of 41 /41
Seqüenciamento e montagem do genoma humano e análise de transcriptoma

Seqüenciamento e montagem do genoma humano e análise de transcriptoma

  • Author
    tariq

  • View
    43

  • Download
    0

Embed Size (px)

DESCRIPTION

Seqüenciamento e montagem do genoma humano e análise de transcriptoma. Seqüenciamento do Genoma Humano. Embate: Consórcio público x Celera genomics: Consórcio público: mapeamento físico, shotgun hieráriquico. Celera genomics: whole genome shotgun - PowerPoint PPT Presentation

Text of Seqüenciamento e montagem do genoma humano e análise de transcriptoma

  • Seqenciamento e montagem do genoma humanoe anlise de transcriptoma

  • Seqenciamento do Genoma HumanoEmbate: Consrcio pblico x Celera genomics:

    Consrcio pblico: mapeamento fsico, shotgun hierriquico.

    Celera genomics: whole genome shotgun

    Em fevereiro de 2001 foi publicada de forma independendente verso draft ou preliminar ambos grupos.

  • Seqenciamento do Genoma Humano2003: Consrcio pblico apresenta verso final do seqenciamento do genoma humanoComprimento total: 3 bilhes pb99% deste total foi seqenciadoErro de seqenciamento estimado em 1/10.000 nt99.9% no apresenta diferenas entre indivduos.25.000 genes Genes codificadores de protenas correspondem a apenas 2% do genoma50 % do genoma consiste de regies repetitivas (D.melanogaster 3%, C.elegans 7%)

  • Celera Genomics Iniciativa privada

    Whole genome shotgun (WGS)GenomaBiblioteca genmicaPlasmdeo (inserto 10 kb)BAC (inserto 100 kb)Seqenciamento das extremidadesdo insertoLeituras ou reads

  • Celera Genomics Iniciativa privada

    Whole genome shotgun (WGS) MontagemAGCGTTA GTTACAAC

    AGCGTTACAAC

  • ContigContigMate pairsCelera Genomics Iniciativa privada

    Whole genome shotgun (WGS) Montagem

  • ContigContigMate pairsBAC contendo inserto demaior comprimentoCelera Genomics Iniciativa privada

    Whole genome shotgun (WGS) Montagem

  • ContigContigMate pairsContigContigScaffoldMate pairsCelera Genomics Iniciativa privada

    Whole genome shotgun (WGS) Montagem

  • Consrcio pblicoMapeamento fsico, shotgun hierrquicoCromossomoBiblioteca genmicaem BAC (inserto 100Kb)Fragmento cromossmicoBiblioteca genmicaem BAC

  • Consrcio pblicoMapeamento fsico, shotgun hierrquicoCromossomoBiblioteca genmicaem BAC (inserto 100Kb)Fragmento cromossmicoBiblioteca genmicaem BAC

  • BACBibliotecaPlasmdeo (inserto 10 kb)Seqenciamento das extremidadesdo insertoLeituras ou readsConsrcio pblicoMapeamento fsico, shotgun hierrquico - Montagem

  • ContigMate pairsAGCGTTA GTTACAAC

    AGCGTTACAACConsrcio pblicoMapeamento fsico, shotgun hierrquico - Montagem

  • Consrcio pblicoMapeamento fsico, shotgun hierrquicoCromossomoBiblioteca genmicaem BAC (inserto 100 kb)

  • Consrcio pblicoMapeamento fsico, shotgun hierrquicoCromossomoBiblioteca genmicaem BAC (inserto 100 kb)

  • Consrcio pblicoMapeamento fsico, shotgun hierrquicoCromossomoBiblioteca genmicaem BAC (inserto 100 kb)

  • Avaliao de estratgias de seqenciamento

    Vantagens WGS

    Estratgia mais simples com menos etapas.

    Vantagens Shotgun Hierrquico

    Menos vulnervel que a estratgia WGS em relao a montagem de regies repetitivas.

