Van Rie J, Lereclus D, Baum J, Feitelson J, Zeigler DR, Dean DH, 1998. Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 62, 775–806.

Shao Z, Liu Z, Yu Z, 2001. Effects of the 20-Kilodalton helper protein on CrylAc production and spore formation in Bacillus thuringiensis. Appl. Environ. Microbiol. 67, 5362–5369.

Song L, Gao M, Dai S, Wu Y, Yi D, Li R, 2008. Specific activity of a Bacillus thuringiensis strain against Locusta migratoria manilensis. J. Invertebr. Pathol. 98, 169–176.

Song P, Wang Q, Nangong Z, Su J, Ge D, 2012. Identification of Henosepilachna vigintioctomaculata (Coleoptera: Coccinellidae) midgut putative receptor for Bacillus thuringiensis insecticidal Cry7Ab3 toxin. J. Invertebr. Pathol. 109, 318–22.

Stewart GSAB, Johnstonr K, Hagelberg E, Ellar DJ, 1981. Commitment of bacterial spores. Biochem. J. 101–106.

76

Sun Y, Zhao Q, Xia L, Ding X, Hu Q, Federici BA, Park H-W, 2013. Identification and characterization of three previously undescribed Crystal Proteins from Bacillus thuringiensis subsp. jegathesan . Appl. Environ. Microbiol. 79, 3364–3370.

Tailor R, Ely S, Pells S, Gibb G, Tippett J, Jordan L, 1992. Identification and characterization of a novel Bacillus thuringiensis d-endotoxin entomocidal to coleopteran and lepidopteran larvae. Mol. Microbiol. 6, 1211–1217.

Tang MJ, Zeng SL, Chen JW, Shi YX, Xu W, Yuan MJ, Pang Y, 2003. Effects of helper proteins encoded by p19 and orf1-orf2 genes on Cyt1aa protein expression in acrystalliferous strain of Bacillus thuringiensis. Insect Sci. 10, 221–229.

Thomas WE, Ellar DJ, 1983. Mechanism of action of Bacillus thuringiensis var israelensis insecticidal δ-endotoxin. FEBS Lett. 154, 362–368.

Wei J-Z, Hale K, Carta L, Platzer E, Wong C, Fang S-C, Aroian R V., 2003. Bacillus thuringiensis crystal proteins that target nematodes. PNAS 100, 2760–2765.

Whalon ME, Miller IDL, Hollingworth IRM, Milleri JR, 1993. Selection of a Colorado Potato Beetle (Coleoptera : Chrysomelidae) Strain Resistant to Bacillus thuringiensis. Entomol. Soc. Am. 86, 226–233.

Wu Y, Lei CF, Yi D, Liu PM, Gao MY, 2011. Novel Bacillus thuringiensis δ-endotoxin active against Locusta migratoria manilensis. Appl. Environ. Microbiol. 77, 3227–3233.

Documents

Novel Bacillus thuringiensis cry genes and their