  • Avaliao de estratgias de seqenciamentoRepeties no genomaXXCenrio IXMontagemGenoma

    Processo de montagem suscetvel a erros quando empregado em genomas com alto ndice de repetices.WGS: Montagem de 3 bilhes de bases (todo genoma).

    Shotgun hierrquico: Montagem de 100 mil bases (inserto de cada BAC).

  • In silico

  • Base-calling

    Gerao de uma seqncia de nucleotdeos atravs da anlise dos chromatogramas

    PHREDgaattcggcacgagagttctcccggagacgctccgtgcgaagattatggaggccgtcaatgtggtcggttcccgccactttgctcgcctgcgcatcgatgtaacagtccgtggtgacgaagtcataccgttaagtattacgtttttgttgtcgttgttgcagcaatagtagaggacgggcgcttttttttttgtcaagagaaagggggaggggcgtactaccgctttatcgaggttggtattatttcttatatataaagggaaagagcaacgtgaagcgggtaagggaagagtgaaagtcgag

  • Mascaramento

    Eliminar fragmentos de vetor cross_match>5gctccaccgcggtggcggccgctctagaactagtggatcccccgggctgcaggaattcggcacgagagttctcccggagacgctccgtgcgaagattatggaggccgtcaatgtggtcggttcccgccactttgctcgcctgcgcatcgatgtaacagtccgtggtgacgaagtcataccgttaagtattacgtttttgttgtcgttgttgca

    >3gcaatagtagaggacgggcgcttttttttttgtcaagagaaagggggaggggcgtactaccgctttatcgaggttggtattatttcttatatataaagggaaagagcaacgtgaagcgggtaagggaagagtgaaagtcgagggggggcccggtacccaattc

  • Montagem

    Produzir uma seqncia contgua atravs de seqncias menores que possuam regies de sobreposioPHRAP, Celera Assembler, Arachnecontigleituras

  • Anotao

    Localizar na seqencia genmica final: Genes que codificam protenas e RNAs no traduzidos (tRNA, rRNA, snRNA)

    Determinar, se possvel, o produto provvel de cada gene encontrado.

    Associar cada gene uma categoria funcional ou via metablica. Ex.: sntese de lipdeos, maquinaria de traduo, fosforilao oxidativa, etc.

  • Anotao

  • Anotao AutomticaGlimmercontigRBSfindertRNAscanGeneMarkCDS

  • Anotao AutomticaBLAST contra KEGGInterproBLAST contra GenBankPSORTBLAST contra COGAnotao manual

  • Alinhamento

    Determinar o grau de similaridade entre duas ou mais seqncias, ou entre fragmentos de seqncias.

    Inferir homologia entre genes: parlogos, ortlogos.

  • Alinhamento local

    Similaridade pode se ater a regies de cada seqncia

  • BLAST(Basic Local Alignment Search Tool)

    BLASTKEGGCOGGenBankNucleotdeos> SEQ1atgggcacgagagttctcccggagacgctccgtgcgaagattatggaggccgtcaatgtggtcggttcccgccactttgctcgcctgBancos de seqnciasGenBankProtenas

  • BLAST(Basic Local Alignment Search Tool)

    Aldolase Trypanosoma cruzi

    .........1.........2.........3.........4.........5.........6.........7.........8.........9.........10 acaagctggagctcccgcggtggtcggcgctctagaactagtggatcccccgggctgcaggaattcggcacgagaacaacttcaaccgcgtctggaaggc gccacgccgcccgtttgagaaggaacgccttgaccgcgagatgaaactctgcggccagtacggccttcngttgcaacgcgtgagatttggcgccgtgaac atgacgctctccaagatgcgtcgtaccgcccgtctgttgttgacgttgccggagaaccacccgcgccggcagctggagggttccgccatcatgcgccgct gccacgactacggcttcctcgagggggggcccggtacccaattcgccctatagtgagtcgtattacannattcactggccgntcgntnntttacaacgtc gntnngactgggnannaaaccctggnnncgttacccaacttaatcgccttBLAST it!

  • Anotao AutomticaBLAST contra KEGGInterproBLAST contra GenBankPSORTBLAST contra COGAnotao manual

  • Aldolase Trypanosoma cruzi

    .........1.........2.........3.........4.........5.........6.........7.........8.........9.........10 acaagctggagctcccgcggtggtcggcgctctagaactagtggatcccccgggctgcaggaattcggcacgagaacaacttcaaccgcgtctggaaggc gccacgccgcccgtttgagaaggaacgccttgaccgcgagatgaaactctgcggccagtacggccttcngttgcaacgcgtgagatttggcgccgtgaac atgacgctctccaagatgcgtcgtaccgcccgtctgttgttgacgttgccggagaaccacccgcgccggcagctggagggttccgccatcatgcgccgct gccacgactacggcttcctcgagggggggcccggtacccaattcgccctatagtgagtcgtattacannattcactggccgntcgntnntttacaacgtc gntnngactgggnannaaaccctggnnncgttacccaacttaatcgccttInterpro

    Procura na seqncias por domnios, assinaturas ou motivos conhecidos.

    Se utiliza de outros bancos de domnios para produzir seu relatrio final. PFAM, SMART, PROSITE, etcInterpro

  • Anotao AutomticaBLAST contra KEGGInterproBLAST contra GenBankPSORTBLAST contra COGAnotao manual

  • Anotao

    Streptococcus pneumoniae R6

  • SabiSystem for Automated Bacterial Integrated Annotation

    LNCC Coordenao do Projeto Genoma Brasileiro

    Gerenciamento de todos softwares de Base-calling, Mascaramento, Montagem e Anotao automtica.

    Disponibilizao da Anotao automtica dos resultados via Web possibilitando a realizao da Anotao manual por pesquisadores distribudos geograficamente.Exemplo SabiMapa AntesMapa Depois

  • Anlise do transcriptoma

    Projetos que precedem seqenciamento do genoma nuclear:

    Identificao de novos genes.

    Estimativa do perfil de expresso da linhagem celular, estgio de desenvolvimento ou tecido avaliado

  • Transcrio e Transcriptoma

    EST

    RNA totalcstronPoli AmRNACAP53

  • Transcrio e Transcriptoma

    ESTPoli APoli APoli APoli AcDNAVetor + cDNA

  • Transcrio e Transcriptoma

    ESTSequenciamentoextremidades5Poli A3Poli A3 5~ 800 pbVetorVetorVetorVetorcDNA completo

  • Transcrio e Transcriptoma

    ESTRemooSequencia de vetor(cross_match, Lucy)Remoo Poli A (Script Perl)EST5Poli A3VetorVetorPoli AXXX5353

  • Anlise do transcriptoma

    EST AnotaoBLASTXEBLASTNGenBankNucleotdeos>clone_23 5ggcacgagagttctcccggagacgctccgtgcgaagattatggaggccgtcaatgtggtcggttcccgccactttgctcgcctgBancos de seqnciasGenBankProtenas53clone_23 5 = amastina

  • Anlise do transcriptoma

    EST Anotao

    Agrupamento deseqncia similaresouagrupamento via anotao

    Nmero de ESTsAnotao4amastina6TcMUC II

  • Transcrio e Transcriptoma

    Transcriptoma de amastigotas

  • Transcrio e Transcriptoma

    Transcriptoma de amastigotas

    Estrutral em foram de disco onde so armazenadas inmeras cpias do DNA mitocondrialConsiste na procura por sequencias similaresCluster ou sequencia individualCell Surface and MembraneCell cycleCell MotilityDNA MetabolismEnergy MetabolismHeat-shock proteins and chaperonins Kinases and phophatasesOther MetabolismProteases and proteasome

    HistonasProteinas ribossomicasProteinas associadas a fosforilacao oxidativa3 proteinas de superfcie gp85, amastin e mucinasAssim como em outros trabalhos proteinas associadas maquinaria de traducao, proteinas ribossomicas, correspondem a grande parte da expressao